Starting /dee2/code/volunteer_pipeline.sh SRR7804079 current disk space = 1541896011776 free memory = 1607572388 SRR7804079 SRAfilesize c67657f4ff93ee7d3d10bac1ca228976 SRR7804079.sra SRR7804079.sra file validated SRR7804079 is paired end SRR7804079 is conventional basespace SRR7804079 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804079_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.348 37.0 37.0 37.0 37.0 37.0 2 36.377 37.0 37.0 37.0 37.0 37.0 3 36.4635 37.0 37.0 37.0 37.0 37.0 4 36.606 37.0 37.0 37.0 37.0 37.0 5 36.5935 37.0 37.0 37.0 37.0 37.0 6 36.5425 37.0 37.0 37.0 37.0 37.0 7 36.516 37.0 37.0 37.0 37.0 37.0 8 36.517 37.0 37.0 37.0 37.0 37.0 9 36.562 37.0 37.0 37.0 37.0 37.0 10-14 36.540400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.534800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.50449999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4445 37.0 37.0 37.0 37.0 37.0 30-34 36.466300000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.408500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4688 37.0 37.0 37.0 37.0 37.0 45-49 36.4602 37.0 37.0 37.0 37.0 37.0 50-54 36.41180000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.402 37.0 37.0 37.0 37.0 37.0 60-64 36.3882 37.0 37.0 37.0 37.0 37.0 65-69 36.387899999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3577 37.0 37.0 37.0 37.0 37.0 75-79 36.3425 37.0 37.0 37.0 37.0 37.0 80-84 36.337599999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2896 37.0 37.0 37.0 37.0 37.0 90-94 36.2327 37.0 37.0 37.0 37.0 37.0 95-99 36.2691 37.0 37.0 37.0 37.0 37.0 100-104 36.2439 37.0 37.0 37.0 37.0 37.0 105-109 36.15559999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1528 37.0 37.0 37.0 37.0 37.0 115-119 36.1012 37.0 37.0 37.0 37.0 37.0 120-124 36.0723 37.0 37.0 37.0 37.0 37.0 125-129 35.9956 37.0 37.0 37.0 37.0 37.0 130-134 35.951699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9608 37.0 37.0 37.0 37.0 37.0 140-144 35.839600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.83879999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.313500000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 2.0 27 7.0 28 14.0 29 19.0 30 22.0 31 43.0 32 51.0 33 79.0 34 113.0 35 312.0 36 2879.0 37 455.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.725 12.225 8.725 33.324999999999996 2 29.854854854854857 13.138138138138139 28.303303303303302 28.703703703703702 3 23.95 18.15 23.150000000000002 34.75 4 28.325 23.5 20.075000000000003 28.1 5 27.975 26.474999999999998 20.65 24.9 6 26.35 29.325000000000003 21.8 22.525000000000002 7 20.875 22.675 35.75 20.7 8 23.7 21.675 25.874999999999996 28.749999999999996 9 22.1 21.85 29.725 26.325 10-14 25.275 24.595 24.035 26.095000000000002 15-19 25.215 23.724999999999998 24.04 27.02 20-24 25.759999999999998 23.705000000000002 24.195 26.340000000000003 25-29 25.314999999999998 24.125 23.855 26.705000000000002 30-34 25.35 23.48 24.005000000000003 27.165 35-39 25.435000000000002 22.955000000000002 24.325 27.284999999999997 40-44 25.729999999999997 23.39 23.794999999999998 27.084999999999997 45-49 25.785000000000004 22.8 23.98 27.435 50-54 24.895 23.485 23.39 28.23 55-59 25.645 23.34 23.635 27.38 60-64 26.185000000000002 23.09 23.39 27.334999999999997 65-69 26.51 23.435 22.67 27.384999999999998 70-74 26.125 22.52 23.66 27.694999999999997 75-79 25.95 23.535 22.93 27.584999999999997 80-84 26.384999999999998 23.11 22.98 27.525 85-89 26.405 23.02 22.82 27.755000000000003 90-94 26.83 22.855 22.97 27.345000000000002 95-99 26.27 22.650000000000002 22.935 28.144999999999996 100-104 26.19 22.075 23.474999999999998 28.26 105-109 26.939999999999998 22.225 23.14 27.694999999999997 110-114 26.38 22.355 23.575 27.689999999999998 115-119 26.490000000000002 22.235 23.32 27.955000000000002 120-124 27.13 22.42 23.22 27.229999999999997 125-129 26.33 22.53 23.1 28.04 130-134 26.810000000000002 22.67 22.595000000000002 27.925 135-139 26.810000000000002 23.26 22.8 27.13 140-144 27.075 22.58 22.67 27.675 145-149 26.455000000000002 23.14 22.725 27.68 150-151 26.937499999999996 22.975 22.55 27.537499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.5 27 2.5 28 1.0 29 1.0 30 5.5 31 7.5 32 6.0 33 12.5 34 22.0 35 25.5 36 37.5 37 49.5 38 58.5 39 72.5 40 98.5 41 106.0 42 102.5 43 124.0 44 137.0 45 144.0 46 155.0 47 139.5 48 118.0 49 132.0 50 142.5 51 134.5 52 124.0 53 116.5 54 114.0 55 124.5 56 130.5 57 116.5 58 102.5 59 94.0 60 90.5 61 89.5 62 95.0 63 97.5 64 91.5 65 88.0 66 84.5 67 89.0 68 92.0 69 74.5 70 59.5 71 49.5 72 44.5 73 47.0 74 36.5 75 23.0 76 20.0 77 17.0 78 11.0 79 13.0 80 13.0 81 7.0 82 3.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.175 #Duplication Level Percentage of deduplicated Percentage of total 1 92.35150528885274 85.125 2 6.9433143477081645 12.8 3 0.5966910767561703 1.6500000000000001 4 0.08136696501220504 0.3 5 0.027122321670735017 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTCGTATCCATTGCTGGTGGTGGCGAGGATGTAGTAGGCGACGATGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.6500000000000004 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.5 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.2875 0.0 0.0 0.0 0.0 138-139 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATCTT 10 0.006830828 145.0 5 >>END_MODULE SRR7804079 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804079_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.374 37.0 37.0 37.0 37.0 37.0 2 36.1515 37.0 37.0 37.0 37.0 37.0 3 36.26 37.0 37.0 37.0 37.0 37.0 4 36.3085 37.0 37.0 37.0 37.0 37.0 5 36.3755 37.0 37.0 37.0 37.0 37.0 6 36.3365 37.0 37.0 37.0 37.0 37.0 7 36.3355 37.0 37.0 37.0 37.0 37.0 8 36.2975 37.0 37.0 37.0 37.0 37.0 9 36.2395 37.0 37.0 37.0 37.0 37.0 10-14 36.3501 37.0 37.0 37.0 37.0 37.0 15-19 36.28060000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.280300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.261900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.2127 37.0 37.0 37.0 37.0 37.0 35-39 36.1957 37.0 37.0 37.0 37.0 37.0 40-44 36.1475 37.0 37.0 37.0 37.0 37.0 45-49 36.117000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.088499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0632 37.0 37.0 37.0 37.0 37.0 60-64 36.0617 37.0 37.0 37.0 37.0 37.0 65-69 35.9384 37.0 37.0 37.0 37.0 37.0 70-74 35.9268 37.0 37.0 37.0 37.0 37.0 75-79 35.9605 37.0 37.0 37.0 37.0 37.0 80-84 35.9533 37.0 37.0 37.0 37.0 37.0 85-89 35.988499999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.924699999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8798 37.0 37.0 37.0 37.0 37.0 100-104 35.8804 37.0 37.0 37.0 37.0 37.0 105-109 35.8096 37.0 37.0 37.0 37.0 37.0 110-114 35.6959 37.0 37.0 37.0 37.0 37.0 115-119 35.6777 37.0 37.0 37.0 37.0 37.0 120-124 35.6609 37.0 37.0 37.0 37.0 37.0 125-129 35.5654 37.0 37.0 37.0 37.0 37.0 130-134 35.588100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.5298 37.0 37.0 37.0 37.0 37.0 140-144 35.4577 37.0 37.0 37.0 37.0 37.0 145-149 35.257799999999996 37.0 37.0 37.0 32.2 37.0 150-151 34.768 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 7.0 15 2.0 16 4.0 17 0.0 18 1.0 19 2.0 20 5.0 21 6.0 22 4.0 23 3.0 24 7.0 25 7.0 26 5.0 27 15.0 28 10.0 29 20.0 30 22.0 31 33.0 32 39.0 33 82.0 34 168.0 35 520.0 36 2781.0 37 256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.75 15.85 10.424999999999999 30.975 2 33.25 21.375 20.974999999999998 24.4 3 26.25 23.95 25.5 24.3 4 27.224999999999998 29.95 17.875 24.95 5 29.549999999999997 30.225 16.375 23.849999999999998 6 26.625 31.324999999999996 18.099999999999998 23.95 7 24.5 17.625 30.95 26.924999999999997 8 26.35 21.85 20.200000000000003 31.6 9 25.275 21.85 23.625 29.25 10-14 28.005000000000003 23.885 20.424999999999997 27.685 15-19 28.095 23.41 21.25 27.245 20-24 28.1 23.785 21.34 26.775 25-29 27.49 23.169999999999998 22.21 27.13 30-34 28.315 23.775 21.465 26.445 35-39 27.61 23.375 22.055 26.96 40-44 28.32 23.355 21.51 26.815 45-49 28.07 23.29 21.745 26.895000000000003 50-54 27.805000000000003 23.255 22.025 26.915 55-59 28.65 23.125 21.425 26.8 60-64 27.589999999999996 23.335 21.68 27.395000000000003 65-69 27.715 23.9 21.705 26.68 70-74 28.715000000000003 22.475 21.84 26.97 75-79 27.889999999999997 22.99 22.02 27.1 80-84 28.165000000000003 23.07 22.665 26.1 85-89 27.894999999999996 23.0 21.404999999999998 27.700000000000003 90-94 28.365000000000002 22.785 21.490000000000002 27.36 95-99 28.09 22.900000000000002 22.195 26.815 100-104 28.24 23.175 21.895 26.69 105-109 28.134999999999998 23.275000000000002 22.145 26.445 110-114 28.235 23.5 21.63 26.634999999999998 115-119 28.065 23.61 21.58 26.745 120-124 28.24 23.82 21.385 26.555 125-129 27.825 24.099999999999998 21.625 26.450000000000003 130-134 28.395 23.255 21.735 26.615 135-139 28.389999999999997 23.805 22.305 25.5 140-144 28.660000000000004 23.635 22.365 25.34 145-149 28.444999999999997 23.825 22.225 25.505 150-151 27.875 25.0375 22.35 24.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 1.0 29 2.5 30 3.0 31 4.0 32 7.5 33 9.5 34 10.0 35 16.5 36 23.0 37 29.5 38 42.0 39 52.5 40 63.5 41 81.0 42 99.5 43 105.0 44 114.5 45 122.0 46 120.0 47 139.0 48 153.0 49 134.5 50 115.5 51 116.0 52 108.5 53 112.0 54 129.0 55 123.5 56 105.5 57 111.0 58 115.0 59 126.0 60 127.5 61 116.5 62 116.0 63 106.0 64 92.5 65 90.5 66 97.0 67 99.5 68 103.0 69 100.5 70 82.0 71 64.5 72 60.5 73 48.0 74 41.5 75 35.5 76 31.5 77 24.0 78 17.0 79 11.5 80 6.5 81 5.5 82 2.0 83 1.5 84 1.5 85 1.0 86 0.5 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 1.0 96 0.5 97 0.0 98 0.5 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 92.10166712216451 84.25 2 6.969117245148948 12.75 3 0.7105766602896966 1.95 4 0.08198961464881116 0.3 5 0.05465974309920743 0.25 6 0.027329871549603715 0.15 7 0.05465974309920743 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCC 7 0.17500000000000002 No Hit CCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAA 6 0.15 No Hit CCCGGCCACGGCGAGGCGGTCCGTGGCGGCGCGGGCGGCGCTGGAGCCGT 5 0.125 No Hit GGATGAACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGGAAGTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.2625000000000002 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.7374999999999998 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.625 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.1625 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.8499999999999996 0.0 0.0 0.0 0.0 136-137 4.2625 0.0 0.0 0.0 0.0 138-139 4.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089901 spots for SRR7804079.sra Written 1089901 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra Read 1089889 spots for SRR7804079.sra Written 1089889 spots for SRR7804079.sra SRR ids: ['SRR7804079.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qjcnfh1y SRR7804079.sra spots: 21797792 blocks: [[1, 1089889], [1089890, 2179778], [2179779, 3269667], [3269668, 4359556], [4359557, 5449445], [5449446, 6539334], [6539335, 7629223], [7629224, 8719112], [8719113, 9809001], [9809002, 10898890], [10898891, 11988779], [11988780, 13078668], [13078669, 14168557], [14168558, 15258446], [15258447, 16348335], [16348336, 17438224], [17438225, 18528113], [18528114, 19618002], [19618003, 20707891], [20707892, 21797792]] SRR7804079 file size 7364856 SRR7804079 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804079 SRR7804079_1.fastq SRR7804079_2.fastq Input file: SRR7804079_1.fastq Paired file: SRR7804079_2.fastq trimmed: SRR7804079-trimmed-pair1.fastq, SRR7804079-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:22:55 2024 >> started Sat Dec 7 16:24:32 2024 >> done (96.352s) 21797792 read pairs processed; of these: 130 ( 0.00%) short read pairs filtered out after trimming by size control 77 ( 0.00%) empty read pairs filtered out after trimming by size control 21797585 (100.00%) read pairs available; of these: 1691771 ( 7.76%) trimmed read pairs available after processing 20105814 (92.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 13 0.00% 21 7 0.00% 22 8 0.00% 23 17 0.00% 24 13 0.00% 25 10 0.00% 26 15 0.00% 27 10 0.00% 28 15 0.00% 29 21 0.00% 30 20 0.00% 31 19 0.00% 32 14 0.00% 33 16 0.00% 34 32 0.00% 35 9 0.00% 36 15 0.00% 37 18 0.00% 38 25 0.00% 39 15 0.00% 40 26 0.00% 41 14 0.00% 42 19 0.00% 43 19 0.00% 44 23 0.00% 45 22 0.00% 46 17 0.00% 47 28 0.00% 48 18 0.00% 49 17 0.00% 50 28 0.00% 51 28 0.00% 52 30 0.00% 53 33 0.00% 54 22 0.00% 55 27 0.00% 56 38 0.00% 57 51 0.00% 58 49 0.00% 59 40 0.00% 60 37 0.00% 61 37 0.00% 62 75 0.00% 63 55 0.00% 64 65 0.00% 65 70 0.00% 66 91 0.00% 67 85 0.00% 68 127 0.00% 69 137 0.00% 70 159 0.00% 71 158 0.00% 72 211 0.00% 73 288 0.00% 74 295 0.00% 75 345 0.00% 76 412 0.00% 77 444 0.00% 78 505 0.00% 79 559 0.00% 80 707 0.00% 81 787 0.00% 82 979 0.00% 83 1187 0.01% 84 1305 0.01% 85 1559 0.01% 86 1764 0.01% 87 2007 0.01% 88 2121 0.01% 89 2518 0.01% 90 2726 0.01% 91 3102 0.01% 92 3389 0.02% 93 3872 0.02% 94 4320 0.02% 95 4718 0.02% 96 5109 0.02% 97 5674 0.03% 98 6146 0.03% 99 6720 0.03% 100 7120 0.03% 101 7761 0.04% 102 8480 0.04% 103 9201 0.04% 104 10052 0.05% 105 10493 0.05% 106 11336 0.05% 107 12171 0.06% 108 12909 0.06% 109 13400 0.06% 110 14349 0.07% 111 15220 0.07% 112 15939 0.07% 113 17340 0.08% 114 18448 0.08% 115 19488 0.09% 116 20380 0.09% 117 21032 0.10% 118 21845 0.10% 119 22744 0.10% 120 23935 0.11% 121 25113 0.12% 122 26094 0.12% 123 27530 0.13% 124 29028 0.13% 125 30199 0.14% 126 31611 0.15% 127 32697 0.15% 128 33671 0.15% 129 34362 0.16% 130 35060 0.16% 131 36880 0.17% 132 38064 0.17% 133 39551 0.18% 134 41876 0.19% 135 42978 0.20% 136 44676 0.20% 137 45355 0.21% 138 46499 0.21% 139 47533 0.22% 140 48643 0.22% 141 49658 0.23% 142 51186 0.23% 143 53517 0.25% 144 55991 0.26% 145 57443 0.26% 146 59034 0.27% 147 60758 0.28% 148 61456 0.28% 149 62384 0.29% 150 63537 0.29% 151 20105814 92.24% 21797585 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.94 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=35 fanout-score=55.74 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=3.9 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=22 prefix-density=0.76 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=138.97 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=4.1 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7804079 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:00:22 Started mapping on | Dec 07 18:00:49 Finished on | Dec 07 18:04:00 Mapping speed, Million of reads per hour | 410.84 Number of input reads | 21797585 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16927155 Uniquely mapped reads % | 77.66% Average mapped length | 290.21 Number of splices: Total | 15178581 Number of splices: Annotated (sjdb) | 14352973 Number of splices: GT/AG | 14964515 Number of splices: GC/AG | 169870 Number of splices: AT/AC | 5543 Number of splices: Non-canonical | 38653 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 653373 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 136978 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.66% % of reads unmapped: other | 3.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4217060 4217060 4217060 N_multimapping 653373 653373 653373 N_noFeature 950290 16422206 1060389 N_ambiguous 509309 2434 115394 UnstrandedReadsAssigned:15467556 PositiveStrandReadsAssigned:502515 NegativeStrandReadsAssigned:15751372 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR7804079 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804079-trimmed-pair1.fastq SRR7804079-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,797,585 reads, 17,297,844 reads pseudoaligned [quant] estimated average fragment length: 239.613 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR7804079.ke.tsv 35125 SRR7804079.se.tsv 88098 total ==> SRR7804079.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.729 3.84468e-05 3.65789e-06 PNS24247 1044 805.387 44.192 3.64247 PNS24249 1928 1689.39 196.986 7.74038 PNS24246 1044 805.387 44.192 3.64247 PNS24248 1044 805.387 44.192 3.64247 PNS24244 1471 1232.39 62.4384 3.36327 PNS24243 293 94.1475 0 0 KQK14069 1603 1364.39 6743.04 328.076 KQK14071 474 244.329 209.736 56.9843 ==> SRR7804079.se.tsv <== BRADI_1g14170v3 6507 BRADI_1g53295v3 700 BRADI_1g59795v3 326 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 105 BRADI_1g74790v3 243 BRADI_1g09890v3 0 BRADI_1g77505v3 461 BRADI_1g48960v3 0 SRR7804079 completed mapping pipeline successfully