Starting /dee2/code/volunteer_pipeline.sh SRR7692659 current disk space = 1523298447360 free memory = 1605422636 SRR7692659 SRAfilesize 10e6838b1228bdc4c864b162dd60f344 SRR7692659.sra SRR7692659.sra file validated SRR7692659 is paired end SRR7692659 is conventional basespace SRR7692659 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692659_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7775 33.0 33.0 34.0 32.0 34.0 2 32.84125 33.0 33.0 34.0 32.0 34.0 3 32.8375 33.0 33.0 34.0 32.0 34.0 4 32.841 34.0 33.0 34.0 32.0 34.0 5 32.86725 34.0 33.0 34.0 32.0 34.0 6 37.13175 38.0 38.0 38.0 36.0 38.0 7 36.97425 38.0 38.0 38.0 36.0 38.0 8 36.99575 38.0 38.0 38.0 36.0 38.0 9 36.9055 38.0 38.0 38.0 36.0 38.0 10-11 37.036874999999995 38.0 38.0 38.0 36.0 38.0 12-13 37.097125000000005 38.0 38.0 38.0 36.0 38.0 14-15 36.811499999999995 38.0 38.0 38.0 35.0 38.0 16-17 37.004375 38.0 38.0 38.0 36.0 38.0 18-19 36.975375 38.0 38.0 38.0 36.0 38.0 20-21 37.052 38.0 38.0 38.0 36.0 38.0 22-23 37.014875 38.0 38.0 38.0 36.0 38.0 24-25 37.00425 38.0 38.0 38.0 36.0 38.0 26-27 37.051625 38.0 38.0 38.0 36.5 38.0 28-29 37.138625000000005 38.0 38.0 38.0 37.0 38.0 30-31 37.14375 38.0 38.0 38.0 37.0 38.0 32-33 37.056875000000005 38.0 38.0 38.0 36.0 38.0 34-35 37.102000000000004 38.0 38.0 38.0 37.0 38.0 36-37 37.179249999999996 38.0 38.0 38.0 37.0 38.0 38-39 37.151375 38.0 38.0 38.0 36.5 38.0 40-41 37.14075 38.0 38.0 38.0 36.5 38.0 42-43 37.180125000000004 38.0 38.0 38.0 37.0 38.0 44-45 37.1035 38.0 38.0 38.0 36.5 38.0 46-47 37.08525 38.0 38.0 38.0 36.0 38.0 48-49 37.066125 38.0 38.0 38.0 36.5 38.0 50-51 37.103875 38.0 38.0 38.0 36.5 38.0 52-53 37.1145 38.0 38.0 38.0 36.5 38.0 54-55 37.10425 38.0 38.0 38.0 36.5 38.0 56-57 37.104749999999996 38.0 38.0 38.0 36.5 38.0 58-59 37.1145 38.0 38.0 38.0 37.0 38.0 60-61 37.168125 38.0 38.0 38.0 36.5 38.0 62-63 37.065250000000006 38.0 38.0 38.0 36.0 38.0 64-65 37.130624999999995 38.0 38.0 38.0 36.5 38.0 66-67 37.1065 38.0 38.0 38.0 36.0 38.0 68-69 37.0405 38.0 38.0 38.0 36.0 38.0 70-71 36.97425 38.0 38.0 38.0 36.0 38.0 72-73 37.062 38.0 38.0 38.0 36.5 38.0 74-75 36.986625000000004 38.0 38.0 38.0 36.0 38.0 76-77 36.96425 38.0 38.0 38.0 36.0 38.0 78-79 36.83475 38.0 38.0 38.0 35.5 38.0 80-81 36.867374999999996 38.0 38.0 38.0 35.5 38.0 82-83 36.8305 38.0 38.0 38.0 35.5 38.0 84-85 36.795625 38.0 38.0 38.0 35.0 38.0 86-87 36.860749999999996 38.0 38.0 38.0 35.5 38.0 88-89 36.854625 38.0 38.0 38.0 35.5 38.0 90-91 36.725125 38.0 38.0 38.0 35.0 38.0 92-93 36.750249999999994 38.0 38.0 38.0 35.0 38.0 94-95 36.79725 38.0 38.0 38.0 35.0 38.0 96-97 36.774 38.0 38.0 38.0 35.0 38.0 98-99 36.733875 38.0 38.0 38.0 35.0 38.0 100-101 36.632625 38.0 38.0 38.0 34.5 38.0 102-103 36.61675 38.0 38.0 38.0 34.5 38.0 104-105 36.54225 38.0 38.0 38.0 34.0 38.0 106-107 36.468375 38.0 38.0 38.0 34.0 38.0 108-109 36.426125 38.0 38.0 38.0 34.0 38.0 110-111 36.479625 38.0 38.0 38.0 34.0 38.0 112-113 36.276375 38.0 38.0 38.0 33.5 38.0 114-115 36.372 38.0 38.0 38.0 34.0 38.0 116-117 36.080124999999995 38.0 37.0 38.0 33.0 38.0 118-119 36.171625000000006 38.0 38.0 38.0 33.0 38.0 120-121 36.117875 38.0 38.0 38.0 32.5 38.0 122-123 35.668000000000006 38.0 36.0 38.0 31.0 38.0 124-125 35.5415 38.0 36.0 38.0 30.0 38.0 126 30.4375 34.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 2.0 18 9.0 19 12.0 20 4.0 21 8.0 22 11.0 23 4.0 24 10.0 25 10.0 26 9.0 27 16.0 28 24.0 29 22.0 30 28.0 31 36.0 32 46.0 33 52.0 34 103.0 35 160.0 36 440.0 37 2991.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.625 17.974999999999998 12.174999999999999 34.225 2 28.449999999999996 24.099999999999998 29.099999999999998 18.35 3 22.85 25.3 26.8 25.05 4 26.224999999999998 30.5 20.225 23.05 5 26.924999999999997 33.2 19.3 20.575 6 22.875 34.875 20.925 21.325 7 22.1 17.224999999999998 35.85 24.825 8 22.025 22.95 25.324999999999996 29.7 9 24.125 22.175 28.349999999999998 25.35 10-11 25.6125 28.000000000000004 20.837500000000002 25.55 12-13 25.637500000000003 22.5875 25.2 26.575 14-15 25.074999999999996 25.0375 25.412499999999998 24.474999999999998 16-17 26.5625 24.0625 24.3875 24.9875 18-19 25.8625 24.0125 24.9125 25.2125 20-21 25.924999999999997 24.45 24.525 25.1 22-23 25.4375 24.224999999999998 25.25 25.087500000000002 24-25 25.5625 25.2625 24.875 24.3 26-27 24.975 24.9875 25.5375 24.5 28-29 25.3125 25.1 24.5 25.087500000000002 30-31 26.137500000000003 24.425 25.174999999999997 24.2625 32-33 26.1125 25.1 25.3 23.4875 34-35 25.087500000000002 25.6 24.887500000000003 24.425 36-37 25.3 25.5125 24.7875 24.4 38-39 26.125 25.4875 25.374999999999996 23.0125 40-41 25.1 25.15 25.15 24.6 42-43 24.1875 25.2125 25.674999999999997 24.925 44-45 26.375 24.099999999999998 24.7375 24.7875 46-47 26.224999999999998 24.4875 24.8625 24.425 48-49 25.587500000000002 24.099999999999998 25.2625 25.05 50-51 25.55 24.887500000000003 25.6125 23.95 52-53 25.5125 25.1875 25.2875 24.0125 54-55 25.9625 24.3125 24.575 25.15 56-57 25.4 25.025 24.9125 24.6625 58-59 25.387500000000003 24.4375 25.7 24.474999999999998 60-61 25.8125 24.6625 24.95 24.575 62-63 25.35 25.224999999999998 25.4625 23.962500000000002 64-65 26.6 24.6875 24.5 24.212500000000002 66-67 25.8625 25.3 25.0625 23.775 68-69 25.424999999999997 25.362499999999997 25.7375 23.474999999999998 70-71 26.5 24.6875 24.9 23.9125 72-73 25.362499999999997 24.9 26.075 23.6625 74-75 24.675 25.074999999999996 26.487500000000004 23.7625 76-77 26.325 24.55 24.45 24.675 78-79 25.2875 25.525 25.7875 23.400000000000002 80-81 25.5625 24.4875 26.0375 23.9125 82-83 25.924999999999997 24.4375 25.124999999999996 24.5125 84-85 25.775 25.887500000000003 24.375 23.962500000000002 86-87 25.874999999999996 25.8625 25.5 22.7625 88-89 25.55 24.425 25.837500000000002 24.1875 90-91 25.775 24.837500000000002 25.8625 23.525 92-93 26.5125 24.5125 25.687500000000004 23.2875 94-95 25.1875 25.424999999999997 25.525 23.8625 96-97 25.0375 25.4875 25.587500000000002 23.8875 98-99 24.875 25.7 25.587500000000002 23.8375 100-101 25.0625 25.162499999999998 26.237500000000004 23.5375 102-103 26.3125 24.9 25.2375 23.549999999999997 104-105 25.4375 25.275 25.424999999999997 23.8625 106-107 26.0375 24.5625 26.0625 23.3375 108-109 25.3 25.912499999999998 25.137500000000003 23.65 110-111 25.924999999999997 25.825 25.174999999999997 23.075000000000003 112-113 25.900000000000002 25.4 25.687500000000004 23.0125 114-115 26.224999999999998 25.387500000000003 24.5625 23.825 116-117 25.7875 25.837500000000002 25.4375 22.9375 118-119 26.650000000000002 26.3125 24.349999999999998 22.6875 120-121 26.174999999999997 26.200000000000003 25.0 22.625 122-123 26.27235213204952 26.35988495685882 25.034387895460796 22.33337501563086 124-125 26.8375 25.624999999999996 24.7875 22.75 126 26.950000000000003 26.6 24.8 21.65 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 1.0 26 1.5 27 2.5 28 7.5 29 9.5 30 12.5 31 16.0 32 13.5 33 15.0 34 28.0 35 37.5 36 47.0 37 76.5 38 96.5 39 102.5 40 125.5 41 143.0 42 166.0 43 186.5 44 176.5 45 176.0 46 178.5 47 168.5 48 157.5 49 160.0 50 164.0 51 144.5 52 129.5 53 119.5 54 102.5 55 88.5 56 80.0 57 81.5 58 80.0 59 78.5 60 75.5 61 69.5 62 70.0 63 73.0 64 68.5 65 61.0 66 58.5 67 54.5 68 48.5 69 46.5 70 40.0 71 36.0 72 35.5 73 29.0 74 22.0 75 11.0 76 6.5 77 6.0 78 3.0 79 3.5 80 3.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0375 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.4783484390735146 0.95 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692659 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692659_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.52175 32.0 25.0 33.0 18.0 33.0 2 28.59125 30.0 27.0 33.0 18.0 33.0 3 31.05825 33.0 30.0 33.0 28.0 33.0 4 32.27175 33.0 33.0 33.0 31.0 34.0 5 32.5035 33.0 33.0 33.0 32.0 34.0 6 36.29575 38.0 36.0 38.0 33.0 38.0 7 36.6735 38.0 37.0 38.0 34.0 38.0 8 36.74175 38.0 38.0 38.0 34.0 38.0 9 37.21325 38.0 38.0 38.0 36.0 38.0 10-11 37.308499999999995 38.0 38.0 38.0 36.5 38.0 12-13 37.416624999999996 38.0 38.0 38.0 37.0 38.0 14-15 37.414 38.0 38.0 38.0 37.0 38.0 16-17 37.363625 38.0 38.0 38.0 37.0 38.0 18-19 37.39325 38.0 38.0 38.0 37.0 38.0 20-21 37.37125 38.0 38.0 38.0 37.0 38.0 22-23 37.345 38.0 38.0 38.0 37.0 38.0 24-25 37.43025 38.0 38.0 38.0 37.0 38.0 26-27 37.429 38.0 38.0 38.0 37.0 38.0 28-29 37.478624999999994 38.0 38.0 38.0 37.0 38.0 30-31 37.50675 38.0 38.0 38.0 38.0 38.0 32-33 37.487750000000005 38.0 38.0 38.0 37.5 38.0 34-35 37.268875 38.0 38.0 38.0 37.0 38.0 36-37 37.369 38.0 38.0 38.0 37.0 38.0 38-39 37.364 38.0 38.0 38.0 37.0 38.0 40-41 37.3895 38.0 38.0 38.0 37.0 38.0 42-43 37.378 38.0 38.0 38.0 37.0 38.0 44-45 37.439 38.0 38.0 38.0 37.0 38.0 46-47 37.389375 38.0 38.0 38.0 37.0 38.0 48-49 37.27175 38.0 38.0 38.0 37.0 38.0 50-51 37.406375 38.0 38.0 38.0 37.0 38.0 52-53 37.4045 38.0 38.0 38.0 37.0 38.0 54-55 37.4735 38.0 38.0 38.0 37.0 38.0 56-57 37.380250000000004 38.0 38.0 38.0 37.0 38.0 58-59 37.422625 38.0 38.0 38.0 37.0 38.0 60-61 37.45275 38.0 38.0 38.0 37.0 38.0 62-63 37.40825 38.0 38.0 38.0 37.0 38.0 64-65 37.321125 38.0 38.0 38.0 37.0 38.0 66-67 37.278625 38.0 38.0 38.0 37.0 38.0 68-69 37.3675 38.0 38.0 38.0 37.0 38.0 70-71 37.318875000000006 38.0 38.0 38.0 36.5 38.0 72-73 37.308375 38.0 38.0 38.0 36.5 38.0 74-75 37.235375000000005 38.0 38.0 38.0 36.0 38.0 76-77 37.222750000000005 38.0 38.0 38.0 36.0 38.0 78-79 37.307 38.0 38.0 38.0 36.5 38.0 80-81 37.17825 38.0 38.0 38.0 36.0 38.0 82-83 37.242375 38.0 38.0 38.0 36.5 38.0 84-85 37.287000000000006 38.0 38.0 38.0 36.0 38.0 86-87 37.1975 38.0 38.0 38.0 36.0 38.0 88-89 37.216875 38.0 38.0 38.0 36.0 38.0 90-91 37.13275 38.0 38.0 38.0 36.0 38.0 92-93 37.129375 38.0 38.0 38.0 36.0 38.0 94-95 37.015625 38.0 38.0 38.0 35.0 38.0 96-97 37.068125 38.0 38.0 38.0 36.0 38.0 98-99 36.91625 38.0 38.0 38.0 35.0 38.0 100-101 36.996875 38.0 38.0 38.0 35.0 38.0 102-103 36.870875 38.0 38.0 38.0 35.0 38.0 104-105 36.784375 38.0 38.0 38.0 35.0 38.0 106-107 36.48675 38.0 38.0 38.0 34.0 38.0 108-109 36.572874999999996 38.0 38.0 38.0 34.0 38.0 110-111 36.5505 38.0 38.0 38.0 34.0 38.0 112-113 36.712125 38.0 38.0 38.0 34.5 38.0 114-115 36.558 38.0 38.0 38.0 34.0 38.0 116-117 36.648250000000004 38.0 38.0 38.0 34.0 38.0 118-119 36.3875 38.0 37.5 38.0 34.0 38.0 120-121 36.422 38.0 38.0 38.0 34.0 38.0 122-123 36.360125 38.0 37.0 38.0 34.0 38.0 124-125 36.400375 38.0 38.0 38.0 34.0 38.0 126 32.294 36.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 3.0 24 3.0 25 4.0 26 7.0 27 7.0 28 13.0 29 19.0 30 22.0 31 36.0 32 46.0 33 79.0 34 102.0 35 166.0 36 562.0 37 2930.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.36735725113694 10.181910055583627 8.413340070742798 44.037392622536636 2 22.6 14.075 34.75 28.575 3 22.45 17.025000000000002 24.224999999999998 36.3 4 26.05 24.4 22.075 27.474999999999998 5 25.55 28.599999999999998 24.8 21.05 6 21.75 32.574999999999996 24.325 21.349999999999998 7 18.725 23.200000000000003 38.625 19.45 8 21.575 23.025000000000002 29.225 26.174999999999997 9 19.8 22.7 33.925 23.575 10-11 23.575 30.825000000000003 22.15 23.45 12-13 23.0125 24.525 27.0125 25.45 14-15 22.7625 25.575 26.400000000000002 25.2625 16-17 23.5375 25.8 26.1125 24.55 18-19 23.6875 26.2875 24.9125 25.112499999999997 20-21 22.7625 25.587500000000002 25.95 25.7 22-23 24.212500000000002 25.45 25.5 24.837500000000002 24-25 23.7125 25.162499999999998 25.0625 26.0625 26-27 22.977872234029252 25.728216027003377 26.440805100637583 24.85310663832979 28-29 24.425 26.025 25.124999999999996 24.425 30-31 24.1875 25.112499999999997 25.412499999999998 25.2875 32-33 24.075 25.0625 26.137500000000003 24.725 34-35 23.68817474265629 25.30755711775044 24.993723324127544 26.01054481546573 36-37 23.4625 24.2375 27.224999999999998 25.074999999999996 38-39 22.3614941087992 24.943594885936324 26.021559288042116 26.67335171722236 40-41 23.3625 25.637500000000003 25.7375 25.2625 42-43 23.6625 25.775 24.8125 25.75 44-45 23.4375 26.35 24.8625 25.35 46-47 23.40877829185945 26.30986619982493 25.09691134175316 25.184444166562457 48-49 23.6126769384943 26.030314418138545 24.689966178128522 25.66704246523863 50-51 23.979974968710888 25.00625782227785 24.831038798498124 26.18272841051314 52-53 23.95194593918158 25.34100863471405 25.954198473282442 24.752846952821926 54-55 23.1615807903952 24.862431215607803 25.400200100050025 26.575787893946973 56-57 23.92799099887486 25.240655081885237 24.990623827978496 25.84073009126141 58-59 22.811405702851424 25.72536268134067 25.72536268134067 25.737868934467233 60-61 23.7625 25.6 24.637500000000003 26.0 62-63 23.443360840210055 26.03150787696924 25.481370342585645 25.04376094023506 64-65 23.796423658872076 25.447042640990368 25.09691134175316 25.659622358384393 66-67 24.062031015507753 25.50025012506253 25.050025012506254 25.387693846923458 68-69 23.93098274568642 25.55638909727432 25.081270317579396 25.431357839459867 70-71 24.034012754783042 25.409528573214956 24.90934100287608 25.647117669125922 72-73 24.0 25.15 25.0375 25.8125 74-75 23.799999999999997 25.3125 25.6125 25.275 76-77 24.4 25.45 24.6125 25.5375 78-79 23.849999999999998 25.474999999999998 25.55 25.124999999999996 80-81 23.0375 25.474999999999998 25.4625 26.025 82-83 23.925 25.6125 24.125 26.337500000000002 84-85 23.4375 24.587500000000002 25.687500000000004 26.2875 86-87 23.7125 24.825 25.224999999999998 26.237500000000004 88-89 23.9 26.2625 24.3125 25.525 90-91 23.9875 25.2625 24.85 25.900000000000002 92-93 24.656164041010253 25.268817204301076 24.868717179294826 25.206301575393848 94-95 24.259097161435538 25.009378516943855 25.196948855820935 25.534575465799676 96-97 23.99349837459365 24.85621405351338 24.90622655663916 26.244061015253813 98-99 23.865483185398176 25.040630078759847 25.478184773096636 25.61570196274534 100-101 24.21552694086761 24.815601950243778 24.603075384423054 26.365795724465556 102-103 24.474999999999998 25.587500000000002 24.8125 25.124999999999996 104-105 24.875 25.1875 25.15 24.7875 106-107 25.25 25.1 24.55 25.1 108-109 24.45 24.762500000000003 24.675 26.1125 110-111 24.25 25.124999999999996 24.875 25.75 112-113 25.3 26.025 23.3375 25.337500000000002 114-115 24.45 25.5125 25.05 24.9875 116-117 24.575 25.637500000000003 24.25 25.5375 118-119 25.112499999999997 26.0 24.2875 24.6 120-121 24.95 25.924999999999997 24.3875 24.7375 122-123 24.4875 25.587500000000002 24.837500000000002 25.087500000000002 124-125 25.874999999999996 26.025 23.575 24.525 126 24.975 25.45 24.6 24.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 2.0 28 4.0 29 6.0 30 10.0 31 16.5 32 18.5 33 22.0 34 33.5 35 37.5 36 53.5 37 78.5 38 92.5 39 108.5 40 132.0 41 158.0 42 177.0 43 183.0 44 188.5 45 198.5 46 183.0 47 180.0 48 185.0 49 174.5 50 153.0 51 130.5 52 117.0 53 106.5 54 101.5 55 95.0 56 91.5 57 80.5 58 71.5 59 75.0 60 83.0 61 73.5 62 57.5 63 56.0 64 59.0 65 57.0 66 51.5 67 47.5 68 43.5 69 38.0 70 33.5 71 29.0 72 23.5 73 19.5 74 16.0 75 15.0 76 12.5 77 8.0 78 4.5 79 2.0 80 1.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.42500000000000004 36-37 0.0 38-39 0.27499999999999997 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0375 48-49 0.21250000000000002 50-51 0.125 52-53 0.11249999999999999 54-55 0.05 56-57 0.0125 58-59 0.05 60-61 0.0 62-63 0.025 64-65 0.0375 66-67 0.05 68-69 0.025 70-71 0.0375 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0375 96-97 0.025 98-99 0.0125 100-101 0.0125 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.4778672032193159 0.95 3 0.025150905432595575 0.075 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0125 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.05 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.05 0.0 0.0 0.0 0.025 80-81 0.05 0.0 0.0 0.0 0.025 82-83 0.05 0.0 0.0 0.0 0.025 84-85 0.05 0.0 0.0 0.0 0.025 86-87 0.075 0.0 0.0 0.0 0.025 88-89 0.075 0.0 0.0 0.0 0.025 90-91 0.1 0.0 0.0 0.0 0.025 92-93 0.1375 0.0 0.0 0.0 0.025 94-95 0.15 0.0 0.0 0.0 0.025 96-97 0.2 0.0 0.0 0.0 0.025 98-99 0.2875 0.0 0.0 0.0 0.025 100-101 0.3625 0.0 0.0 0.0 0.025 102-103 0.6000000000000001 0.0 0.0 0.0 0.025 104-105 0.8374999999999999 0.0 0.0 0.0 0.025 106-107 1.0875 0.0 0.0 0.0 0.025 108-109 1.4874999999999998 0.0 0.0 0.0 0.025 110-111 1.925 0.0 0.0 0.0 0.025 112-113 2.5875 0.0 0.0 0.0 0.025 114 3.225 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661284 spots for SRR7692659.sra Written 661284 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra Read 661275 spots for SRR7692659.sra Written 661275 spots for SRR7692659.sra SRR ids: ['SRR7692659.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rss4wk9u SRR7692659.sra spots: 13225509 blocks: [[1, 661275], [661276, 1322550], [1322551, 1983825], [1983826, 2645100], [2645101, 3306375], [3306376, 3967650], [3967651, 4628925], [4628926, 5290200], [5290201, 5951475], [5951476, 6612750], [6612751, 7274025], [7274026, 7935300], [7935301, 8596575], [8596576, 9257850], [9257851, 9919125], [9919126, 10580400], [10580401, 11241675], [11241676, 11902950], [11902951, 12564225], [12564226, 13225509]] SRR7692659 file size 4218830 SRR7692659 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692659 SRR7692659_1.fastq SRR7692659_2.fastq Input file: SRR7692659_1.fastq Paired file: SRR7692659_2.fastq trimmed: SRR7692659-trimmed-pair1.fastq, SRR7692659-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 16:05:35 2024 >> started Mon Dec 9 16:05:51 2024 >> done (16.103s) 13225509 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 13225509 (100.00%) read pairs available; of these: 912931 ( 6.90%) trimmed read pairs available after processing 12312578 (93.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 75 5 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 3 0.00% 109 2 0.00% 110 13 0.00% 111 524 0.00% 112 10402 0.08% 113 45122 0.34% 114 49624 0.38% 115 53556 0.40% 116 57268 0.43% 117 60876 0.46% 118 65104 0.49% 119 68171 0.52% 120 72078 0.54% 121 76839 0.58% 122 81303 0.61% 123 84474 0.64% 124 90906 0.69% 125 96661 0.73% 126 12312578 93.10% 13225509 reads passed initial QC criterion=sequence-density sequence-density=2.54 sequence-density-rank=1 fanout-score=35.37 fanout-score-rank=4 prefix-density=2.64 prefix-fanout=34.0 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCTCGGTGGTCGCCGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=85.73 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=18.3 sequence=CAAGAAGAAGGT criterion=sequence-density sequence-density=2.58 sequence-density-rank=1 fanout-score=46.91 fanout-score-rank=2 prefix-density=2.61 prefix-fanout=46.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=205.87 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=13.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACCGGAACC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCTCGGTGGTCGCCGT -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATGCCGTCTTCTGCTTG -o SRR7692659 SRR7692659_1.fastq SRR7692659_2.fastq Input file: SRR7692659_1.fastq Paired file: SRR7692659_2.fastq trimmed: SRR7692659-trimmed-pair1.fastq, SRR7692659-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCTCGGTGGTCGCCGT -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 16:20:35 2024 >> started Mon Dec 9 16:20:40 2024 >> done (5.096s) 4408503 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 75 ( 0.00%) empty read pairs filtered out after trimming by size control 4408427 (100.00%) read pairs available; of these: 121214 ( 2.75%) trimmed read pairs available after processing 4287213 (97.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 1 0.00% 36 1 0.00% 37 1 0.00% 38 3 0.00% 39 3 0.00% 40 0 0.00% 41 1 0.00% 42 0 0.00% 43 2 0.00% 44 2 0.00% 45 2 0.00% 46 4 0.00% 47 5 0.00% 48 2 0.00% 49 3 0.00% 50 2 0.00% 51 3 0.00% 52 3 0.00% 53 5 0.00% 54 11 0.00% 55 7 0.00% 56 6 0.00% 57 6 0.00% 58 8 0.00% 59 15 0.00% 60 11 0.00% 61 18 0.00% 62 21 0.00% 63 25 0.00% 64 20 0.00% 65 30 0.00% 66 21 0.00% 67 27 0.00% 68 37 0.00% 69 27 0.00% 70 50 0.00% 71 51 0.00% 72 57 0.00% 73 59 0.00% 74 68 0.00% 75 88 0.00% 76 106 0.00% 77 113 0.00% 78 134 0.00% 79 134 0.00% 80 178 0.00% 81 198 0.00% 82 230 0.01% 83 262 0.01% 84 313 0.01% 85 357 0.01% 86 407 0.01% 87 432 0.01% 88 503 0.01% 89 620 0.01% 90 717 0.02% 91 813 0.02% 92 999 0.02% 93 1167 0.03% 94 1437 0.03% 95 1613 0.04% 96 1874 0.04% 97 2209 0.05% 98 2639 0.06% 99 2949 0.07% 100 3348 0.08% 101 3947 0.09% 102 4497 0.10% 103 5249 0.12% 104 5911 0.13% 105 6821 0.15% 106 7698 0.17% 107 8633 0.20% 108 9578 0.22% 109 10415 0.24% 110 11550 0.26% 111 12440 0.28% 112 13712 0.31% 113 15227 0.35% 114 16582 0.38% 115 17808 0.40% 116 18994 0.43% 117 20313 0.46% 118 21468 0.49% 119 22701 0.51% 120 23911 0.54% 121 25469 0.58% 122 27013 0.61% 123 28255 0.64% 124 30448 0.69% 125 32237 0.73% 126 3983090 90.35% criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=2.6 sequence=GTCACCGGCAAGGGTCCCCTTGAGAACCTCGCTGACCACCTTGCCGACCCCGTCAACAACAACGCGTGGGCCTTTGCCACCAACTTCGTTCCCGGCAAGTAAGGTGTCAATGAGAGGCACATGTGTATATGCAAATCGACTATGCTCGCGACCAAGTGTGTGTAGCTGGTTTCACTTGTACTACCACGATGATGATGTAAATTAATTACGAGGATCTTATGAACAAAAGAT criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=87.50 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=18.5 sequence=CAAGAAGAAGGT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=29 prefix-density=0.30 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=197.86 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=13.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC SRR7692659 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 16:23:21 Started mapping on | Dec 09 16:23:21 Finished on | Dec 09 16:25:30 Mapping speed, Million of reads per hour | 369.08 Number of input reads | 13225433 Average input read length | 250 UNIQUE READS: Uniquely mapped reads number | 12558794 Uniquely mapped reads % | 94.96% Average mapped length | 249.77 Number of splices: Total | 10624093 Number of splices: Annotated (sjdb) | 10045194 Number of splices: GT/AG | 10480558 Number of splices: GC/AG | 124961 Number of splices: AT/AC | 4635 Number of splices: Non-canonical | 13939 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 168806 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 12511 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 497833 497833 497833 N_multimapping 168806 168806 168806 N_noFeature 547947 632477 12235852 N_ambiguous 277827 39777 1312 UnstrandedReadsAssigned:11733020 PositiveStrandReadsAssigned:11886540 NegativeStrandReadsAssigned:321630 Dataset is classified positive stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692659 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692659-trimmed-pair1.fastq SRR7692659-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,225,433 reads, 12,113,487 reads pseudoaligned [quant] estimated average fragment length: 158.03 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR7692659.ke.tsv 35125 SRR7692659.se.tsv 88098 total ==> SRR7692659.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 779.111 0 0 PNS24247 1044 886.97 40.1639 5.72647 PNS24249 1928 1770.97 100.928 7.20707 PNS24246 1044 886.97 40.1639 5.72647 PNS24248 1044 886.97 40.1639 5.72647 PNS24244 1471 1313.97 48.5807 4.67561 PNS24243 293 137.627 0 0 KQK14069 1603 1445.97 8646.21 756.183 KQK14071 474 318.193 430.308 171.021 ==> SRR7692659.se.tsv <== BRADI_1g14170v3 9788 BRADI_1g53295v3 90 BRADI_1g59795v3 497 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 89 BRADI_1g74790v3 63 BRADI_1g09890v3 0 BRADI_1g77505v3 291 BRADI_1g48960v3 0 SRR7692659 completed mapping pipeline successfully