Starting /dee2/code/volunteer_pipeline.sh SRR7692643 current disk space = 1523293224960 free memory = 1580372088 SRR7692643 SRAfilesize 47f18f81cb1bd3ea8e64f18cbd7c1c8f SRR7692643.sra SRR7692643.sra file validated SRR7692643 is paired end SRR7692643 is conventional basespace SRR7692643 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692643_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.474 18.0 18.0 25.0 18.0 32.0 2 29.879 30.0 27.0 31.0 27.0 33.0 3 31.601 33.0 31.0 33.0 29.0 33.0 4 32.46175 33.0 33.0 33.0 31.0 34.0 5 33.12675 33.0 33.0 34.0 32.0 34.0 6 36.97025 38.0 38.0 38.0 35.0 38.0 7 37.15375 38.0 38.0 38.0 36.0 38.0 8 37.22525 38.0 38.0 38.0 36.0 38.0 9 37.36725 38.0 38.0 38.0 37.0 38.0 10-11 37.33975 38.0 38.0 38.0 37.0 38.0 12-13 37.4525 38.0 38.0 38.0 37.0 38.0 14-15 37.394999999999996 38.0 38.0 38.0 37.0 38.0 16-17 37.38825 38.0 38.0 38.0 37.0 38.0 18-19 37.423125 38.0 38.0 38.0 37.0 38.0 20-21 37.386125 38.0 38.0 38.0 37.0 38.0 22-23 37.449125 38.0 38.0 38.0 37.0 38.0 24-25 37.450125 38.0 38.0 38.0 37.0 38.0 26-27 37.335499999999996 38.0 38.0 38.0 37.0 38.0 28-29 37.403499999999994 38.0 38.0 38.0 37.0 38.0 30-31 37.4255 38.0 38.0 38.0 37.0 38.0 32-33 37.497625 38.0 38.0 38.0 37.0 38.0 34-35 37.335375 38.0 38.0 38.0 37.0 38.0 36-37 37.43275 38.0 38.0 38.0 37.0 38.0 38-39 37.412875 38.0 38.0 38.0 37.0 38.0 40-41 37.355374999999995 38.0 38.0 38.0 37.0 38.0 42-43 37.347375 38.0 38.0 38.0 37.0 38.0 44-45 37.426375 38.0 38.0 38.0 37.0 38.0 46-47 37.365624999999994 38.0 38.0 38.0 37.0 38.0 48-49 37.272625000000005 38.0 38.0 38.0 37.0 38.0 50-51 37.345375000000004 38.0 38.0 38.0 37.0 38.0 52-53 37.321124999999995 38.0 38.0 38.0 37.0 38.0 54-55 37.356625 38.0 38.0 38.0 37.0 38.0 56-57 37.348875 38.0 38.0 38.0 37.0 38.0 58-59 37.356625 38.0 38.0 38.0 37.0 38.0 60-61 37.3805 38.0 38.0 38.0 37.0 38.0 62-63 37.36525 38.0 38.0 38.0 37.0 38.0 64-65 37.351124999999996 38.0 38.0 38.0 37.0 38.0 66-67 37.349000000000004 38.0 38.0 38.0 36.5 38.0 68-69 37.34225 38.0 38.0 38.0 37.0 38.0 70-71 37.357625 38.0 38.0 38.0 36.5 38.0 72-73 37.301500000000004 38.0 38.0 38.0 36.0 38.0 74-75 37.249875 38.0 38.0 38.0 36.5 38.0 76-77 37.235125 38.0 38.0 38.0 36.0 38.0 78-79 37.217625 38.0 38.0 38.0 36.0 38.0 80-81 37.236125 38.0 38.0 38.0 36.0 38.0 82-83 37.23175 38.0 38.0 38.0 36.0 38.0 84-85 37.169624999999996 38.0 38.0 38.0 36.0 38.0 86-87 37.125125 38.0 38.0 38.0 36.0 38.0 88-89 37.138374999999996 38.0 38.0 38.0 36.0 38.0 90-91 37.091625 38.0 38.0 38.0 35.5 38.0 92-93 37.07825 38.0 38.0 38.0 36.0 38.0 94-95 36.98125 38.0 38.0 38.0 35.0 38.0 96-97 37.026250000000005 38.0 38.0 38.0 35.0 38.0 98-99 36.929249999999996 38.0 38.0 38.0 35.0 38.0 100-101 36.948125 38.0 38.0 38.0 35.0 38.0 102-103 36.849000000000004 38.0 38.0 38.0 35.0 38.0 104-105 36.79375 38.0 38.0 38.0 35.0 38.0 106-107 36.55137499999999 38.0 38.0 38.0 34.0 38.0 108-109 36.562124999999995 38.0 38.0 38.0 34.0 38.0 110-111 36.649249999999995 38.0 38.0 38.0 34.0 38.0 112-113 36.718500000000006 38.0 38.0 38.0 34.5 38.0 114-115 36.5565 38.0 38.0 38.0 34.0 38.0 116-117 36.54 38.0 38.0 38.0 34.0 38.0 118-119 36.22675 38.0 37.0 38.0 33.0 38.0 120-121 36.477625 38.0 38.0 38.0 34.0 38.0 122-123 36.289 38.0 37.5 38.0 33.5 38.0 124-125 36.313125 38.0 37.5 38.0 33.5 38.0 126 32.075 35.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 6.0 26 11.0 27 4.0 28 6.0 29 19.0 30 22.0 31 30.0 32 50.0 33 74.0 34 116.0 35 222.0 36 571.0 37 2865.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.266801927466396 9.028658381942684 16.282018767435964 38.422520923154956 2 24.2 13.100000000000001 34.2 28.499999999999996 3 22.25 17.125 22.925 37.7 4 26.6 25.0 21.4 27.0 5 24.95 29.349999999999998 23.599999999999998 22.1 6 22.650000000000002 32.15 23.65 21.55 7 20.1 22.3 37.325 20.275000000000002 8 21.85 21.8 29.825000000000003 26.525 9 21.325 21.25 32.475 24.95 10-11 24.45 28.875 23.1625 23.5125 12-13 23.849999999999998 22.7 26.224999999999998 27.224999999999998 14-15 23.400000000000002 24.725 26.375 25.5 16-17 24.3875 24.725 25.674999999999997 25.2125 18-19 23.8875 25.3 25.7875 25.025 20-21 24.1625 24.375 25.2 26.2625 22-23 23.25 25.7125 25.2625 25.775 24-25 24.45 24.5125 25.025 26.0125 26-27 24.281070267566893 25.468867216804203 25.018754688672168 25.23130782695674 28-29 24.325 25.2125 24.5125 25.95 30-31 25.162499999999998 25.35 23.474999999999998 26.0125 32-33 24.6125 24.3125 25.2375 25.837500000000002 34-35 24.639317526031864 25.291682348513362 25.040772801405094 25.02822732404968 36-37 24.1875 25.2125 25.15 25.45 38-39 24.148296593186373 25.012525050100198 24.39879759519038 26.44038076152305 40-41 25.3125 24.3625 24.9125 25.412499999999998 42-43 24.85 24.725 25.0625 25.362499999999997 44-45 23.375 25.4875 25.0125 26.125 46-47 25.100050025012504 24.92496248124062 24.79989994997499 25.175087543771884 48-49 23.705653754544315 25.072082236429736 24.482888303873636 26.739375705152312 50-51 24.962443665498245 24.9749624436655 24.27391086629945 25.78868302453681 52-53 24.76214321482223 24.824737105658485 24.774661992989483 25.63845768652979 54-55 25.53776888444222 24.88744372186093 24.84992496248124 24.72486243121561 56-57 24.193548387096776 25.343835958989747 24.418604651162788 26.04401100275069 58-59 24.143107330497873 24.806104578433825 25.23142356767576 25.819364523392547 60-61 24.2375 24.725 24.4875 26.55 62-63 23.97799724965621 25.365670708838607 24.8906113264158 25.765720715089387 64-65 24.449724862431214 24.899949974987493 24.224612306153077 26.425712856428213 66-67 24.605954465849386 24.380785589191895 24.756067050287715 26.257192894671004 68-69 24.36554569321165 25.103137892236532 24.6530816352044 25.87823477934742 70-71 25.1937984496124 24.618654663665918 24.793698424606152 25.393848462115532 72-73 23.905976494123532 24.99374843710928 24.293573393348336 26.806701675418854 74-75 25.0625 24.2875 24.525 26.125 76-77 24.3 25.112499999999997 25.0 25.587500000000002 78-79 25.174999999999997 24.5 23.7375 26.5875 80-81 24.2 24.7375 24.8625 26.200000000000003 82-83 24.6125 25.3 24.625 25.4625 84-85 24.453056632079008 24.79059882485311 25.053131641455185 25.703212901612705 86-87 25.825 24.025 24.025 26.125 88-89 24.349999999999998 24.9875 24.4125 26.25 90-91 25.528191023877984 23.952994124265533 23.96549568696087 26.553319164895612 92-93 24.668667166791696 24.90622655663916 24.418604651162788 26.006501625406354 94-95 25.343835958989747 24.031007751937985 24.81870467616904 25.806451612903224 96-97 24.6530816352044 23.6029503687961 24.990623827978496 26.753344168021005 98-99 24.6530816352044 23.827978497312163 24.990623827978496 26.52831603950494 100-101 25.790723840480062 24.16552069008626 24.515564445555693 25.528191023877984 102-103 25.137500000000003 24.349999999999998 24.4125 26.1 104-105 25.3125 23.9375 25.337500000000002 25.412499999999998 106-107 25.587500000000002 24.6 24.1875 25.624999999999996 108-109 25.387500000000003 24.637500000000003 24.5 25.474999999999998 110-111 25.3125 24.65 23.8625 26.174999999999997 112-113 25.25 25.0625 23.7875 25.900000000000002 114-115 25.6 24.275 23.9125 26.2125 116-117 24.95 24.9125 24.3625 25.775 118-119 25.4875 24.8125 24.6 25.1 120-121 25.387500000000003 24.625 23.962500000000002 26.025 122-123 25.3 24.45 24.1125 26.137500000000003 124-125 25.6 24.4375 24.337500000000002 25.624999999999996 126 25.874999999999996 24.325 23.775 26.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 1.0 27 0.0 28 0.0 29 1.5 30 2.5 31 10.0 32 20.5 33 23.5 34 31.0 35 43.5 36 50.0 37 64.5 38 84.0 39 102.0 40 132.0 41 150.0 42 156.0 43 169.5 44 186.5 45 189.5 46 189.0 47 188.5 48 163.5 49 150.5 50 146.0 51 132.5 52 115.5 53 105.5 54 99.5 55 79.5 56 67.5 57 70.5 58 81.0 59 78.5 60 78.5 61 89.0 62 83.5 63 64.5 64 59.5 65 59.5 66 55.5 67 59.0 68 61.5 69 54.0 70 41.5 71 34.5 72 34.5 73 35.0 74 28.0 75 20.5 76 15.0 77 13.0 78 11.0 79 6.5 80 4.5 81 3.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.36250000000000004 36-37 0.0 38-39 0.2 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.05 48-49 0.2875 50-51 0.15 52-53 0.15 54-55 0.05 56-57 0.025 58-59 0.075 60-61 0.0 62-63 0.0125 64-65 0.05 66-67 0.075 68-69 0.0125 70-71 0.025 72-73 0.025 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.025 94-95 0.025 96-97 0.0125 98-99 0.0125 100-101 0.0125 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.6802721088435374 1.35 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692643 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692643_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75625 33.0 33.0 34.0 32.0 34.0 2 32.802 33.0 33.0 34.0 32.0 34.0 3 32.773 33.0 33.0 34.0 32.0 34.0 4 32.64125 33.0 33.0 34.0 31.0 34.0 5 32.682 33.0 33.0 34.0 32.0 34.0 6 36.827 38.0 38.0 38.0 35.0 38.0 7 36.745 38.0 38.0 38.0 35.0 38.0 8 36.708 38.0 38.0 38.0 35.0 38.0 9 36.66575 38.0 38.0 38.0 35.0 38.0 10-11 36.825500000000005 38.0 38.0 38.0 36.0 38.0 12-13 36.869625 38.0 38.0 38.0 36.0 38.0 14-15 36.578500000000005 38.0 38.0 38.0 34.5 38.0 16-17 36.805875 38.0 38.0 38.0 35.5 38.0 18-19 36.725750000000005 38.0 38.0 38.0 35.5 38.0 20-21 36.846875 38.0 38.0 38.0 36.0 38.0 22-23 36.735125 38.0 38.0 38.0 35.0 38.0 24-25 36.820875 38.0 38.0 38.0 35.5 38.0 26-27 36.832125 38.0 38.0 38.0 36.0 38.0 28-29 36.912625 38.0 38.0 38.0 36.0 38.0 30-31 36.97425 38.0 38.0 38.0 36.0 38.0 32-33 36.91825 38.0 38.0 38.0 36.0 38.0 34-35 36.90175 38.0 38.0 38.0 36.0 38.0 36-37 36.9935 38.0 38.0 38.0 36.0 38.0 38-39 37.018125 38.0 38.0 38.0 36.0 38.0 40-41 36.988875 38.0 38.0 38.0 36.0 38.0 42-43 36.946875000000006 38.0 38.0 38.0 36.0 38.0 44-45 36.908500000000004 38.0 38.0 38.0 36.0 38.0 46-47 36.92825 38.0 38.0 38.0 36.0 38.0 48-49 36.981 38.0 38.0 38.0 36.0 38.0 50-51 36.951625 38.0 38.0 38.0 35.5 38.0 52-53 37.015 38.0 38.0 38.0 36.0 38.0 54-55 36.9255 38.0 38.0 38.0 36.0 38.0 56-57 36.963625 38.0 38.0 38.0 36.0 38.0 58-59 36.97625 38.0 38.0 38.0 36.0 38.0 60-61 36.968 38.0 38.0 38.0 36.0 38.0 62-63 36.886875 38.0 38.0 38.0 36.0 38.0 64-65 36.904624999999996 38.0 38.0 38.0 36.0 38.0 66-67 36.91475 38.0 38.0 38.0 36.0 38.0 68-69 36.870125 38.0 38.0 38.0 35.5 38.0 70-71 36.8435 38.0 38.0 38.0 35.5 38.0 72-73 36.85825 38.0 38.0 38.0 36.0 38.0 74-75 36.8005 38.0 38.0 38.0 35.0 38.0 76-77 36.78125 38.0 38.0 38.0 35.0 38.0 78-79 36.799 38.0 38.0 38.0 35.5 38.0 80-81 36.771375000000006 38.0 38.0 38.0 35.5 38.0 82-83 36.79475 38.0 38.0 38.0 35.0 38.0 84-85 36.6475 38.0 38.0 38.0 34.5 38.0 86-87 36.712 38.0 38.0 38.0 35.0 38.0 88-89 36.731375 38.0 38.0 38.0 35.0 38.0 90-91 36.636125 38.0 38.0 38.0 35.0 38.0 92-93 36.636750000000006 38.0 38.0 38.0 35.0 38.0 94-95 36.661125 38.0 38.0 38.0 35.0 38.0 96-97 36.60125 38.0 38.0 38.0 35.0 38.0 98-99 36.548 38.0 38.0 38.0 34.0 38.0 100-101 36.505250000000004 38.0 38.0 38.0 34.0 38.0 102-103 36.486125 38.0 38.0 38.0 34.0 38.0 104-105 36.303375 38.0 38.0 38.0 34.0 38.0 106-107 36.25875 38.0 38.0 38.0 34.0 38.0 108-109 36.19175 38.0 38.0 38.0 33.5 38.0 110-111 36.311 38.0 38.0 38.0 34.0 38.0 112-113 36.231875 38.0 38.0 38.0 33.5 38.0 114-115 36.142125 38.0 38.0 38.0 33.5 38.0 116-117 35.927499999999995 38.0 37.0 38.0 32.0 38.0 118-119 35.97575 38.0 37.5 38.0 32.5 38.0 120-121 35.8985 38.0 37.0 38.0 31.0 38.0 122-123 35.551500000000004 38.0 36.0 38.0 30.0 38.0 124-125 35.3555 38.0 35.5 38.0 29.5 38.0 126 30.536 33.0 26.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 6.0 17 12.0 18 14.0 19 14.0 20 7.0 21 5.0 22 7.0 23 5.0 24 11.0 25 9.0 26 9.0 27 15.0 28 23.0 29 21.0 30 40.0 31 46.0 32 55.0 33 72.0 34 110.0 35 183.0 36 467.0 37 2869.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.25 16.25 12.4 34.1 2 27.55 24.0 27.325 21.125 3 24.325 24.425 25.8 25.45 4 27.200000000000003 29.675 19.075 24.05 5 27.825 31.7 19.35 21.125 6 22.85 34.35 19.5 23.3 7 23.150000000000002 18.025 34.1 24.725 8 24.95 22.375 24.099999999999998 28.575 9 23.9 20.974999999999998 27.750000000000004 27.375 10-11 26.55 26.937499999999996 20.5875 25.924999999999997 12-13 26.3625 21.5 24.9125 27.224999999999998 14-15 24.65 24.474999999999998 25.387500000000003 25.4875 16-17 26.6 24.0125 23.5125 25.874999999999996 18-19 25.1 24.625 24.3 25.974999999999998 20-21 25.7125 25.324999999999996 23.825 25.137500000000003 22-23 25.7 24.7 23.8625 25.7375 24-25 26.575 25.0125 23.95 24.462500000000002 26-27 25.837500000000002 25.387500000000003 23.5875 25.1875 28-29 26.25 24.1875 24.4875 25.074999999999996 30-31 25.525 24.425 24.9375 25.112499999999997 32-33 25.1875 25.0625 24.462500000000002 25.2875 34-35 25.912499999999998 24.675 24.2375 25.174999999999997 36-37 26.575 23.400000000000002 24.337500000000002 25.687500000000004 38-39 25.8 24.75 25.162499999999998 24.2875 40-41 26.25 24.5625 24.05 25.137500000000003 42-43 25.95 23.974999999999998 24.9375 25.137500000000003 44-45 25.5625 25.55 24.25 24.637500000000003 46-47 25.9875 25.35 23.625 25.0375 48-49 25.650000000000002 23.5375 24.8625 25.95 50-51 26.0375 25.0375 23.962500000000002 24.962500000000002 52-53 26.700000000000003 24.775 24.2625 24.2625 54-55 25.587500000000002 24.425 24.725 25.2625 56-57 25.7625 24.6875 24.3125 25.2375 58-59 26.85 24.0625 24.1875 24.9 60-61 25.7875 24.6875 24.0 25.525 62-63 25.724999999999998 24.525 24.625 25.124999999999996 64-65 26.5 23.8875 23.962500000000002 25.650000000000002 66-67 25.974999999999998 24.587500000000002 23.962500000000002 25.474999999999998 68-69 24.6 26.0625 24.6875 24.65 70-71 26.450000000000003 24.5 23.825 25.224999999999998 72-73 24.85 24.75 25.587500000000002 24.8125 74-75 26.400000000000002 24.9125 24.825 23.8625 76-77 25.887500000000003 23.75 24.3625 26.0 78-79 27.1 24.3 24.025 24.575 80-81 26.125 25.15 23.9125 24.8125 82-83 26.950000000000003 23.7 24.8625 24.4875 84-85 26.9125 25.4625 24.2875 23.3375 86-87 26.075 24.975 24.099999999999998 24.85 88-89 26.474999999999998 24.25 24.337500000000002 24.9375 90-91 25.887500000000003 24.087500000000002 25.0125 25.0125 92-93 25.662499999999998 25.5 24.7 24.1375 94-95 25.3125 24.712500000000002 25.05 24.925 96-97 25.874999999999996 23.7375 25.3125 25.074999999999996 98-99 26.275 24.8125 25.25 23.6625 100-101 26.55 24.8625 24.6625 23.925 102-103 25.95 24.5 25.337500000000002 24.212500000000002 104-105 24.9875 25.025 25.3125 24.675 106-107 25.912499999999998 24.4125 24.775 24.9 108-109 25.5125 24.4875 25.674999999999997 24.325 110-111 24.9 25.337500000000002 25.35 24.4125 112-113 26.450000000000003 25.35 23.5625 24.637500000000003 114-115 25.912499999999998 24.6125 25.45 24.025 116-117 26.4625 25.3125 24.637500000000003 23.5875 118-119 26.7625 25.1 23.9125 24.224999999999998 120-121 26.26578322290286 25.128141017627204 24.290536317039628 24.315539442430303 122-123 26.40070035017509 26.32566283141571 24.12456228114057 23.149074537268636 124-125 27.97849731216402 25.17814726840855 23.29041130141268 23.55294411801475 126 26.625 26.474999999999998 23.425 23.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.5 19 1.0 20 0.5 21 2.0 22 2.0 23 1.5 24 1.5 25 2.5 26 2.5 27 1.5 28 1.5 29 1.5 30 4.5 31 10.5 32 14.0 33 18.5 34 27.5 35 36.0 36 44.0 37 54.5 38 71.0 39 95.0 40 113.0 41 138.5 42 153.5 43 157.0 44 165.0 45 173.0 46 189.0 47 180.5 48 163.0 49 152.5 50 143.0 51 140.5 52 124.0 53 98.5 54 79.5 55 82.5 56 90.0 57 81.0 58 80.5 59 85.5 60 93.5 61 96.0 62 87.5 63 78.0 64 68.0 65 63.5 66 71.0 67 74.0 68 65.0 69 53.0 70 44.0 71 40.0 72 39.0 73 35.5 74 29.0 75 21.0 76 13.5 77 12.0 78 8.5 79 6.5 80 5.5 81 3.5 82 2.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0125 122-123 0.05 124-125 0.0125 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49634852681945 98.775 2 0.4029211785444472 0.8 3 0.0503651473180559 0.15 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02518257365902795 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.11249999999999999 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114 2.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCTTC 15 0.0039514517 60.000004 24-25 >>END_MODULE Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881921 spots for SRR7692643.sra Written 881921 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra Read 881914 spots for SRR7692643.sra Written 881914 spots for SRR7692643.sra SRR ids: ['SRR7692643.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sricdsgj SRR7692643.sra spots: 17638287 blocks: [[1, 881914], [881915, 1763828], [1763829, 2645742], [2645743, 3527656], [3527657, 4409570], [4409571, 5291484], [5291485, 6173398], [6173399, 7055312], [7055313, 7937226], [7937227, 8819140], [8819141, 9701054], [9701055, 10582968], [10582969, 11464882], [11464883, 12346796], [12346797, 13228710], [13228711, 14110624], [14110625, 14992538], [14992539, 15874452], [15874453, 16756366], [16756367, 17638287]] SRR7692643 file size 5630089 SRR7692643 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692643 SRR7692643_1.fastq SRR7692643_2.fastq Input file: SRR7692643_1.fastq Paired file: SRR7692643_2.fastq trimmed: SRR7692643-trimmed-pair1.fastq, SRR7692643-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 15:56:22 2024 >> started Mon Dec 9 15:56:39 2024 >> done (17.721s) 17638287 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 92 ( 0.00%) empty read pairs filtered out after trimming by size control 17638191 (100.00%) read pairs available; of these: 1229311 ( 6.97%) trimmed read pairs available after processing 16408880 (93.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 5 0.00% 34 5 0.00% 35 3 0.00% 36 1 0.00% 37 4 0.00% 38 9 0.00% 39 10 0.00% 40 9 0.00% 41 10 0.00% 42 11 0.00% 43 14 0.00% 44 12 0.00% 45 11 0.00% 46 14 0.00% 47 32 0.00% 48 21 0.00% 49 26 0.00% 50 34 0.00% 51 32 0.00% 52 34 0.00% 53 39 0.00% 54 40 0.00% 55 42 0.00% 56 37 0.00% 57 48 0.00% 58 87 0.00% 59 83 0.00% 60 96 0.00% 61 123 0.00% 62 108 0.00% 63 136 0.00% 64 153 0.00% 65 178 0.00% 66 195 0.00% 67 214 0.00% 68 231 0.00% 69 243 0.00% 70 278 0.00% 71 316 0.00% 72 342 0.00% 73 401 0.00% 74 501 0.00% 75 527 0.00% 76 600 0.00% 77 652 0.00% 78 775 0.00% 79 821 0.00% 80 976 0.01% 81 1192 0.01% 82 1313 0.01% 83 1530 0.01% 84 1729 0.01% 85 1916 0.01% 86 2231 0.01% 87 2516 0.01% 88 2831 0.02% 89 3059 0.02% 90 3457 0.02% 91 3987 0.02% 92 4471 0.03% 93 5334 0.03% 94 6187 0.04% 95 6940 0.04% 96 7678 0.04% 97 8802 0.05% 98 9729 0.06% 99 10728 0.06% 100 12174 0.07% 101 13371 0.08% 102 15459 0.09% 103 17010 0.10% 104 19117 0.11% 105 21094 0.12% 106 23192 0.13% 107 25296 0.14% 108 27679 0.16% 109 30110 0.17% 110 32568 0.18% 111 35381 0.20% 112 39035 0.22% 113 41523 0.24% 114 44887 0.25% 115 49004 0.28% 116 52277 0.30% 117 55562 0.32% 118 58827 0.33% 119 61117 0.35% 120 65421 0.37% 121 69366 0.39% 122 73408 0.42% 123 78145 0.44% 124 83933 0.48% 125 90179 0.51% 126 16408880 93.03% 17638191 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=4.83 fanout-score-rank=10 prefix-density=0.54 prefix-fanout=3.9 sequence=AGGTTCTCGAGGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=18.46 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.6 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=18 prefix-density=0.42 prefix-fanout=3.0 sequence=CCCTCGAGAACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=49.45 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCC SRR7692643 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 15:57:23 Started mapping on | Dec 09 15:57:23 Finished on | Dec 09 15:58:47 Mapping speed, Million of reads per hour | 755.92 Number of input reads | 17638191 Average input read length | 250 UNIQUE READS: Uniquely mapped reads number | 17101517 Uniquely mapped reads % | 96.96% Average mapped length | 249.81 Number of splices: Total | 14577032 Number of splices: Annotated (sjdb) | 13838689 Number of splices: GT/AG | 14374053 Number of splices: GC/AG | 180219 Number of splices: AT/AC | 5173 Number of splices: Non-canonical | 17587 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 199721 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 12294 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.49% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 336953 336953 336953 N_multimapping 199721 199721 199721 N_noFeature 583614 16669500 680831 N_ambiguous 386789 1643 52017 UnstrandedReadsAssigned:16131114 PositiveStrandReadsAssigned:430374 NegativeStrandReadsAssigned:16368669 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692643 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692643-trimmed-pair1.fastq SRR7692643-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,638,191 reads, 16,511,536 reads pseudoaligned [quant] estimated average fragment length: 165.314 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 SRR7692643.ke.tsv 35125 SRR7692643.se.tsv 88098 total ==> SRR7692643.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 771.846 0 0 PNS24247 1044 879.686 38.2757 3.79446 PNS24249 1928 1763.69 102.385 5.06255 PNS24246 1044 879.686 38.2757 3.79446 PNS24248 1044 879.686 38.2757 3.79446 PNS24244 1471 1306.69 60.7875 4.05692 PNS24243 293 130.562 0 0 KQK14069 1603 1438.69 4826.31 292.552 KQK14071 474 310.98 164.13 46.0267 ==> SRR7692643.se.tsv <== BRADI_1g14170v3 5204 BRADI_1g53295v3 79 BRADI_1g59795v3 514 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 138 BRADI_1g74790v3 157 BRADI_1g09890v3 0 BRADI_1g77505v3 312 BRADI_1g48960v3 0 SRR7692643 completed mapping pipeline successfully