Starting /dee2/code/volunteer_pipeline.sh SRR7692658 current disk space = 1523298447360 free memory = 1605422636 SRR7692658 SRAfilesize adef63c25faf91b3542b699dec934193 SRR7692658.sra SRR7692658.sra file validated SRR7692658 is paired end SRR7692658 is conventional basespace SRR7692658 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692658_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85075 33.0 33.0 34.0 32.0 34.0 2 32.84825 33.0 33.0 34.0 32.0 34.0 3 32.856 33.0 33.0 34.0 32.0 34.0 4 32.757 33.0 33.0 34.0 32.0 34.0 5 32.748 34.0 33.0 34.0 32.0 34.0 6 36.96 38.0 38.0 38.0 36.0 38.0 7 36.8865 38.0 38.0 38.0 36.0 38.0 8 36.93575 38.0 38.0 38.0 36.0 38.0 9 36.837 38.0 38.0 38.0 36.0 38.0 10-11 37.019375 38.0 38.0 38.0 36.0 38.0 12-13 36.998000000000005 38.0 38.0 38.0 36.0 38.0 14-15 36.851625 38.0 38.0 38.0 35.5 38.0 16-17 36.9035 38.0 38.0 38.0 36.0 38.0 18-19 36.87225 38.0 38.0 38.0 36.0 38.0 20-21 36.943875000000006 38.0 38.0 38.0 36.0 38.0 22-23 36.869749999999996 38.0 38.0 38.0 35.5 38.0 24-25 36.92475 38.0 38.0 38.0 36.0 38.0 26-27 36.964375 38.0 38.0 38.0 36.0 38.0 28-29 37.0315 38.0 38.0 38.0 36.0 38.0 30-31 37.0755 38.0 38.0 38.0 37.0 38.0 32-33 36.983375 38.0 38.0 38.0 36.0 38.0 34-35 37.049 38.0 38.0 38.0 36.5 38.0 36-37 37.073 38.0 38.0 38.0 36.5 38.0 38-39 37.042375 38.0 38.0 38.0 36.0 38.0 40-41 37.076499999999996 38.0 38.0 38.0 36.5 38.0 42-43 37.089124999999996 38.0 38.0 38.0 36.5 38.0 44-45 37.011875 38.0 38.0 38.0 36.0 38.0 46-47 37.016999999999996 38.0 38.0 38.0 36.0 38.0 48-49 36.9955 38.0 38.0 38.0 36.0 38.0 50-51 37.01175 38.0 38.0 38.0 36.0 38.0 52-53 37.079 38.0 38.0 38.0 36.5 38.0 54-55 36.9925 38.0 38.0 38.0 36.0 38.0 56-57 36.97825 38.0 38.0 38.0 36.0 38.0 58-59 37.06525 38.0 38.0 38.0 36.0 38.0 60-61 37.021875 38.0 38.0 38.0 36.0 38.0 62-63 36.935125 38.0 38.0 38.0 36.0 38.0 64-65 36.957125 38.0 38.0 38.0 36.0 38.0 66-67 36.932249999999996 38.0 38.0 38.0 36.0 38.0 68-69 36.989000000000004 38.0 38.0 38.0 36.0 38.0 70-71 36.946 38.0 38.0 38.0 36.0 38.0 72-73 36.972625 38.0 38.0 38.0 36.0 38.0 74-75 36.88775 38.0 38.0 38.0 36.0 38.0 76-77 36.8845 38.0 38.0 38.0 35.5 38.0 78-79 36.752875 38.0 38.0 38.0 35.0 38.0 80-81 36.79075 38.0 38.0 38.0 35.0 38.0 82-83 36.800124999999994 38.0 38.0 38.0 35.5 38.0 84-85 36.704875 38.0 38.0 38.0 35.0 38.0 86-87 36.778000000000006 38.0 38.0 38.0 35.0 38.0 88-89 36.71525 38.0 38.0 38.0 35.0 38.0 90-91 36.695750000000004 38.0 38.0 38.0 35.0 38.0 92-93 36.680625 38.0 38.0 38.0 35.0 38.0 94-95 36.690125 38.0 38.0 38.0 34.5 38.0 96-97 36.612375 38.0 38.0 38.0 34.5 38.0 98-99 36.559125 38.0 38.0 38.0 34.0 38.0 100-101 36.49825 38.0 38.0 38.0 34.0 38.0 102-103 36.4525 38.0 38.0 38.0 34.0 38.0 104-105 36.3895 38.0 38.0 38.0 34.0 38.0 106-107 36.270375 38.0 38.0 38.0 33.5 38.0 108-109 36.227500000000006 38.0 38.0 38.0 33.5 38.0 110-111 36.2675 38.0 38.0 38.0 33.5 38.0 112-113 36.283249999999995 38.0 38.0 38.0 34.0 38.0 114-115 36.11975 38.0 37.0 38.0 33.0 38.0 116-117 35.92675 38.0 37.0 38.0 32.5 38.0 118-119 36.00125 38.0 37.0 38.0 32.5 38.0 120-121 35.932 38.0 37.5 38.0 32.0 38.0 122-123 35.53275 38.0 36.0 38.0 30.0 38.0 124-125 35.3335 38.0 35.5 38.0 30.0 38.0 126 30.05775 33.0 24.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 6.0 17 8.0 18 9.0 19 7.0 20 13.0 21 6.0 22 4.0 23 3.0 24 6.0 25 15.0 26 11.0 27 11.0 28 24.0 29 28.0 30 39.0 31 46.0 32 49.0 33 68.0 34 106.0 35 156.0 36 479.0 37 2905.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.975 16.85 14.224999999999998 34.949999999999996 2 28.825 24.2 27.575 19.400000000000002 3 21.525 27.125 27.700000000000003 23.65 4 26.150000000000002 31.125000000000004 20.775 21.95 5 26.025 33.625 21.275 19.075 6 22.15 33.45 22.675 21.725 7 21.85 19.05 35.8 23.3 8 23.05 23.275000000000002 25.025 28.65 9 23.45 22.625 29.25 24.675 10-11 26.1625 28.799999999999997 21.7 23.3375 12-13 25.775 24.275 24.8125 25.137500000000003 14-15 23.875 26.737499999999997 25.75 23.6375 16-17 25.4 26.2125 24.837500000000002 23.549999999999997 18-19 24.6 26.450000000000003 25.6125 23.3375 20-21 24.4375 25.775 26.187500000000004 23.599999999999998 22-23 24.587500000000002 25.900000000000002 25.424999999999997 24.087500000000002 24-25 24.575 26.224999999999998 25.424999999999997 23.775 26-27 24.6125 26.275 25.724999999999998 23.3875 28-29 24.85 26.05 25.25 23.849999999999998 30-31 24.3625 26.325 25.7 23.6125 32-33 25.2625 26.025 24.887500000000003 23.825 34-35 25.387500000000003 25.4875 25.3125 23.8125 36-37 24.575 25.674999999999997 25.912499999999998 23.8375 38-39 25.45 25.424999999999997 26.5 22.625 40-41 24.837500000000002 25.674999999999997 25.55 23.9375 42-43 24.9125 26.0 26.087500000000002 23.0 44-45 25.374999999999996 25.2125 26.200000000000003 23.2125 46-47 25.4625 25.674999999999997 25.3 23.5625 48-49 24.712500000000002 25.874999999999996 26.450000000000003 22.9625 50-51 25.95 25.374999999999996 25.637500000000003 23.0375 52-53 24.4375 25.9875 25.8625 23.7125 54-55 25.424999999999997 25.687500000000004 25.874999999999996 23.0125 56-57 24.4125 26.5625 25.7625 23.2625 58-59 24.762500000000003 25.9625 25.95 23.325000000000003 60-61 24.349999999999998 25.95 26.424999999999997 23.275000000000002 62-63 24.775 26.5125 25.912499999999998 22.8 64-65 25.324999999999996 25.912499999999998 25.912499999999998 22.85 66-67 24.7375 26.174999999999997 26.700000000000003 22.3875 68-69 25.3 25.7875 26.687499999999996 22.225 70-71 24.2625 26.174999999999997 26.337500000000002 23.225 72-73 24.3875 26.3125 26.775 22.525000000000002 74-75 26.0 25.5375 25.724999999999998 22.7375 76-77 25.7 25.15 26.1625 22.9875 78-79 24.212500000000002 25.7625 27.0625 22.9625 80-81 25.775 26.1 25.5 22.625 82-83 25.837500000000002 25.95 25.924999999999997 22.287499999999998 84-85 25.0 26.487500000000004 26.200000000000003 22.3125 86-87 24.75 25.587500000000002 26.950000000000003 22.7125 88-89 24.75 26.487500000000004 26.2125 22.55 90-91 24.1875 26.5375 26.787499999999998 22.4875 92-93 24.637500000000003 26.825 26.2875 22.25 94-95 24.2625 26.200000000000003 26.5375 23.0 96-97 24.375 26.487500000000004 26.85 22.287499999999998 98-99 25.55 26.237500000000004 26.2875 21.925 100-101 26.1125 25.162499999999998 25.900000000000002 22.825 102-103 24.7 25.9625 26.825 22.5125 104-105 25.575 26.200000000000003 26.437500000000004 21.7875 106-107 25.0625 26.25 25.7 22.9875 108-109 26.05 26.5 26.325 21.125 110-111 24.675 25.5625 27.0625 22.7 112-113 25.6125 26.0375 25.637500000000003 22.7125 114-115 25.900000000000002 25.587500000000002 26.35 22.162499999999998 116-117 25.75 27.05 25.587500000000002 21.6125 118-119 26.9625 26.450000000000003 25.674999999999997 20.9125 120-121 25.874999999999996 26.5625 26.0375 21.525 122-123 27.040880110013752 27.25340667583448 25.028128516064506 20.677584698087262 124-125 26.487500000000004 27.5125 24.6125 21.3875 126 27.150000000000002 26.924999999999997 25.85 20.075000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 1.0 24 1.0 25 3.5 26 4.5 27 3.0 28 5.5 29 9.5 30 12.5 31 15.0 32 19.0 33 25.5 34 37.0 35 51.5 36 64.0 37 84.5 38 108.0 39 115.0 40 136.5 41 156.5 42 173.5 43 205.5 44 220.0 45 206.0 46 193.5 47 203.0 48 196.5 49 172.0 50 151.5 51 137.0 52 126.0 53 108.5 54 93.0 55 91.0 56 78.5 57 66.0 58 69.5 59 65.5 60 65.5 61 58.0 62 47.0 63 54.0 64 50.5 65 44.5 66 36.5 67 34.5 68 41.0 69 35.5 70 24.0 71 17.5 72 16.5 73 16.0 74 10.5 75 5.5 76 6.0 77 6.0 78 4.5 79 2.0 80 1.5 81 2.5 82 1.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0125 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.9250000000000003 0.0 0.0 0.0 0.0 114 4.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGAT 15 0.0039514517 60.000004 60-61 >>END_MODULE SRR7692658 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692658_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.3155 18.0 18.0 25.0 18.0 32.0 2 29.92825 30.0 28.0 31.0 27.0 33.0 3 31.79525 33.0 31.0 33.0 29.0 33.0 4 32.5555 33.0 33.0 33.0 31.0 34.0 5 33.19225 33.0 33.0 34.0 33.0 34.0 6 37.101 38.0 38.0 38.0 36.0 38.0 7 37.246 38.0 38.0 38.0 36.0 38.0 8 37.31325 38.0 38.0 38.0 36.0 38.0 9 37.387 38.0 38.0 38.0 37.0 38.0 10-11 37.451125000000005 38.0 38.0 38.0 37.0 38.0 12-13 37.468375 38.0 38.0 38.0 37.0 38.0 14-15 37.479875 38.0 38.0 38.0 37.0 38.0 16-17 37.43 38.0 38.0 38.0 37.0 38.0 18-19 37.47525 38.0 38.0 38.0 37.5 38.0 20-21 37.431875 38.0 38.0 38.0 37.0 38.0 22-23 37.45975 38.0 38.0 38.0 37.0 38.0 24-25 37.51175 38.0 38.0 38.0 37.0 38.0 26-27 37.459 38.0 38.0 38.0 37.0 38.0 28-29 37.462 38.0 38.0 38.0 37.0 38.0 30-31 37.51025 38.0 38.0 38.0 37.0 38.0 32-33 37.521375 38.0 38.0 38.0 37.5 38.0 34-35 37.346125 38.0 38.0 38.0 37.0 38.0 36-37 37.4705 38.0 38.0 38.0 37.0 38.0 38-39 37.468125 38.0 38.0 38.0 37.5 38.0 40-41 37.4255 38.0 38.0 38.0 37.0 38.0 42-43 37.3575 38.0 38.0 38.0 37.0 38.0 44-45 37.428875000000005 38.0 38.0 38.0 37.0 38.0 46-47 37.379625000000004 38.0 38.0 38.0 37.0 38.0 48-49 37.354125 38.0 38.0 38.0 37.0 38.0 50-51 37.459374999999994 38.0 38.0 38.0 37.0 38.0 52-53 37.4065 38.0 38.0 38.0 37.0 38.0 54-55 37.437875 38.0 38.0 38.0 37.0 38.0 56-57 37.37175 38.0 38.0 38.0 37.0 38.0 58-59 37.377125 38.0 38.0 38.0 37.0 38.0 60-61 37.396874999999994 38.0 38.0 38.0 37.0 38.0 62-63 37.40075 38.0 38.0 38.0 37.0 38.0 64-65 37.376999999999995 38.0 38.0 38.0 37.0 38.0 66-67 37.34425 38.0 38.0 38.0 37.0 38.0 68-69 37.348749999999995 38.0 38.0 38.0 37.0 38.0 70-71 37.302875 38.0 38.0 38.0 37.0 38.0 72-73 37.341625 38.0 38.0 38.0 37.0 38.0 74-75 37.267624999999995 38.0 38.0 38.0 36.5 38.0 76-77 37.21175 38.0 38.0 38.0 36.0 38.0 78-79 37.275625000000005 38.0 38.0 38.0 36.5 38.0 80-81 37.286125 38.0 38.0 38.0 36.0 38.0 82-83 37.24525 38.0 38.0 38.0 36.0 38.0 84-85 37.188125 38.0 38.0 38.0 36.0 38.0 86-87 37.256 38.0 38.0 38.0 36.0 38.0 88-89 37.14475 38.0 38.0 38.0 36.0 38.0 90-91 37.16075 38.0 38.0 38.0 36.0 38.0 92-93 37.133375 38.0 38.0 38.0 36.0 38.0 94-95 37.014375 38.0 38.0 38.0 35.5 38.0 96-97 37.096125 38.0 38.0 38.0 36.0 38.0 98-99 37.0175 38.0 38.0 38.0 35.5 38.0 100-101 37.01025 38.0 38.0 38.0 35.5 38.0 102-103 36.931125 38.0 38.0 38.0 35.0 38.0 104-105 36.818875 38.0 38.0 38.0 35.0 38.0 106-107 36.599875 38.0 38.0 38.0 34.0 38.0 108-109 36.557874999999996 38.0 38.0 38.0 34.0 38.0 110-111 36.607 38.0 38.0 38.0 34.0 38.0 112-113 36.697 38.0 38.0 38.0 34.0 38.0 114-115 36.51025 38.0 38.0 38.0 34.0 38.0 116-117 36.56125 38.0 38.0 38.0 34.0 38.0 118-119 36.282375 38.0 37.0 38.0 33.5 38.0 120-121 36.39075 38.0 37.5 38.0 34.0 38.0 122-123 36.248125 38.0 37.0 38.0 33.0 38.0 124-125 36.36375 38.0 37.0 38.0 34.0 38.0 126 32.06975 36.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 3.0 24 3.0 25 4.0 26 4.0 27 8.0 28 7.0 29 10.0 30 29.0 31 40.0 32 43.0 33 69.0 34 90.0 35 199.0 36 591.0 37 2899.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.41791423496574 10.149708195889367 14.31108855620401 42.12128901294088 2 22.35 15.575 34.2 27.875 3 22.825 18.675 23.7 34.8 4 27.175 25.575 21.5 25.75 5 25.55 30.425 24.0 20.025000000000002 6 21.175 33.15 25.4 20.275000000000002 7 17.8 24.425 38.475 19.3 8 20.0 25.224999999999998 30.45 24.325 9 18.975 22.875 33.725 24.425 10-11 22.7375 30.575000000000003 23.325000000000003 23.3625 12-13 22.5 25.3125 26.8125 25.374999999999996 14-15 21.75 26.450000000000003 27.3 24.5 16-17 21.9625 25.7 27.175 25.162499999999998 18-19 22.7 26.337500000000002 26.05 24.9125 20-21 22.15 27.224999999999998 25.8125 24.8125 22-23 22.175 26.825 26.187500000000004 24.8125 24-25 22.3 25.8 26.125 25.775 26-27 22.252781597699713 26.465808226028255 27.17839729966246 24.103012876609576 28-29 22.8 26.487500000000004 26.0125 24.7 30-31 22.5 26.787499999999998 26.087500000000002 24.625 32-33 22.125 26.3625 25.374999999999996 26.137500000000003 34-35 22.910915934755334 26.72521957340025 25.68381430363865 24.680050188205772 36-37 22.3625 26.987499999999997 26.0375 24.6125 38-39 21.87695777471495 27.051747901265504 26.8638015286305 24.207492795389047 40-41 22.475 26.487500000000004 26.2875 24.75 42-43 23.0125 26.937499999999996 25.474999999999998 24.575 44-45 22.3625 26.35 26.337500000000002 24.95 46-47 23.05479109331999 26.55741806354766 25.93194896172129 24.455841881411057 48-49 22.531328320802004 27.192982456140353 25.300751879699245 24.9749373433584 50-51 22.540675844806007 26.708385481852314 26.12015018773467 24.63078848560701 52-53 22.828535669586984 27.02127659574468 25.594493116395494 24.55569461827284 54-55 22.202775346918365 26.815851981497683 25.640705088136016 25.340667583447928 56-57 22.3375 25.724999999999998 26.8625 25.074999999999996 58-59 22.5834688008003 26.50994122796049 25.659622358384393 25.24696761285482 60-61 22.1875 26.825 25.900000000000002 25.087500000000002 62-63 22.665333166645834 25.59069883735467 26.128266033254157 25.61570196274534 64-65 23.0278784848106 26.740842605325664 25.490686335791974 24.74059257407176 66-67 22.968242060515127 26.319079769942487 26.406601650412604 24.306076519129782 68-69 22.537499999999998 26.450000000000003 26.237500000000004 24.775 70-71 22.225 26.637499999999996 25.874999999999996 25.2625 72-73 22.7375 26.3625 25.374999999999996 25.525 74-75 22.1375 26.6 26.3125 24.95 76-77 22.5 26.775 25.837500000000002 24.887500000000003 78-79 22.4375 26.35 26.237500000000004 24.975 80-81 21.8875 26.525 26.275 25.3125 82-83 21.6 26.35 26.6125 25.4375 84-85 22.925 26.224999999999998 26.1125 24.7375 86-87 22.3625 26.5125 25.4875 25.637500000000003 88-89 22.725 26.3625 26.237500000000004 24.675 90-91 22.6875 26.0625 25.7875 25.4625 92-93 23.425 25.7125 26.1 24.762500000000003 94-95 23.3875 25.275 25.95 25.387500000000003 96-97 23.375 25.374999999999996 26.25 25.0 98-99 23.400000000000002 25.45 25.587500000000002 25.5625 100-101 23.075000000000003 26.137500000000003 25.924999999999997 24.8625 102-103 23.7875 26.387500000000003 25.2375 24.587500000000002 104-105 23.1125 26.1125 26.724999999999998 24.05 106-107 23.3 26.400000000000002 25.224999999999998 25.074999999999996 108-109 23.275000000000002 26.8125 25.174999999999997 24.7375 110-111 23.4875 26.5125 25.2625 24.7375 112-113 23.2625 26.075 26.0125 24.65 114-115 24.1625 26.200000000000003 24.0625 25.575 116-117 23.1875 26.8375 25.2375 24.7375 118-119 23.7125 27.2625 24.625 24.4 120-121 24.125 26.474999999999998 24.9375 24.462500000000002 122-123 25.4375 25.8625 24.337500000000002 24.3625 124-125 25.15 27.5875 22.9875 24.275 126 24.85 26.450000000000003 24.625 24.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 4.0 28 6.5 29 8.5 30 15.0 31 18.0 32 22.0 33 33.0 34 42.0 35 58.0 36 72.5 37 83.5 38 117.5 39 148.5 40 161.0 41 180.5 42 207.0 43 200.5 44 199.5 45 214.5 46 208.5 47 197.5 48 169.0 49 144.0 50 139.5 51 132.0 52 119.5 53 107.0 54 97.5 55 83.0 56 67.0 57 66.5 58 69.5 59 72.0 60 61.0 61 50.0 62 48.0 63 49.5 64 45.5 65 40.5 66 38.5 67 33.0 68 29.5 69 25.0 70 21.0 71 18.5 72 18.5 73 16.0 74 11.5 75 7.5 76 6.0 77 5.5 78 3.5 79 2.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.375 36-37 0.0 38-39 0.2375 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.075 48-49 0.25 50-51 0.125 52-53 0.125 54-55 0.0125 56-57 0.0 58-59 0.0375 60-61 0.0 62-63 0.0125 64-65 0.0125 66-67 0.025 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.3125 0.0 0.0 0.0 0.0 108-109 2.7875 0.0 0.0 0.0 0.0 110-111 3.25 0.0 0.0 0.0 0.0 112-113 4.1875 0.0 0.0 0.0 0.0 114 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800668 spots for SRR7692658.sra Written 800668 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra Read 800654 spots for SRR7692658.sra Written 800654 spots for SRR7692658.sra SRR ids: ['SRR7692658.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ipnsd19 SRR7692658.sra spots: 16013094 blocks: [[1, 800654], [800655, 1601308], [1601309, 2401962], [2401963, 3202616], [3202617, 4003270], [4003271, 4803924], [4803925, 5604578], [5604579, 6405232], [6405233, 7205886], [7205887, 8006540], [8006541, 8807194], [8807195, 9607848], [9607849, 10408502], [10408503, 11209156], [11209157, 12009810], [12009811, 12810464], [12810465, 13611118], [13611119, 14411772], [14411773, 15212426], [15212427, 16013094]] SRR7692658 file size 5110332 SRR7692658 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692658 SRR7692658_1.fastq SRR7692658_2.fastq Input file: SRR7692658_1.fastq Paired file: SRR7692658_2.fastq trimmed: SRR7692658-trimmed-pair1.fastq, SRR7692658-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 16:10:25 2024 >> started Mon Dec 9 16:10:50 2024 >> done (24.573s) 16013094 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 16013094 (100.00%) read pairs available; of these: 1272272 ( 7.95%) trimmed read pairs available after processing 14740822 (92.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 75 10 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 2 0.00% 109 1 0.00% 110 21 0.00% 111 967 0.01% 112 15669 0.10% 113 66778 0.42% 114 72415 0.45% 115 77704 0.49% 116 82664 0.52% 117 86611 0.54% 118 91671 0.57% 119 95315 0.60% 120 99877 0.62% 121 104768 0.65% 122 110061 0.69% 123 115606 0.72% 124 122499 0.76% 125 129633 0.81% 126 14740822 92.05% 16013094 reads passed initial QC criterion=sequence-density sequence-density=3.78 sequence-density-rank=1 fanout-score=38.68 fanout-score-rank=1 prefix-density=3.91 prefix-fanout=37.3 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCCGTATCATT criterion=fanout-score sequence-density=3.78 sequence-density-rank=1 fanout-score=38.68 fanout-score-rank=1 prefix-density=3.91 prefix-fanout=37.3 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCCGTATCATT criterion=sequence-density sequence-density=3.85 sequence-density-rank=1 fanout-score=48.15 fanout-score-rank=2 prefix-density=3.88 prefix-fanout=47.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=19 fanout-score=108.82 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.7 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCCGTATCATT -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTGAAA -o SRR7692658 SRR7692658_1.fastq SRR7692658_2.fastq Input file: SRR7692658_1.fastq Paired file: SRR7692658_2.fastq trimmed: SRR7692658-trimmed-pair1.fastq, SRR7692658-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCCGT -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 16:21:18 2024 >> started Mon Dec 9 16:21:28 2024 >> done (10.754s) 8006547 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 657 ( 0.01%) empty read pairs filtered out after trimming by size control 8005886 (99.99%) read pairs available; of these: 332136 ( 4.15%) trimmed read pairs available after processing 7673750 (95.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 6 0.00% 32 3 0.00% 33 4 0.00% 34 3 0.00% 35 1 0.00% 36 9 0.00% 37 5 0.00% 38 3 0.00% 39 9 0.00% 40 6 0.00% 41 14 0.00% 42 9 0.00% 43 12 0.00% 44 12 0.00% 45 12 0.00% 46 22 0.00% 47 25 0.00% 48 20 0.00% 49 29 0.00% 50 34 0.00% 51 26 0.00% 52 49 0.00% 53 37 0.00% 54 30 0.00% 55 42 0.00% 56 52 0.00% 57 51 0.00% 58 62 0.00% 59 71 0.00% 60 97 0.00% 61 107 0.00% 62 128 0.00% 63 115 0.00% 64 158 0.00% 65 158 0.00% 66 187 0.00% 67 174 0.00% 68 203 0.00% 69 211 0.00% 70 254 0.00% 71 305 0.00% 72 359 0.00% 73 416 0.01% 74 455 0.01% 75 521 0.01% 76 557 0.01% 77 658 0.01% 78 714 0.01% 79 834 0.01% 80 913 0.01% 81 1005 0.01% 82 1231 0.02% 83 1367 0.02% 84 1553 0.02% 85 1700 0.02% 86 1964 0.02% 87 2209 0.03% 88 2417 0.03% 89 2797 0.03% 90 3107 0.04% 91 3627 0.05% 92 4038 0.05% 93 4568 0.06% 94 5156 0.06% 95 5986 0.07% 96 6799 0.08% 97 7700 0.10% 98 8411 0.11% 99 9370 0.12% 100 10428 0.13% 101 11450 0.14% 102 12876 0.16% 103 14454 0.18% 104 16096 0.20% 105 17550 0.22% 106 19424 0.24% 107 20883 0.26% 108 23143 0.29% 109 24667 0.31% 110 26476 0.33% 111 28754 0.36% 112 31087 0.39% 113 33405 0.42% 114 36204 0.45% 115 38824 0.48% 116 41771 0.52% 117 43461 0.54% 118 45650 0.57% 119 47640 0.60% 120 49927 0.62% 121 52531 0.66% 122 54880 0.69% 123 57773 0.72% 124 61101 0.76% 125 64880 0.81% 126 7037361 87.90% criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=27 prefix-density=0.43 prefix-fanout=2.2 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=38.24 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.5 sequence=CCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGTGTGTTCCTGTTCTGTTCCGTTCGCTATCCCTATGAATGAATGAAAAAAGAA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=21 prefix-density=0.39 prefix-fanout=2.0 sequence=GCAAGACATCTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=55.27 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.3 sequence=GAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGG SRR7692658 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 16:23:25 Started mapping on | Dec 09 16:23:25 Finished on | Dec 09 16:25:51 Mapping speed, Million of reads per hour | 394.83 Number of input reads | 16012433 Average input read length | 250 UNIQUE READS: Uniquely mapped reads number | 15246338 Uniquely mapped reads % | 95.22% Average mapped length | 248.91 Number of splices: Total | 12198180 Number of splices: Annotated (sjdb) | 11498990 Number of splices: GT/AG | 12029071 Number of splices: GC/AG | 146640 Number of splices: AT/AC | 4763 Number of splices: Non-canonical | 17706 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247170 % of reads mapped to multiple loci | 1.54% Number of reads mapped to too many loci | 17961 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518925 518925 518925 N_multimapping 247170 247170 247170 N_noFeature 651503 748687 14800489 N_ambiguous 400738 53687 1518 UnstrandedReadsAssigned:14194097 PositiveStrandReadsAssigned:14443964 NegativeStrandReadsAssigned:444331 Dataset is classified positive stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692658 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692658-trimmed-pair1.fastq SRR7692658-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,012,433 reads, 14,774,077 reads pseudoaligned [quant] estimated average fragment length: 156.366 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR7692658.ke.tsv 35125 SRR7692658.se.tsv 88098 total ==> SRR7692658.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 780.768 0 0 PNS24247 1044 888.634 27.9021 3.12209 PNS24249 1928 1772.63 50.6004 2.83835 PNS24246 1044 888.634 27.9021 3.12209 PNS24248 1044 888.634 27.9021 3.12209 PNS24244 1471 1315.63 113.693 8.59272 PNS24243 293 139.275 0 0 KQK14069 1603 1447.63 7165.02 492.141 KQK14071 474 319.726 349.221 108.606 ==> SRR7692658.se.tsv <== BRADI_1g14170v3 8201 BRADI_1g53295v3 112 BRADI_1g59795v3 620 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 145 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 427 BRADI_1g48960v3 0 SRR7692658 completed mapping pipeline successfully