Starting /dee2/code/volunteer_pipeline.sh SRR7692646 current disk space = 1523193716736 free memory = 1336170356 SRR7692646 SRAfilesize 2d7ef96f806c7e6f290fe364f8e12854 SRR7692646.sra SRR7692646.sra file validated SRR7692646 is paired end SRR7692646 is conventional basespace SRR7692646 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692646_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74975 33.0 33.0 34.0 32.0 34.0 2 32.72575 33.0 33.0 34.0 32.0 34.0 3 32.8035 33.0 33.0 34.0 32.0 34.0 4 32.7435 33.0 33.0 34.0 32.0 34.0 5 32.73225 33.0 33.0 34.0 32.0 34.0 6 36.828 38.0 38.0 38.0 36.0 38.0 7 36.78625 38.0 38.0 38.0 35.0 38.0 8 36.7285 38.0 38.0 38.0 35.0 38.0 9 36.683 38.0 38.0 38.0 35.0 38.0 10-11 36.851375000000004 38.0 38.0 38.0 35.0 38.0 12-13 36.842749999999995 38.0 38.0 38.0 36.0 38.0 14-15 36.6915 38.0 38.0 38.0 35.0 38.0 16-17 36.801625 38.0 38.0 38.0 35.5 38.0 18-19 36.764875 38.0 38.0 38.0 35.5 38.0 20-21 36.845375 38.0 38.0 38.0 35.5 38.0 22-23 36.8065 38.0 38.0 38.0 36.0 38.0 24-25 36.832750000000004 38.0 38.0 38.0 35.0 38.0 26-27 36.889375 38.0 38.0 38.0 35.5 38.0 28-29 36.895375 38.0 38.0 38.0 36.0 38.0 30-31 36.992374999999996 38.0 38.0 38.0 36.0 38.0 32-33 36.919375 38.0 38.0 38.0 36.0 38.0 34-35 36.92375 38.0 38.0 38.0 36.0 38.0 36-37 36.976375000000004 38.0 38.0 38.0 36.0 38.0 38-39 36.985375000000005 38.0 38.0 38.0 36.0 38.0 40-41 37.042 38.0 38.0 38.0 36.0 38.0 42-43 37.0425 38.0 38.0 38.0 36.0 38.0 44-45 37.024 38.0 38.0 38.0 36.0 38.0 46-47 36.994125 38.0 38.0 38.0 36.0 38.0 48-49 36.997625 38.0 38.0 38.0 36.0 38.0 50-51 37.009125 38.0 38.0 38.0 36.0 38.0 52-53 37.049375 38.0 38.0 38.0 36.0 38.0 54-55 36.955124999999995 38.0 38.0 38.0 36.0 38.0 56-57 36.943125 38.0 38.0 38.0 36.0 38.0 58-59 37.07575 38.0 38.0 38.0 36.0 38.0 60-61 36.988625 38.0 38.0 38.0 36.0 38.0 62-63 36.9835 38.0 38.0 38.0 36.0 38.0 64-65 36.957625 38.0 38.0 38.0 36.0 38.0 66-67 36.92075 38.0 38.0 38.0 36.0 38.0 68-69 36.871875 38.0 38.0 38.0 36.0 38.0 70-71 36.87 38.0 38.0 38.0 36.0 38.0 72-73 36.94725 38.0 38.0 38.0 36.0 38.0 74-75 36.838125000000005 38.0 38.0 38.0 36.0 38.0 76-77 36.791875000000005 38.0 38.0 38.0 35.0 38.0 78-79 36.763999999999996 38.0 38.0 38.0 35.0 38.0 80-81 36.725624999999994 38.0 38.0 38.0 35.0 38.0 82-83 36.758125 38.0 38.0 38.0 35.0 38.0 84-85 36.685249999999996 38.0 38.0 38.0 35.0 38.0 86-87 36.72775 38.0 38.0 38.0 35.0 38.0 88-89 36.66925 38.0 38.0 38.0 34.5 38.0 90-91 36.67725 38.0 38.0 38.0 35.0 38.0 92-93 36.586875 38.0 38.0 38.0 34.5 38.0 94-95 36.613125 38.0 38.0 38.0 34.5 38.0 96-97 36.585750000000004 38.0 38.0 38.0 34.0 38.0 98-99 36.509249999999994 38.0 38.0 38.0 34.0 38.0 100-101 36.371125 38.0 38.0 38.0 34.0 38.0 102-103 36.5355 38.0 38.0 38.0 34.0 38.0 104-105 36.343374999999995 38.0 38.0 38.0 34.0 38.0 106-107 36.247749999999996 38.0 38.0 38.0 34.0 38.0 108-109 36.177125000000004 38.0 38.0 38.0 33.5 38.0 110-111 36.249625 38.0 38.0 38.0 33.5 38.0 112-113 36.113625 38.0 38.0 38.0 33.0 38.0 114-115 36.034 38.0 37.0 38.0 33.0 38.0 116-117 35.84225000000001 38.0 36.5 38.0 31.0 38.0 118-119 35.851124999999996 38.0 36.5 38.0 31.0 38.0 120-121 35.819625 38.0 37.0 38.0 31.0 38.0 122-123 35.47825 38.0 36.0 38.0 29.0 38.0 124-125 35.091 38.0 35.0 38.0 28.0 38.0 126 30.3245 33.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 7.0 18 6.0 19 8.0 20 14.0 21 8.0 22 4.0 23 8.0 24 10.0 25 21.0 26 12.0 27 23.0 28 26.0 29 22.0 30 23.0 31 50.0 32 59.0 33 76.0 34 98.0 35 205.0 36 467.0 37 2851.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.55 16.5 12.375 35.575 2 27.750000000000004 23.575 27.925 20.75 3 23.225 25.3 24.95 26.525 4 26.35 30.025000000000002 19.7 23.925 5 27.900000000000002 31.45 19.575 21.075 6 23.0 32.725 20.325 23.95 7 23.9 17.175 34.125 24.8 8 23.425 23.0 23.200000000000003 30.375000000000004 9 24.425 21.65 27.3 26.625 10-11 26.5625 26.487500000000004 20.875 26.075 12-13 26.375 21.9 24.7 27.025 14-15 25.124999999999996 24.6875 24.775 25.412499999999998 16-17 26.3 23.5625 23.95 26.187500000000004 18-19 26.35 23.9875 23.974999999999998 25.687500000000004 20-21 25.025 24.75 24.5625 25.662499999999998 22-23 25.4375 25.0 24.65 24.9125 24-25 25.662499999999998 24.3875 24.375 25.575 26-27 25.362499999999997 24.462500000000002 24.925 25.25 28-29 26.625 24.325 23.525 25.525 30-31 25.1875 25.45 24.1625 25.2 32-33 24.625 23.9 25.3125 26.1625 34-35 26.424999999999997 25.1875 23.125 25.2625 36-37 25.8125 24.275 24.175 25.7375 38-39 25.0 24.587500000000002 24.0 26.4125 40-41 26.1 24.0125 24.762500000000003 25.124999999999996 42-43 25.924999999999997 24.275 24.15 25.650000000000002 44-45 24.85 23.575 25.75 25.825 46-47 25.387500000000003 25.575 24.2 24.837500000000002 48-49 26.887499999999996 24.1625 24.1375 24.8125 50-51 25.3125 24.95 24.9 24.837500000000002 52-53 25.424999999999997 24.637500000000003 24.7375 25.2 54-55 26.737499999999997 24.349999999999998 25.087500000000002 23.825 56-57 26.275 24.224999999999998 24.8125 24.6875 58-59 26.0625 25.5375 23.7125 24.6875 60-61 25.937500000000004 24.3 23.962500000000002 25.8 62-63 25.0 25.5125 24.7875 24.7 64-65 26.75 23.875 24.462500000000002 24.9125 66-67 25.637500000000003 24.6875 24.525 25.15 68-69 24.887500000000003 25.112499999999997 24.3875 25.6125 70-71 25.8 24.2 24.5125 25.4875 72-73 26.2875 23.5625 25.25 24.9 74-75 25.7375 24.05 25.624999999999996 24.587500000000002 76-77 25.874999999999996 24.375 24.5 25.25 78-79 25.362499999999997 25.0125 25.412499999999998 24.212500000000002 80-81 25.874999999999996 25.35 23.7125 25.0625 82-83 26.1 23.8875 24.6875 25.324999999999996 84-85 26.5125 23.95 25.15 24.3875 86-87 25.2875 24.462500000000002 25.0125 25.2375 88-89 26.5625 24.0375 23.9375 25.4625 90-91 26.25 24.325 25.4625 23.962500000000002 92-93 25.724999999999998 24.762500000000003 25.0125 24.5 94-95 26.0625 25.575 23.3625 25.0 96-97 25.4875 25.7 24.575 24.2375 98-99 26.9625 24.25 24.837500000000002 23.95 100-101 26.0375 24.099999999999998 25.362499999999997 24.5 102-103 25.624999999999996 25.3125 24.8 24.2625 104-105 25.112499999999997 24.875 25.112499999999997 24.9 106-107 26.237500000000004 24.7375 24.05 24.975 108-109 25.162499999999998 24.6 25.5375 24.7 110-111 25.775 25.0125 25.087500000000002 24.125 112-113 26.0625 25.124999999999996 24.712500000000002 24.099999999999998 114-115 25.75 25.412499999999998 24.462500000000002 24.375 116-117 25.900000000000002 24.15 25.662499999999998 24.2875 118-119 25.7875 25.35 24.887500000000003 23.974999999999998 120-121 26.269067266816705 24.69367341835459 25.30632658164541 23.730932733183295 122-123 26.7017017017017 25.312812812812812 24.6996996996997 23.285785785785787 124-125 26.456614153538382 25.431357839459867 24.218554638659665 23.893473368342086 126 27.075 26.174999999999997 23.25 23.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 0.5 25 1.5 26 1.0 27 0.5 28 2.5 29 4.0 30 7.5 31 9.5 32 15.5 33 22.0 34 25.0 35 27.5 36 36.5 37 54.5 38 70.5 39 88.5 40 108.5 41 138.0 42 166.0 43 159.0 44 168.5 45 195.5 46 170.5 47 158.5 48 160.0 49 145.0 50 135.5 51 145.0 52 135.0 53 118.5 54 107.0 55 90.0 56 89.5 57 94.0 58 94.5 59 87.0 60 95.5 61 88.5 62 82.0 63 82.0 64 73.0 65 75.5 66 70.5 67 58.0 68 49.5 69 45.5 70 47.0 71 43.0 72 33.0 73 26.5 74 22.5 75 21.5 76 16.5 77 7.5 78 8.0 79 7.0 80 3.0 81 2.0 82 2.0 83 1.5 84 1.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.025 122-123 0.1 124-125 0.025 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06542056074767 98.05 2 0.8335438241980297 1.6500000000000001 3 0.10103561505430665 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114 1.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692646 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692646_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.19425 32.0 25.0 33.0 18.0 33.0 2 28.321 29.0 27.0 33.0 18.0 33.0 3 30.91625 33.0 30.0 33.0 27.0 33.0 4 32.215 33.0 33.0 33.0 30.0 33.0 5 32.37975 33.0 33.0 33.0 32.0 34.0 6 36.24875 38.0 36.0 38.0 33.0 38.0 7 36.5945 38.0 37.0 38.0 34.0 38.0 8 36.5585 38.0 37.0 38.0 34.0 38.0 9 37.15775 38.0 38.0 38.0 36.0 38.0 10-11 37.2215 38.0 38.0 38.0 36.0 38.0 12-13 37.345749999999995 38.0 38.0 38.0 37.0 38.0 14-15 37.3305 38.0 38.0 38.0 37.0 38.0 16-17 37.321124999999995 38.0 38.0 38.0 37.0 38.0 18-19 37.39775 38.0 38.0 38.0 37.0 38.0 20-21 37.384 38.0 38.0 38.0 37.0 38.0 22-23 37.41575 38.0 38.0 38.0 37.0 38.0 24-25 37.434 38.0 38.0 38.0 37.0 38.0 26-27 37.393625 38.0 38.0 38.0 37.0 38.0 28-29 37.40425 38.0 38.0 38.0 37.0 38.0 30-31 37.4525 38.0 38.0 38.0 37.0 38.0 32-33 37.457125 38.0 38.0 38.0 37.0 38.0 34-35 37.222375 38.0 38.0 38.0 37.0 38.0 36-37 37.410250000000005 38.0 38.0 38.0 37.0 38.0 38-39 37.41375 38.0 38.0 38.0 37.0 38.0 40-41 37.379625000000004 38.0 38.0 38.0 37.0 38.0 42-43 37.28675 38.0 38.0 38.0 36.5 38.0 44-45 37.355000000000004 38.0 38.0 38.0 37.0 38.0 46-47 37.321125 38.0 38.0 38.0 37.0 38.0 48-49 37.273625 38.0 38.0 38.0 37.0 38.0 50-51 37.317625 38.0 38.0 38.0 37.0 38.0 52-53 37.362375 38.0 38.0 38.0 37.0 38.0 54-55 37.338875 38.0 38.0 38.0 37.0 38.0 56-57 37.224625 38.0 38.0 38.0 37.0 38.0 58-59 37.267375 38.0 38.0 38.0 37.0 38.0 60-61 37.309625 38.0 38.0 38.0 37.0 38.0 62-63 37.3445 38.0 38.0 38.0 37.0 38.0 64-65 37.241 38.0 38.0 38.0 36.5 38.0 66-67 37.223875 38.0 38.0 38.0 36.5 38.0 68-69 37.199 38.0 38.0 38.0 36.0 38.0 70-71 37.235875 38.0 38.0 38.0 36.0 38.0 72-73 37.250125 38.0 38.0 38.0 36.5 38.0 74-75 37.181375 38.0 38.0 38.0 36.0 38.0 76-77 37.120000000000005 38.0 38.0 38.0 36.0 38.0 78-79 37.141125 38.0 38.0 38.0 36.0 38.0 80-81 37.12925 38.0 38.0 38.0 36.0 38.0 82-83 37.163875 38.0 38.0 38.0 36.0 38.0 84-85 37.160250000000005 38.0 38.0 38.0 36.0 38.0 86-87 37.126625 38.0 38.0 38.0 36.0 38.0 88-89 37.115624999999994 38.0 38.0 38.0 36.0 38.0 90-91 37.0715 38.0 38.0 38.0 36.0 38.0 92-93 36.980625 38.0 38.0 38.0 35.0 38.0 94-95 36.89275000000001 38.0 38.0 38.0 35.0 38.0 96-97 36.9185 38.0 38.0 38.0 35.0 38.0 98-99 36.844 38.0 38.0 38.0 35.0 38.0 100-101 36.86475 38.0 38.0 38.0 35.0 38.0 102-103 36.768875 38.0 38.0 38.0 34.5 38.0 104-105 36.712625 38.0 38.0 38.0 34.0 38.0 106-107 36.48375 38.0 38.0 38.0 34.0 38.0 108-109 36.555125000000004 38.0 38.0 38.0 34.0 38.0 110-111 36.587875 38.0 38.0 38.0 34.0 38.0 112-113 36.603 38.0 38.0 38.0 34.0 38.0 114-115 36.485625 38.0 38.0 38.0 34.0 38.0 116-117 36.582875 38.0 38.0 38.0 34.0 38.0 118-119 36.287375 38.0 37.0 38.0 33.5 38.0 120-121 36.346999999999994 38.0 37.5 38.0 34.0 38.0 122-123 36.238625 38.0 37.0 38.0 33.0 38.0 124-125 36.273250000000004 38.0 37.0 38.0 33.5 38.0 126 31.93025 35.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 2.0 22 1.0 23 0.0 24 5.0 25 3.0 26 7.0 27 13.0 28 12.0 29 19.0 30 30.0 31 34.0 32 52.0 33 88.0 34 108.0 35 193.0 36 599.0 37 2833.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.99320070511206 9.141274238227147 8.7383530596827 45.12717199697809 2 23.974999999999998 12.8 34.275 28.95 3 22.025 17.375 24.349999999999998 36.25 4 26.625 24.075 22.650000000000002 26.650000000000002 5 27.325 29.075 24.025 19.575 6 22.325 31.0 24.474999999999998 22.2 7 18.825 22.8 37.974999999999994 20.4 8 21.675 22.8 29.575000000000003 25.95 9 20.1 21.725 33.475 24.7 10-11 24.349999999999998 28.9375 23.3125 23.400000000000002 12-13 24.45 22.787499999999998 26.825 25.937500000000004 14-15 23.474999999999998 24.962500000000002 26.237500000000004 25.324999999999996 16-17 24.025 25.05 25.624999999999996 25.3 18-19 23.9375 25.275 25.45 25.337500000000002 20-21 23.75 24.962500000000002 26.5625 24.725 22-23 24.95 24.4125 25.074999999999996 25.5625 24-25 23.825 24.65 25.4625 26.0625 26-27 24.928116014501814 24.70308788598575 25.115639454931866 25.25315664458057 28-29 23.3 25.8 25.374999999999996 25.525 30-31 24.275 24.9375 25.912499999999998 24.875 32-33 22.8125 25.374999999999996 25.650000000000002 26.1625 34-35 24.69275144218711 24.855781289189867 25.5079006772009 24.943566591422123 36-37 23.724999999999998 24.9875 25.362499999999997 25.924999999999997 38-39 23.76002004008016 25.876753507014026 24.912324649298597 25.450901803607213 40-41 24.375 24.4125 25.5625 25.650000000000002 42-43 24.1375 24.1625 26.1625 25.5375 44-45 24.212500000000002 24.75 25.275 25.7625 46-47 24.715447154471544 26.00375234521576 24.090056285178235 25.19074421513446 48-49 23.92883988975194 25.557504384865947 24.768228514156853 25.74542721122526 50-51 24.0020022525341 24.92804404955575 25.428607183080963 25.641346514829184 52-53 24.427480916030532 25.215867851332753 23.97697409585784 26.379677136778877 54-55 23.135635635635634 24.274274274274273 25.93843843843844 26.651651651651655 56-57 24.577861163227016 24.740462789243278 24.715447154471544 25.96622889305816 58-59 24.55569461827284 24.680851063829788 24.831038798498124 25.93241551939925 60-61 23.1 24.75 25.1 27.05 62-63 24.60287679799875 25.14071294559099 24.953095684803 25.303314571607256 64-65 24.94994994994995 24.56206206206206 24.64964964964965 25.83833833833834 66-67 24.342928660826033 24.956195244055067 25.682102628285357 25.018773466833544 68-69 24.899949974987493 24.974987493746873 24.462231115557778 25.662831415707853 70-71 24.68101075806855 24.86865148861646 23.642732049036777 26.80760570427821 72-73 24.6248124062031 25.48774387193597 24.462231115557778 25.42521260630315 74-75 24.375 25.1 24.575 25.95 76-77 24.6875 24.9 24.65 25.7625 78-79 24.325 24.675 24.275 26.724999999999998 80-81 24.1875 25.3125 25.3125 25.1875 82-83 24.7375 25.0 24.1875 26.075 84-85 25.206301575393848 23.493373343335833 25.068767191797946 26.231557889472366 86-87 24.925 25.074999999999996 24.9375 25.0625 88-89 24.6625 24.8625 24.349999999999998 26.125 90-91 24.681170292573142 24.381095273818453 24.718679669917478 26.219054763690924 92-93 25.040650406504067 24.652908067542214 25.265791119449656 25.040650406504067 94-95 25.69427070302727 23.767825869402053 24.668501376032022 25.869402051538653 96-97 25.700350175087543 24.374687343671837 24.16208104052026 25.76288144072036 98-99 25.17193947730399 24.19657371514318 24.159059647367762 26.47242716018507 100-101 25.13442540952857 25.609603601350507 23.721395523321245 25.534575465799676 102-103 26.0125 24.775 24.212500000000002 25.0 104-105 24.762500000000003 24.4875 24.712500000000002 26.0375 106-107 25.174999999999997 24.7375 24.212500000000002 25.874999999999996 108-109 26.4625 23.8375 24.0125 25.687500000000004 110-111 24.087500000000002 25.724999999999998 24.675 25.5125 112-113 25.5125 25.174999999999997 24.0 25.3125 114-115 25.15 23.9 24.9875 25.9625 116-117 25.112499999999997 25.587500000000002 23.8625 25.4375 118-119 24.825 24.425 24.9875 25.7625 120-121 25.474999999999998 25.224999999999998 23.375 25.924999999999997 122-123 25.5625 25.0125 24.175 25.25 124-125 26.0125 24.575 22.3375 27.075 126 25.15 26.674999999999997 23.625 24.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 3.0 27 3.0 28 3.0 29 7.0 30 10.0 31 12.5 32 15.0 33 17.0 34 24.0 35 38.5 36 47.0 37 55.5 38 77.0 39 97.0 40 118.0 41 137.5 42 167.0 43 192.0 44 193.0 45 199.5 46 192.0 47 178.0 48 167.0 49 160.0 50 152.5 51 135.5 52 121.0 53 110.0 54 102.5 55 92.0 56 84.5 57 79.5 58 79.5 59 83.5 60 85.5 61 78.5 62 69.5 63 63.5 64 61.0 65 62.0 66 57.0 67 54.0 68 47.5 69 44.5 70 47.0 71 38.0 72 28.0 73 22.0 74 20.0 75 16.5 76 14.5 77 13.0 78 6.5 79 4.5 80 5.5 81 3.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.325 36-37 0.0 38-39 0.2 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0625 48-49 0.22499999999999998 50-51 0.11249999999999999 52-53 0.11249999999999999 54-55 0.1 56-57 0.0625 58-59 0.125 60-61 0.0 62-63 0.0625 64-65 0.1 66-67 0.125 68-69 0.05 70-71 0.075 72-73 0.05 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.025 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.0625 94-95 0.075 96-97 0.05 98-99 0.0375 100-101 0.0375 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06542056074767 98.05 2 0.8335438241980297 1.6500000000000001 3 0.10103561505430665 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378189 spots for SRR7692646.sra Written 378189 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra Read 378185 spots for SRR7692646.sra Written 378185 spots for SRR7692646.sra SRR ids: ['SRR7692646.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b5p7s9i0 SRR7692646.sra spots: 7563704 blocks: [[1, 378185], [378186, 756370], [756371, 1134555], [1134556, 1512740], [1512741, 1890925], [1890926, 2269110], [2269111, 2647295], [2647296, 3025480], [3025481, 3403665], [3403666, 3781850], [3781851, 4160035], [4160036, 4538220], [4538221, 4916405], [4916406, 5294590], [5294591, 5672775], [5672776, 6050960], [6050961, 6429145], [6429146, 6807330], [6807331, 7185515], [7185516, 7563704]] SRR7692646 file size 2410492 SRR7692646 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692646 SRR7692646_1.fastq SRR7692646_2.fastq Input file: SRR7692646_1.fastq Paired file: SRR7692646_2.fastq trimmed: SRR7692646-trimmed-pair1.fastq, SRR7692646-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 16:00:35 2024 >> started Mon Dec 9 16:01:15 2024 >> done (39.606s) 7563704 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 7563704 (100.00%) read pairs available; of these: 343427 ( 4.54%) trimmed read pairs available after processing 7220277 (95.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 75 4 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 0 0.00% 109 1 0.00% 110 9 0.00% 111 241 0.00% 112 3918 0.05% 113 16222 0.21% 114 17782 0.24% 115 19641 0.26% 116 21193 0.28% 117 22757 0.30% 118 24144 0.32% 119 25557 0.34% 120 27281 0.36% 121 29002 0.38% 122 30834 0.41% 123 32618 0.43% 124 34618 0.46% 125 37605 0.50% 126 7220277 95.46% 7563704 reads passed initial QC criterion=sequence-density sequence-density=1.93 sequence-density-rank=1 fanout-score=35.39 fanout-score-rank=2 prefix-density=2.01 prefix-fanout=34.0 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCTCGGTGGTCGCCGTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=40.56 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCC criterion=sequence-density sequence-density=1.96 sequence-density-rank=1 fanout-score=47.51 fanout-score-rank=1 prefix-density=1.98 prefix-fanout=47.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=1.96 sequence-density-rank=1 fanout-score=47.51 fanout-score-rank=1 prefix-density=1.98 prefix-fanout=47.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTG SRR7692646 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 16:05:03 Started mapping on | Dec 09 16:05:04 Finished on | Dec 09 16:07:29 Mapping speed, Million of reads per hour | 187.79 Number of input reads | 7563704 Average input read length | 251 UNIQUE READS: Uniquely mapped reads number | 7287150 Uniquely mapped reads % | 96.34% Average mapped length | 250.38 Number of splices: Total | 6418657 Number of splices: Annotated (sjdb) | 6110445 Number of splices: GT/AG | 6331335 Number of splices: GC/AG | 78005 Number of splices: AT/AC | 2059 Number of splices: Non-canonical | 7258 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 83924 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 5487 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 192630 192630 192630 N_multimapping 83924 83924 83924 N_noFeature 240868 280843 7118175 N_ambiguous 152285 23728 668 UnstrandedReadsAssigned:6893997 PositiveStrandReadsAssigned:6982579 NegativeStrandReadsAssigned:168307 Dataset is classified positive stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692646 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692646-trimmed-pair1.fastq SRR7692646-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,563,704 reads, 7,103,098 reads pseudoaligned [quant] estimated average fragment length: 169.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52973 SRR7692646.ke.tsv 35125 SRR7692646.se.tsv 88098 total ==> SRR7692646.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 768.115 0 0 PNS24247 1044 875.935 15.9833 3.74034 PNS24249 1928 1759.94 17.3436 2.02003 PNS24246 1044 875.935 15.9833 3.74034 PNS24248 1044 875.935 15.9833 3.74034 PNS24244 1471 1302.94 25.7064 4.04421 PNS24243 293 126.864 0 0 KQK14069 1603 1434.94 834.397 119.194 KQK14071 474 307.236 32.0352 21.3733 ==> SRR7692646.se.tsv <== BRADI_1g14170v3 938 BRADI_1g53295v3 42 BRADI_1g59795v3 210 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 82 BRADI_1g74790v3 35 BRADI_1g09890v3 0 BRADI_1g77505v3 96 BRADI_1g48960v3 0 SRR7692646 completed mapping pipeline successfully