Starting /dee2/code/volunteer_pipeline.sh SRR7804078 current disk space = 1515874693120 free memory = 1607699908 SRR7804078 SRAfilesize d1d6e5fd0919f0d7e8d558472425fcd7 SRR7804078.sra SRR7804078.sra file validated SRR7804078 is paired end SRR7804078 is conventional basespace SRR7804078 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804078_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2115 37.0 37.0 37.0 37.0 37.0 2 36.24125 37.0 37.0 37.0 37.0 37.0 3 36.363 37.0 37.0 37.0 37.0 37.0 4 36.465 37.0 37.0 37.0 37.0 37.0 5 36.4895 37.0 37.0 37.0 37.0 37.0 6 36.4445 37.0 37.0 37.0 37.0 37.0 7 36.446 37.0 37.0 37.0 37.0 37.0 8 36.412 37.0 37.0 37.0 37.0 37.0 9 36.5225 37.0 37.0 37.0 37.0 37.0 10-14 36.4717 37.0 37.0 37.0 37.0 37.0 15-19 36.4653 37.0 37.0 37.0 37.0 37.0 20-24 36.4108 37.0 37.0 37.0 37.0 37.0 25-29 36.3965 37.0 37.0 37.0 37.0 37.0 30-34 36.4116 37.0 37.0 37.0 37.0 37.0 35-39 36.386700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.431200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.384100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3465 37.0 37.0 37.0 37.0 37.0 55-59 36.377300000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3215 37.0 37.0 37.0 37.0 37.0 65-69 36.3287 37.0 37.0 37.0 37.0 37.0 70-74 36.224900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2496 37.0 37.0 37.0 37.0 37.0 80-84 36.21509999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.181599999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1994 37.0 37.0 37.0 37.0 37.0 95-99 36.102599999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1424 37.0 37.0 37.0 37.0 37.0 105-109 36.04860000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.0339 37.0 37.0 37.0 37.0 37.0 115-119 36.0706 37.0 37.0 37.0 37.0 37.0 120-124 35.9683 37.0 37.0 37.0 37.0 37.0 125-129 35.8487 37.0 37.0 37.0 37.0 37.0 130-134 35.8173 37.0 37.0 37.0 37.0 37.0 135-139 35.811600000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.7447 37.0 37.0 37.0 37.0 37.0 145-149 35.7729 37.0 37.0 37.0 37.0 37.0 150-151 35.29575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 5.0 27 11.0 28 13.0 29 22.0 30 31.0 31 47.0 32 59.0 33 85.0 34 153.0 35 312.0 36 2817.0 37 442.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.175 13.325000000000001 8.674999999999999 33.825 2 26.207759699624532 14.743429286608261 29.737171464330416 29.311639549436798 3 24.224999999999998 18.8 23.799999999999997 33.175 4 26.3 22.900000000000002 21.475 29.325000000000003 5 26.724999999999998 25.2 24.15 23.925 6 24.375 29.575000000000003 22.725 23.325000000000003 7 20.5 21.7 35.125 22.675 8 21.4 21.775 29.2 27.625 9 21.425 20.225 32.45 25.900000000000002 10-14 24.765 24.005000000000003 24.23 27.0 15-19 23.830000000000002 24.205 24.75 27.215 20-24 24.435000000000002 23.735 24.610000000000003 27.22 25-29 23.865 24.23 24.91 26.995 30-34 24.3 24.115000000000002 24.58 27.005000000000003 35-39 24.82 23.474999999999998 24.86 26.845000000000002 40-44 24.84 23.165 24.795 27.200000000000003 45-49 24.585 23.815 23.990000000000002 27.61 50-54 24.785 23.605 24.235 27.375 55-59 25.005 23.64 24.185000000000002 27.169999999999998 60-64 24.54 23.535 23.915 28.01 65-69 25.130000000000003 23.405 23.525 27.939999999999998 70-74 25.180000000000003 23.45 23.974999999999998 27.395000000000003 75-79 26.169999999999998 22.66 23.965 27.205000000000002 80-84 25.27 23.169999999999998 23.880000000000003 27.68 85-89 25.45 23.455000000000002 23.39 27.705000000000002 90-94 25.83 22.515 24.0 27.655 95-99 25.155 23.080000000000002 24.275 27.49 100-104 25.765 23.064999999999998 24.27 26.900000000000002 105-109 25.395 22.43 24.169999999999998 28.005000000000003 110-114 25.395 22.895 23.755000000000003 27.955000000000002 115-119 25.490000000000002 22.985 23.974999999999998 27.55 120-124 26.474999999999998 22.935 23.31 27.279999999999998 125-129 26.11 22.814999999999998 23.445 27.63 130-134 26.135 22.93 23.865 27.07 135-139 26.275 22.95 23.46 27.315 140-144 26.935 22.785 23.46 26.82 145-149 25.855 23.035 23.66 27.450000000000003 150-151 25.525 22.5 24.0625 27.9125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 2.0 26 3.0 27 2.0 28 3.0 29 5.0 30 8.0 31 11.5 32 12.0 33 16.5 34 24.5 35 35.0 36 47.5 37 50.0 38 62.0 39 70.0 40 77.5 41 99.0 42 125.0 43 144.5 44 144.5 45 149.5 46 152.5 47 146.5 48 137.5 49 132.5 50 141.0 51 139.0 52 129.0 53 119.0 54 123.5 55 136.5 56 125.5 57 111.5 58 114.0 59 117.0 60 109.0 61 103.5 62 90.5 63 76.0 64 69.0 65 71.0 66 76.5 67 71.0 68 62.5 69 52.5 70 39.5 71 39.5 72 47.0 73 41.0 74 34.5 75 29.0 76 20.5 77 14.5 78 10.5 79 8.5 80 5.5 81 3.5 82 3.0 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.2279792746114 84.55 2 6.626670302699754 12.15 3 0.9817289337332971 2.7 4 0.1636214889555495 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.725 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGATCT 10 0.006830828 145.0 3 ATCGATC 10 0.006830828 145.0 2 CGATCTG 10 0.006830828 145.0 4 >>END_MODULE SRR7804078 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804078_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.27425 37.0 37.0 37.0 37.0 37.0 2 36.089 37.0 37.0 37.0 37.0 37.0 3 35.9675 37.0 37.0 37.0 37.0 37.0 4 36.217 37.0 37.0 37.0 37.0 37.0 5 36.149 37.0 37.0 37.0 37.0 37.0 6 36.166 37.0 37.0 37.0 37.0 37.0 7 35.999 37.0 37.0 37.0 37.0 37.0 8 36.174 37.0 37.0 37.0 37.0 37.0 9 36.0635 37.0 37.0 37.0 37.0 37.0 10-14 36.06609999999999 37.0 37.0 37.0 37.0 37.0 15-19 35.9785 37.0 37.0 37.0 37.0 37.0 20-24 35.949400000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.9328 37.0 37.0 37.0 37.0 37.0 30-34 35.9145 37.0 37.0 37.0 37.0 37.0 35-39 35.89059999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.8846 37.0 37.0 37.0 37.0 37.0 45-49 35.818999999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.7995 37.0 37.0 37.0 37.0 37.0 55-59 35.754 37.0 37.0 37.0 37.0 37.0 60-64 35.7397 37.0 37.0 37.0 37.0 37.0 65-69 35.715700000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.655100000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.6456 37.0 37.0 37.0 37.0 37.0 80-84 35.5981 37.0 37.0 37.0 37.0 37.0 85-89 35.677 37.0 37.0 37.0 37.0 37.0 90-94 35.637 37.0 37.0 37.0 37.0 37.0 95-99 35.5703 37.0 37.0 37.0 37.0 37.0 100-104 35.543600000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.4621 37.0 37.0 37.0 37.0 37.0 110-114 35.3569 37.0 37.0 37.0 37.0 37.0 115-119 35.366200000000006 37.0 37.0 37.0 34.6 37.0 120-124 35.3883 37.0 37.0 37.0 37.0 37.0 125-129 35.2925 37.0 37.0 37.0 37.0 37.0 130-134 35.3185 37.0 37.0 37.0 37.0 37.0 135-139 35.244699999999995 37.0 37.0 37.0 32.2 37.0 140-144 35.18429999999999 37.0 37.0 37.0 32.2 37.0 145-149 35.0336 37.0 37.0 37.0 25.0 37.0 150-151 34.497 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 8.0 14 13.0 15 7.0 16 1.0 17 0.0 18 5.0 19 4.0 20 5.0 21 8.0 22 12.0 23 11.0 24 8.0 25 10.0 26 15.0 27 18.0 28 15.0 29 27.0 30 24.0 31 40.0 32 54.0 33 83.0 34 169.0 35 556.0 36 2659.0 37 245.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.36034008502126 17.829457364341085 10.302575643910977 30.50762690672668 2 31.974999999999998 22.325 24.15 21.55 3 26.150000000000002 23.825 25.674999999999997 24.349999999999998 4 29.299999999999997 28.799999999999997 18.05 23.849999999999998 5 30.275000000000002 30.925000000000004 17.1 21.7 6 25.85 32.475 18.5 23.175 7 25.424999999999997 20.424999999999997 29.75 24.4 8 28.125 20.974999999999998 20.575 30.325000000000003 9 26.224999999999998 21.95 23.625 28.199999999999996 10-14 28.365000000000002 24.425 20.585 26.625 15-19 27.975 24.310000000000002 21.57 26.145000000000003 20-24 27.665 24.665 21.415 26.255 25-29 27.6 24.02 22.23 26.150000000000002 30-34 27.245 24.725 21.78 26.25 35-39 27.134999999999998 24.6 21.62 26.645000000000003 40-44 28.205000000000002 23.585 22.045 26.165 45-49 28.175 24.025 21.275 26.525 50-54 27.365000000000002 24.560000000000002 21.785 26.290000000000003 55-59 27.975 24.145 21.66 26.22 60-64 27.49 23.885 22.05 26.575 65-69 27.98 23.974999999999998 21.22 26.825 70-74 27.915 24.154999999999998 21.685 26.245 75-79 27.0 24.529999999999998 21.759999999999998 26.71 80-84 28.08 23.974999999999998 21.634999999999998 26.31 85-89 27.77 23.595 21.825 26.810000000000002 90-94 27.055 24.52 22.365 26.06 95-99 28.075 24.275 21.34 26.31 100-104 27.655 24.845 21.365000000000002 26.135 105-109 27.845 24.42 22.134999999999998 25.6 110-114 27.860000000000003 24.995 21.51 25.635 115-119 28.050000000000004 24.355 21.445 26.150000000000002 120-124 28.125 24.515 21.345 26.015 125-129 27.765 24.72 21.78 25.735000000000003 130-134 28.225 24.425 21.7 25.650000000000002 135-139 28.155 24.75 21.66 25.435000000000002 140-144 29.035 25.025 21.245 24.695 145-149 28.93 24.41 21.605 25.055 150-151 28.512500000000003 24.2 22.95 24.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.5 9 1.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 1.5 16 2.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.0 22 2.0 23 2.0 24 2.0 25 2.0 26 3.0 27 4.0 28 3.0 29 2.0 30 3.5 31 6.0 32 6.0 33 8.5 34 12.5 35 18.5 36 31.5 37 39.0 38 36.5 39 49.5 40 72.0 41 83.5 42 97.0 43 121.5 44 134.5 45 138.5 46 144.5 47 144.5 48 138.5 49 134.0 50 122.5 51 114.5 52 118.5 53 124.5 54 131.5 55 124.0 56 113.0 57 110.5 58 119.5 59 119.0 60 105.0 61 103.5 62 105.5 63 97.5 64 90.0 65 92.0 66 93.5 67 99.5 68 86.5 69 71.5 70 69.0 71 56.5 72 53.5 73 47.0 74 38.0 75 35.0 76 29.0 77 19.5 78 13.5 79 10.5 80 6.5 81 3.5 82 4.5 83 3.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 1.5 91 1.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 0.0 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.22161572052401 84.475 2 6.604803493449782 12.1 3 1.037117903930131 2.85 4 0.10917030567685589 0.4 5 0.0 0.0 6 0.0 0.0 7 0.02729257641921397 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.8625 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.725 0.0 0.0 0.0 0.0 138-139 3.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467597 spots for SRR7804078.sra Written 1467597 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra Read 1467578 spots for SRR7804078.sra Written 1467578 spots for SRR7804078.sra SRR ids: ['SRR7804078.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m6f_qy5a SRR7804078.sra spots: 29351579 blocks: [[1, 1467578], [1467579, 2935156], [2935157, 4402734], [4402735, 5870312], [5870313, 7337890], [7337891, 8805468], [8805469, 10273046], [10273047, 11740624], [11740625, 13208202], [13208203, 14675780], [14675781, 16143358], [16143359, 17610936], [17610937, 19078514], [19078515, 20546092], [20546093, 22013670], [22013671, 23481248], [23481249, 24948826], [24948827, 26416404], [26416405, 27883982], [27883983, 29351579]] SRR7804078 file size 9924586 SRR7804078 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804078 SRR7804078_1.fastq SRR7804078_2.fastq Input file: SRR7804078_1.fastq Paired file: SRR7804078_2.fastq trimmed: SRR7804078-trimmed-pair1.fastq, SRR7804078-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:06:14 2024 >> started Thu Dec 12 03:06:47 2024 >> done (32.895s) 29351579 read pairs processed; of these: 110 ( 0.00%) short read pairs filtered out after trimming by size control 6929 ( 0.02%) empty read pairs filtered out after trimming by size control 29344540 (99.98%) read pairs available; of these: 1313909 ( 4.48%) trimmed read pairs available after processing 28030631 (95.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 11 0.00% 21 8 0.00% 22 11 0.00% 23 11 0.00% 24 23 0.00% 25 13 0.00% 26 13 0.00% 27 22 0.00% 28 17 0.00% 29 16 0.00% 30 23 0.00% 31 33 0.00% 32 25 0.00% 33 21 0.00% 34 16 0.00% 35 20 0.00% 36 31 0.00% 37 23 0.00% 38 33 0.00% 39 24 0.00% 40 33 0.00% 41 34 0.00% 42 36 0.00% 43 31 0.00% 44 30 0.00% 45 32 0.00% 46 42 0.00% 47 42 0.00% 48 35 0.00% 49 46 0.00% 50 45 0.00% 51 47 0.00% 52 51 0.00% 53 50 0.00% 54 54 0.00% 55 58 0.00% 56 75 0.00% 57 61 0.00% 58 61 0.00% 59 71 0.00% 60 83 0.00% 61 78 0.00% 62 82 0.00% 63 79 0.00% 64 79 0.00% 65 98 0.00% 66 109 0.00% 67 122 0.00% 68 151 0.00% 69 137 0.00% 70 153 0.00% 71 182 0.00% 72 252 0.00% 73 270 0.00% 74 266 0.00% 75 279 0.00% 76 332 0.00% 77 400 0.00% 78 418 0.00% 79 490 0.00% 80 526 0.00% 81 596 0.00% 82 736 0.00% 83 846 0.00% 84 932 0.00% 85 996 0.00% 86 1155 0.00% 87 1343 0.00% 88 1410 0.00% 89 1552 0.01% 90 1711 0.01% 91 2011 0.01% 92 2315 0.01% 93 2587 0.01% 94 2845 0.01% 95 3204 0.01% 96 3629 0.01% 97 3764 0.01% 98 3921 0.01% 99 4243 0.01% 100 4768 0.02% 101 5260 0.02% 102 5492 0.02% 103 6086 0.02% 104 6823 0.02% 105 7104 0.02% 106 7800 0.03% 107 8210 0.03% 108 8633 0.03% 109 9104 0.03% 110 9794 0.03% 111 10420 0.04% 112 11392 0.04% 113 11824 0.04% 114 13067 0.04% 115 13825 0.05% 116 14659 0.05% 117 14778 0.05% 118 15504 0.05% 119 16226 0.06% 120 17045 0.06% 121 18081 0.06% 122 18959 0.06% 123 20591 0.07% 124 21738 0.07% 125 22802 0.08% 126 24115 0.08% 127 24330 0.08% 128 25057 0.09% 129 26328 0.09% 130 26749 0.09% 131 28126 0.10% 132 29294 0.10% 133 31158 0.11% 134 32558 0.11% 135 33991 0.12% 136 35156 0.12% 137 36005 0.12% 138 37107 0.13% 139 38593 0.13% 140 39049 0.13% 141 39885 0.14% 142 42709 0.15% 143 44211 0.15% 144 45868 0.16% 145 48546 0.17% 146 49610 0.17% 147 50872 0.17% 148 51963 0.18% 149 52664 0.18% 150 54251 0.18% 151 28030631 95.52% 29344540 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=20 prefix-density=0.91 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=40.53 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.3 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=11 prefix-density=0.76 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=21.99 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804078 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:07:35 Started mapping on | Dec 12 03:07:35 Finished on | Dec 12 03:13:24 Mapping speed, Million of reads per hour | 302.69 Number of input reads | 29344540 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 24186681 Uniquely mapped reads % | 82.42% Average mapped length | 299.08 Number of splices: Total | 23318604 Number of splices: Annotated (sjdb) | 22071959 Number of splices: GT/AG | 22960112 Number of splices: GC/AG | 294596 Number of splices: AT/AC | 8789 Number of splices: Non-canonical | 55107 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1262336 % of reads mapped to multiple loci | 4.30% Number of reads mapped to too many loci | 176387 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.01% % of reads unmapped: other | 4.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3895523 3895523 3895523 N_multimapping 1262336 1262336 1262336 N_noFeature 1709076 23435753 1867654 N_ambiguous 732805 4070 141843 UnstrandedReadsAssigned:21744800 PositiveStrandReadsAssigned:746858 NegativeStrandReadsAssigned:22177184 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804078 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804078-trimmed-pair1.fastq SRR7804078-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,344,540 reads, 22,936,122 reads pseudoaligned [quant] estimated average fragment length: 283.331 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR7804078.ke.tsv 35125 SRR7804078.se.tsv 88098 total ==> SRR7804078.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.042 2.39892e-08 1.82153e-09 PNS24247 1044 761.669 71.371 4.65352 PNS24249 1928 1645.67 127.439 3.84579 PNS24246 1044 761.669 71.371 4.65352 PNS24248 1044 761.669 71.371 4.65352 PNS24244 1471 1188.67 125.448 5.24118 PNS24243 293 80.3418 0 0 KQK14069 1603 1320.67 3925.86 147.628 KQK14071 474 213.76 32.3126 7.50708 ==> SRR7804078.se.tsv <== BRADI_1g14170v3 3956 BRADI_1g53295v3 813 BRADI_1g59795v3 282 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 338 BRADI_1g74790v3 498 BRADI_1g09890v3 0 BRADI_1g77505v3 579 BRADI_1g48960v3 0 SRR7804078 completed mapping pipeline successfully