Starting /dee2/code/volunteer_pipeline.sh SRR7692647 current disk space = 1523182624768 free memory = 1580362128 SRR7692647 SRAfilesize b2fbfad982546ce68f13ba4a5679bb36 SRR7692647.sra SRR7692647.sra file validated SRR7692647 is paired end SRR7692647 is conventional basespace SRR7692647 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692647_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.57525 32.0 25.0 33.0 18.0 33.0 2 27.08375 29.0 25.0 31.0 18.0 33.0 3 29.74225 31.0 29.0 33.0 25.0 33.0 4 31.286 33.0 31.0 33.0 29.0 33.0 5 32.27025 33.0 32.0 33.0 32.0 33.0 6 35.69 38.0 35.0 38.0 31.0 38.0 7 36.50225 38.0 37.0 38.0 34.0 38.0 8 37.179 38.0 38.0 38.0 36.0 38.0 9 37.3025 38.0 38.0 38.0 36.0 38.0 10-11 37.3995 38.0 38.0 38.0 36.5 38.0 12-13 37.479875 38.0 38.0 38.0 37.0 38.0 14-15 37.43675 38.0 38.0 38.0 37.0 38.0 16-17 37.428749999999994 38.0 38.0 38.0 37.0 38.0 18-19 37.482749999999996 38.0 38.0 38.0 37.0 38.0 20-21 37.439499999999995 38.0 38.0 38.0 37.0 38.0 22-23 37.52875 38.0 38.0 38.0 37.0 38.0 24-25 37.51575 38.0 38.0 38.0 38.0 38.0 26-27 37.501374999999996 38.0 38.0 38.0 37.0 38.0 28-29 37.521375000000006 38.0 38.0 38.0 37.0 38.0 30-31 37.515375 38.0 38.0 38.0 37.5 38.0 32-33 37.521375 38.0 38.0 38.0 37.5 38.0 34-35 37.401250000000005 38.0 38.0 38.0 37.0 38.0 36-37 37.538 38.0 38.0 38.0 37.5 38.0 38-39 37.469875 38.0 38.0 38.0 37.5 38.0 40-41 37.392125 38.0 38.0 38.0 37.0 38.0 42-43 37.410625 38.0 38.0 38.0 37.0 38.0 44-45 37.40625 38.0 38.0 38.0 37.0 38.0 46-47 37.382125 38.0 38.0 38.0 37.0 38.0 48-49 37.375 38.0 38.0 38.0 37.0 38.0 50-51 37.416 38.0 38.0 38.0 37.0 38.0 52-53 37.380375 38.0 38.0 38.0 37.0 38.0 54-55 37.41325 38.0 38.0 38.0 37.0 38.0 56-57 37.34925 38.0 38.0 38.0 37.0 38.0 58-59 37.370000000000005 38.0 38.0 38.0 37.0 38.0 60-61 37.367625000000004 38.0 38.0 38.0 37.0 38.0 62-63 37.3715 38.0 38.0 38.0 37.0 38.0 64-65 37.3585 38.0 38.0 38.0 37.0 38.0 66-67 37.362625 38.0 38.0 38.0 37.0 38.0 68-69 37.37775 38.0 38.0 38.0 37.0 38.0 70-71 37.33475 38.0 38.0 38.0 37.0 38.0 72-73 37.286375 38.0 38.0 38.0 37.0 38.0 74-75 37.22375 38.0 38.0 38.0 36.0 38.0 76-77 37.26275 38.0 38.0 38.0 36.5 38.0 78-79 37.294624999999996 38.0 38.0 38.0 36.0 38.0 80-81 37.198499999999996 38.0 38.0 38.0 36.0 38.0 82-83 37.227374999999995 38.0 38.0 38.0 36.0 38.0 84-85 37.208875 38.0 38.0 38.0 36.0 38.0 86-87 37.248374999999996 38.0 38.0 38.0 36.0 38.0 88-89 37.17725 38.0 38.0 38.0 36.0 38.0 90-91 37.215875 38.0 38.0 38.0 36.0 38.0 92-93 37.135125 38.0 38.0 38.0 36.0 38.0 94-95 37.046375 38.0 38.0 38.0 35.0 38.0 96-97 37.061499999999995 38.0 38.0 38.0 35.5 38.0 98-99 36.919375 38.0 38.0 38.0 35.0 38.0 100-101 36.95225 38.0 38.0 38.0 35.0 38.0 102-103 36.85925 38.0 38.0 38.0 35.0 38.0 104-105 36.907625 38.0 38.0 38.0 35.0 38.0 106-107 36.64275 38.0 38.0 38.0 34.5 38.0 108-109 36.692125000000004 38.0 38.0 38.0 34.0 38.0 110-111 36.683375 38.0 38.0 38.0 34.5 38.0 112-113 36.7075 38.0 38.0 38.0 34.0 38.0 114-115 36.563625 38.0 38.0 38.0 34.0 38.0 116-117 36.611125 38.0 38.0 38.0 34.0 38.0 118-119 36.332499999999996 38.0 37.0 38.0 33.5 38.0 120-121 36.474625 38.0 38.0 38.0 34.0 38.0 122-123 36.425375 38.0 37.5 38.0 34.0 38.0 124-125 36.497125 38.0 38.0 38.0 34.0 38.0 126 32.22275 36.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 0.0 23 3.0 24 4.0 25 4.0 26 3.0 27 12.0 28 12.0 29 13.0 30 19.0 31 29.0 32 52.0 33 58.0 34 98.0 35 179.0 36 598.0 37 2914.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.74152756702074 9.205867475973697 8.598887202832575 39.45371775417299 2 23.599999999999998 12.45 34.25 29.7 3 22.775000000000002 16.075 23.799999999999997 37.35 4 27.275 20.9 23.65 28.175 5 26.85 26.724999999999998 24.775 21.65 6 22.675 30.625000000000004 24.0 22.7 7 18.95 23.025000000000002 38.15 19.875 8 21.275 24.0 29.225 25.5 9 19.475 23.125 33.7 23.7 10-11 23.2375 29.1875 25.275 22.3 12-13 22.650000000000002 23.2875 27.975 26.087500000000002 14-15 22.537499999999998 24.4125 27.6125 25.4375 16-17 23.0875 24.6 26.687499999999996 25.624999999999996 18-19 22.975 25.7875 26.075 25.162499999999998 20-21 23.575 25.75 26.974999999999998 23.7 22-23 23.825 25.775 26.1625 24.2375 24-25 23.0875 24.45 26.7625 25.7 26-27 22.602825353169145 26.778347293411674 25.62820352544068 24.990623827978496 28-29 23.7625 25.0625 26.487500000000004 24.6875 30-31 23.3625 24.125 26.137500000000003 26.375 32-33 23.1875 25.525 25.974999999999998 25.3125 34-35 24.369747899159663 24.88398344412392 26.000250846607297 24.74601781010912 36-37 24.0 24.875 24.962500000000002 26.1625 38-39 22.81778334376957 26.224170319348776 25.773324984345646 25.184721352536005 40-41 23.0875 25.8625 26.424999999999997 24.625 42-43 23.375 25.637500000000003 25.4625 25.525 44-45 24.224999999999998 25.662499999999998 25.3 24.8125 46-47 22.470926597474055 25.922220832812304 26.259847442791045 25.347005126922596 48-49 23.656856606136508 25.28490920475892 25.19724483406387 25.860989355040704 50-51 23.96446001751971 26.054311099987487 25.703916906519837 24.27731197597297 52-53 24.402452759354272 25.50369165310975 25.41609310474284 24.677762482793142 54-55 22.723861930965484 25.67533766883442 25.987993996998497 25.6128064032016 56-57 22.88072018004501 25.418854713678417 25.95648912228057 25.743935983995996 58-59 23.58018513885414 25.869402051538653 25.431573680260193 25.11883912934701 60-61 24.175 24.5625 26.1 25.162499999999998 62-63 23.118279569892472 25.44386096524131 25.406351587896975 26.03150787696924 64-65 23.6963861448043 25.35950981618107 25.70964111541828 25.23446292359635 66-67 24.462231115557778 24.899949974987493 24.674837418709355 25.962981490745374 68-69 23.58089522380595 26.406601650412604 24.918729682420604 25.09377344336084 70-71 24.024512256128062 25.07503751875938 25.76288144072036 25.137568784392194 72-73 24.24053006625828 25.640705088136016 25.203150393799223 24.915614451806476 74-75 22.6375 26.575 25.2 25.587500000000002 76-77 24.1875 25.474999999999998 25.5625 24.775 78-79 23.6875 25.424999999999997 25.124999999999996 25.7625 80-81 23.6125 25.900000000000002 25.724999999999998 24.762500000000003 82-83 23.200000000000003 26.2625 25.7625 24.775 84-85 24.025 26.0375 24.975 24.962500000000002 86-87 23.400000000000002 25.162499999999998 26.1625 25.275 88-89 23.799999999999997 25.1875 25.4875 25.525 90-91 24.440555069383674 25.115639454931866 24.79059882485311 25.653206650831358 92-93 24.131032758189548 25.09377344336084 25.318829707426854 25.456364091022753 94-95 25.46273136568284 25.57528764382191 24.487243621810904 24.474737368684345 96-97 25.068767191797946 25.206301575393848 24.99374843710928 24.731182795698924 98-99 23.843460865216304 25.64391097774444 24.90622655663916 25.6064016004001 100-101 23.97799724965621 26.215776972121514 24.6530816352044 25.153144143017876 102-103 24.025 23.875 25.9625 26.137500000000003 104-105 23.0 24.55 25.650000000000002 26.8 106-107 24.2625 24.4 25.7625 25.575 108-109 23.4375 25.5625 25.775 25.224999999999998 110-111 24.212500000000002 24.65 25.837500000000002 25.3 112-113 24.825 25.337500000000002 24.975 24.8625 114-115 24.425 25.2625 24.85 25.4625 116-117 23.9875 25.75 24.975 25.2875 118-119 24.675 24.95 25.0375 25.337500000000002 120-121 24.85 25.137500000000003 24.6875 25.324999999999996 122-123 24.725 25.687500000000004 25.7625 23.825 124-125 24.0375 25.912499999999998 24.8125 25.2375 126 25.674999999999997 25.2 25.174999999999997 23.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 2.0 28 4.0 29 8.0 30 8.5 31 9.5 32 16.5 33 25.0 34 32.5 35 42.5 36 56.5 37 76.5 38 93.0 39 113.5 40 140.0 41 157.0 42 180.5 43 190.5 44 188.5 45 201.0 46 205.5 47 193.0 48 187.0 49 182.0 50 153.0 51 131.5 52 127.5 53 111.0 54 92.5 55 81.5 56 78.5 57 84.5 58 79.5 59 71.0 60 67.0 61 63.5 62 57.0 63 60.5 64 57.5 65 47.0 66 47.5 67 44.0 68 34.5 69 30.5 70 33.0 71 25.0 72 22.0 73 21.5 74 15.0 75 9.0 76 12.0 77 9.5 78 4.0 79 5.5 80 4.0 81 2.0 82 1.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.3375 36-37 0.0 38-39 0.1875 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0375 48-49 0.1875 50-51 0.11249999999999999 52-53 0.11249999999999999 54-55 0.05 56-57 0.025 58-59 0.075 60-61 0.0 62-63 0.025 64-65 0.0375 66-67 0.05 68-69 0.025 70-71 0.05 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.025 94-95 0.05 96-97 0.025 98-99 0.025 100-101 0.0125 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7250000000000001 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692647 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692647_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75 33.0 33.0 34.0 32.0 34.0 2 32.83975 33.0 33.0 34.0 32.0 34.0 3 32.79875 34.0 33.0 34.0 32.0 34.0 4 32.6615 34.0 33.0 34.0 32.0 34.0 5 32.79575 33.0 33.0 34.0 32.0 34.0 6 36.916 38.0 38.0 38.0 36.0 38.0 7 36.9275 38.0 38.0 38.0 36.0 38.0 8 36.882 38.0 38.0 38.0 36.0 38.0 9 36.86225 38.0 38.0 38.0 36.0 38.0 10-11 36.905 38.0 38.0 38.0 36.0 38.0 12-13 37.004875 38.0 38.0 38.0 36.0 38.0 14-15 36.817625 38.0 38.0 38.0 35.5 38.0 16-17 36.940875 38.0 38.0 38.0 36.0 38.0 18-19 36.896 38.0 38.0 38.0 36.0 38.0 20-21 37.025375 38.0 38.0 38.0 36.0 38.0 22-23 36.878375000000005 38.0 38.0 38.0 36.0 38.0 24-25 36.938375 38.0 38.0 38.0 36.0 38.0 26-27 36.926 38.0 38.0 38.0 36.0 38.0 28-29 37.003875 38.0 38.0 38.0 36.0 38.0 30-31 37.071 38.0 38.0 38.0 36.5 38.0 32-33 36.963750000000005 38.0 38.0 38.0 36.0 38.0 34-35 37.068 38.0 38.0 38.0 36.0 38.0 36-37 37.129875 38.0 38.0 38.0 37.0 38.0 38-39 37.060249999999996 38.0 38.0 38.0 36.0 38.0 40-41 37.087 38.0 38.0 38.0 36.0 38.0 42-43 37.085125 38.0 38.0 38.0 36.0 38.0 44-45 37.0535 38.0 38.0 38.0 36.0 38.0 46-47 37.052875 38.0 38.0 38.0 36.0 38.0 48-49 37.011375 38.0 38.0 38.0 36.0 38.0 50-51 37.047124999999994 38.0 38.0 38.0 36.5 38.0 52-53 37.098749999999995 38.0 38.0 38.0 36.0 38.0 54-55 37.02875 38.0 38.0 38.0 36.0 38.0 56-57 37.034875 38.0 38.0 38.0 36.0 38.0 58-59 37.065875000000005 38.0 38.0 38.0 36.0 38.0 60-61 37.077375 38.0 38.0 38.0 36.0 38.0 62-63 37.051500000000004 38.0 38.0 38.0 36.0 38.0 64-65 37.06975 38.0 38.0 38.0 36.0 38.0 66-67 37.036125 38.0 38.0 38.0 36.0 38.0 68-69 36.995999999999995 38.0 38.0 38.0 36.0 38.0 70-71 36.9305 38.0 38.0 38.0 36.0 38.0 72-73 36.965625 38.0 38.0 38.0 36.0 38.0 74-75 36.921875 38.0 38.0 38.0 36.0 38.0 76-77 36.892375 38.0 38.0 38.0 35.5 38.0 78-79 36.809 38.0 38.0 38.0 35.0 38.0 80-81 36.814125 38.0 38.0 38.0 35.5 38.0 82-83 36.842124999999996 38.0 38.0 38.0 35.5 38.0 84-85 36.79425 38.0 38.0 38.0 35.0 38.0 86-87 36.839375 38.0 38.0 38.0 35.0 38.0 88-89 36.84675 38.0 38.0 38.0 35.5 38.0 90-91 36.72425 38.0 38.0 38.0 35.0 38.0 92-93 36.67425 38.0 38.0 38.0 35.0 38.0 94-95 36.681875000000005 38.0 38.0 38.0 35.0 38.0 96-97 36.733125 38.0 38.0 38.0 35.0 38.0 98-99 36.666875000000005 38.0 38.0 38.0 34.0 38.0 100-101 36.559125 38.0 38.0 38.0 34.0 38.0 102-103 36.56875 38.0 38.0 38.0 34.5 38.0 104-105 36.357625 38.0 38.0 38.0 34.0 38.0 106-107 36.331875 38.0 38.0 38.0 33.5 38.0 108-109 36.25775 38.0 38.0 38.0 34.0 38.0 110-111 36.261624999999995 38.0 38.0 38.0 33.5 38.0 112-113 36.248374999999996 38.0 38.0 38.0 33.5 38.0 114-115 36.19075 38.0 38.0 38.0 33.0 38.0 116-117 35.905 38.0 37.0 38.0 33.0 38.0 118-119 36.096875 38.0 37.5 38.0 32.5 38.0 120-121 36.019375 38.0 38.0 38.0 31.5 38.0 122-123 35.630375 38.0 36.0 38.0 31.0 38.0 124-125 35.309 38.0 35.5 38.0 29.5 38.0 126 30.732 34.0 26.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 5.0 17 3.0 18 10.0 19 6.0 20 7.0 21 10.0 22 8.0 23 4.0 24 14.0 25 9.0 26 7.0 27 19.0 28 17.0 29 23.0 30 39.0 31 38.0 32 62.0 33 73.0 34 94.0 35 180.0 36 475.0 37 2897.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.300000000000004 19.400000000000002 13.025 34.275 2 28.199999999999996 24.825 27.3 19.675 3 23.150000000000002 25.924999999999997 27.750000000000004 23.175 4 25.45 30.875000000000004 20.5 23.175 5 29.2 31.15 18.85 20.8 6 21.9 34.2 21.6 22.3 7 21.875 20.05 34.475 23.599999999999998 8 24.85 23.275000000000002 23.45 28.425 9 23.65 24.45 27.250000000000004 24.65 10-11 26.2875 28.725 21.0375 23.95 12-13 24.575 24.3625 25.275 25.7875 14-15 24.15 25.724999999999998 24.7375 25.387500000000003 16-17 25.587500000000002 25.2 24.1375 25.074999999999996 18-19 24.55 25.8625 25.55 24.0375 20-21 25.724999999999998 25.7125 24.099999999999998 24.462500000000002 22-23 25.2875 26.437500000000004 24.337500000000002 23.9375 24-25 25.662499999999998 24.8 25.5125 24.025 26-27 25.7 25.7625 25.3 23.2375 28-29 25.2625 24.85 24.837500000000002 25.05 30-31 24.462500000000002 25.7 25.7 24.1375 32-33 24.95 25.3 25.937500000000004 23.8125 34-35 25.85 25.387500000000003 24.712500000000002 24.05 36-37 24.9125 26.700000000000003 23.6875 24.7 38-39 25.5375 26.0125 24.7 23.75 40-41 25.2 26.0625 23.7125 25.025 42-43 23.6625 26.137500000000003 25.362499999999997 24.837500000000002 44-45 25.25 24.75 25.1875 24.8125 46-47 24.925 25.8 25.2375 24.0375 48-49 24.425 25.874999999999996 25.25 24.45 50-51 24.6125 25.137500000000003 25.224999999999998 25.025 52-53 26.05 25.3 24.887500000000003 23.7625 54-55 24.212500000000002 25.074999999999996 25.8 24.9125 56-57 25.662499999999998 25.75 24.7875 23.799999999999997 58-59 25.374999999999996 24.8125 25.8125 24.0 60-61 24.65 25.05 25.55 24.75 62-63 24.775 25.0375 25.4 24.7875 64-65 26.3125 24.9125 25.275 23.5 66-67 25.025 25.4 25.3125 24.2625 68-69 24.875 25.2 25.837500000000002 24.087500000000002 70-71 26.2625 24.825 25.0625 23.849999999999998 72-73 24.762500000000003 26.275 25.55 23.4125 74-75 25.5125 24.212500000000002 26.437500000000004 23.8375 76-77 26.0375 25.45 24.8625 23.65 78-79 24.7375 25.8625 25.674999999999997 23.724999999999998 80-81 25.55 25.387500000000003 24.7875 24.275 82-83 25.05 24.8 25.874999999999996 24.275 84-85 25.5375 24.7 26.1125 23.65 86-87 26.0625 25.75 25.275 22.912499999999998 88-89 25.55 25.8125 24.9 23.7375 90-91 24.55 26.8375 25.55 23.0625 92-93 25.4375 25.15 25.2625 24.15 94-95 25.337500000000002 25.6 24.962500000000002 24.099999999999998 96-97 25.0 25.724999999999998 25.575 23.7 98-99 25.25 25.05 26.1125 23.5875 100-101 25.900000000000002 25.124999999999996 25.2 23.775 102-103 25.674999999999997 25.137500000000003 25.650000000000002 23.5375 104-105 25.874999999999996 25.2375 25.074999999999996 23.8125 106-107 25.85 25.674999999999997 24.7375 23.7375 108-109 24.85 26.674999999999997 24.9875 23.4875 110-111 25.5 25.775 24.7 24.025 112-113 25.374999999999996 25.674999999999997 24.6875 24.2625 114-115 24.5 25.374999999999996 25.687500000000004 24.4375 116-117 25.9625 25.7125 25.4375 22.8875 118-119 25.8125 26.200000000000003 24.925 23.0625 120-121 24.962500000000002 26.775 25.074999999999996 23.1875 122-123 26.20060030015007 26.513256628314156 24.61230615307654 22.67383691845923 124-125 26.137500000000003 26.2125 24.3125 23.3375 126 26.674999999999997 24.6 25.374999999999996 23.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 2.0 28 3.0 29 6.5 30 9.0 31 10.5 32 14.0 33 18.5 34 26.5 35 43.5 36 61.5 37 75.5 38 85.0 39 96.0 40 131.0 41 160.5 42 165.0 43 176.0 44 201.0 45 215.0 46 208.5 47 198.5 48 183.0 49 157.5 50 129.0 51 121.0 52 123.0 53 111.0 54 106.0 55 101.0 56 88.5 57 86.0 58 83.5 59 81.5 60 80.0 61 59.5 62 46.5 63 63.0 64 65.0 65 56.5 66 53.0 67 40.0 68 34.0 69 37.5 70 36.5 71 27.5 72 22.5 73 23.5 74 18.0 75 12.5 76 10.5 77 7.0 78 6.5 79 6.5 80 4.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.05 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866028 spots for SRR7692647.sra Written 866028 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra Read 866011 spots for SRR7692647.sra Written 866011 spots for SRR7692647.sra SRR ids: ['SRR7692647.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vram2k61 SRR7692647.sra spots: 17320237 blocks: [[1, 866011], [866012, 1732022], [1732023, 2598033], [2598034, 3464044], [3464045, 4330055], [4330056, 5196066], [5196067, 6062077], [6062078, 6928088], [6928089, 7794099], [7794100, 8660110], [8660111, 9526121], [9526122, 10392132], [10392133, 11258143], [11258144, 12124154], [12124155, 12990165], [12990166, 13856176], [13856177, 14722187], [14722188, 15588198], [15588199, 16454209], [16454210, 17320237]] SRR7692647 file size 5528364 SRR7692647 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692647 SRR7692647_1.fastq SRR7692647_2.fastq Input file: SRR7692647_1.fastq Paired file: SRR7692647_2.fastq trimmed: SRR7692647-trimmed-pair1.fastq, SRR7692647-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 16:02:11 2024 >> started Mon Dec 9 16:02:28 2024 >> done (17.067s) 17320237 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 53 ( 0.00%) empty read pairs filtered out after trimming by size control 17320183 (100.00%) read pairs available; of these: 1012455 ( 5.85%) trimmed read pairs available after processing 16307728 (94.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 0 0.00% 34 1 0.00% 35 1 0.00% 36 2 0.00% 37 6 0.00% 38 1 0.00% 39 9 0.00% 40 2 0.00% 41 7 0.00% 42 9 0.00% 43 6 0.00% 44 6 0.00% 45 8 0.00% 46 8 0.00% 47 19 0.00% 48 14 0.00% 49 26 0.00% 50 20 0.00% 51 24 0.00% 52 24 0.00% 53 16 0.00% 54 24 0.00% 55 29 0.00% 56 40 0.00% 57 41 0.00% 58 54 0.00% 59 62 0.00% 60 61 0.00% 61 84 0.00% 62 108 0.00% 63 108 0.00% 64 124 0.00% 65 140 0.00% 66 169 0.00% 67 183 0.00% 68 190 0.00% 69 233 0.00% 70 316 0.00% 71 271 0.00% 72 331 0.00% 73 391 0.00% 74 425 0.00% 75 503 0.00% 76 557 0.00% 77 600 0.00% 78 740 0.00% 79 749 0.00% 80 921 0.01% 81 1033 0.01% 82 1175 0.01% 83 1399 0.01% 84 1572 0.01% 85 1820 0.01% 86 2007 0.01% 87 2274 0.01% 88 2598 0.01% 89 2872 0.02% 90 3145 0.02% 91 3622 0.02% 92 3980 0.02% 93 4529 0.03% 94 5218 0.03% 95 5871 0.03% 96 6499 0.04% 97 7395 0.04% 98 7842 0.05% 99 8738 0.05% 100 9536 0.06% 101 10494 0.06% 102 11373 0.07% 103 12772 0.07% 104 14248 0.08% 105 15291 0.09% 106 17511 0.10% 107 18983 0.11% 108 20474 0.12% 109 22668 0.13% 110 24707 0.14% 111 26923 0.16% 112 29356 0.17% 113 32590 0.19% 114 35876 0.21% 115 39127 0.23% 116 42603 0.25% 117 46117 0.27% 118 49621 0.29% 119 52808 0.30% 120 56329 0.33% 121 60069 0.35% 122 63729 0.37% 123 67345 0.39% 124 72441 0.42% 125 78207 0.45% 126 16307728 94.15% 17320183 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=21 prefix-density=0.33 prefix-fanout=3.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=110.85 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=18.8 sequence=CCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGCTGTCATCTGCACCATCCTTGAGCGAGAGGAGTGCCTTGATTCCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGGGCACACACGGCGTACTCGATGGCCGACCCAACACCGGCGTACTTGTTCTTGCAGTAGGACGGGACCATGTTGGCGATGTTGCGGACGGTGAAGGCCTCACCGGGCTCCAGGCCCAGGGTCACCGACGGGCACACACGTGAGTCGGCGCAGGCGAACACCATGTACTTGGGGGCCTGGCCGGCCTTGAGCGGCTCGAAGACATCCGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=37 prefix-density=0.17 prefix-fanout=2.0 sequence=GTCCGCATCATCGGCTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=95.67 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.6 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR7692647 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 16:03:35 Started mapping on | Dec 09 16:03:36 Finished on | Dec 09 16:05:01 Mapping speed, Million of reads per hour | 733.56 Number of input reads | 17320183 Average input read length | 246 UNIQUE READS: Uniquely mapped reads number | 15972774 Uniquely mapped reads % | 92.22% Average mapped length | 246.25 Number of splices: Total | 14554114 Number of splices: Annotated (sjdb) | 13825208 Number of splices: GT/AG | 14354815 Number of splices: GC/AG | 177150 Number of splices: AT/AC | 6168 Number of splices: Non-canonical | 15981 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 177504 % of reads mapped to multiple loci | 1.02% Number of reads mapped to too many loci | 10118 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.39% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1169905 1169905 1169905 N_multimapping 177504 177504 177504 N_noFeature 600975 15595793 695688 N_ambiguous 341716 1856 59877 UnstrandedReadsAssigned:15030083 PositiveStrandReadsAssigned:375125 NegativeStrandReadsAssigned:15217209 Dataset is classified negative stranded MeadianReadLen=122 20thPercentileLength=122 echo kmer=117 SRR7692647 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692647-trimmed-pair1.fastq SRR7692647-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,320,183 reads, 16,186,389 reads pseudoaligned [quant] estimated average fragment length: 166.402 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR7692647.ke.tsv 35125 SRR7692647.se.tsv 88098 total ==> SRR7692647.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.679 0 0 PNS24247 1044 878.598 32.9661 3.61208 PNS24249 1928 1762.6 81.9816 4.47758 PNS24246 1044 878.598 32.9661 3.61208 PNS24248 1044 878.598 32.9661 3.61208 PNS24244 1471 1305.6 38.1201 2.81076 PNS24243 293 129.675 0 0 KQK14069 1603 1437.6 1147.84 76.864 KQK14071 474 309.968 72.9819 22.6662 ==> SRR7692647.se.tsv <== BRADI_1g14170v3 1217 BRADI_1g53295v3 90 BRADI_1g59795v3 334 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 119 BRADI_1g74790v3 169 BRADI_1g09890v3 0 BRADI_1g77505v3 241 BRADI_1g48960v3 0 SRR7692647 completed mapping pipeline successfully