Starting /dee2/code/volunteer_pipeline.sh SRR7804080 current disk space = 1541996187648 free memory = 1601258084 SRR7804080 SRAfilesize 1a83217532c88fca72fc5c20bf3a6404 SRR7804080.sra SRR7804080.sra file validated SRR7804080 is paired end SRR7804080 is conventional basespace SRR7804080 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804080_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.185 37.0 37.0 37.0 37.0 37.0 2 36.27775 37.0 37.0 37.0 37.0 37.0 3 36.3605 37.0 37.0 37.0 37.0 37.0 4 36.4855 37.0 37.0 37.0 37.0 37.0 5 36.4465 37.0 37.0 37.0 37.0 37.0 6 36.4075 37.0 37.0 37.0 37.0 37.0 7 36.3705 37.0 37.0 37.0 37.0 37.0 8 36.4615 37.0 37.0 37.0 37.0 37.0 9 36.4265 37.0 37.0 37.0 37.0 37.0 10-14 36.465199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.452999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4695 37.0 37.0 37.0 37.0 37.0 25-29 36.4013 37.0 37.0 37.0 37.0 37.0 30-34 36.3889 37.0 37.0 37.0 37.0 37.0 35-39 36.367999999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.42900000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3927 37.0 37.0 37.0 37.0 37.0 50-54 36.3421 37.0 37.0 37.0 37.0 37.0 55-59 36.2932 37.0 37.0 37.0 37.0 37.0 60-64 36.2861 37.0 37.0 37.0 37.0 37.0 65-69 36.2256 37.0 37.0 37.0 37.0 37.0 70-74 36.2199 37.0 37.0 37.0 37.0 37.0 75-79 36.2161 37.0 37.0 37.0 37.0 37.0 80-84 36.15990000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1475 37.0 37.0 37.0 37.0 37.0 90-94 36.1278 37.0 37.0 37.0 37.0 37.0 95-99 36.1528 37.0 37.0 37.0 37.0 37.0 100-104 36.1289 37.0 37.0 37.0 37.0 37.0 105-109 36.056599999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.0689 37.0 37.0 37.0 37.0 37.0 115-119 36.0519 37.0 37.0 37.0 37.0 37.0 120-124 35.956100000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.8599 37.0 37.0 37.0 37.0 37.0 130-134 35.8408 37.0 37.0 37.0 37.0 37.0 135-139 35.7838 37.0 37.0 37.0 37.0 37.0 140-144 35.7141 37.0 37.0 37.0 37.0 37.0 145-149 35.7183 37.0 37.0 37.0 37.0 37.0 150-151 35.125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 2.0 25 5.0 26 3.0 27 8.0 28 13.0 29 32.0 30 35.0 31 50.0 32 56.0 33 88.0 34 130.0 35 311.0 36 2815.0 37 449.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.224999999999994 13.775 8.200000000000001 33.800000000000004 2 28.40710177544386 13.978494623655912 29.107276819204802 28.507126781695426 3 22.6 15.85 25.900000000000002 35.65 4 25.324999999999996 22.35 21.975 30.349999999999998 5 26.825 24.725 23.549999999999997 24.9 6 26.075 28.475 23.075000000000003 22.375 7 19.0 24.775 36.15 20.075000000000003 8 21.2 24.125 29.049999999999997 25.624999999999996 9 21.5 21.275 32.175 25.05 10-14 23.855 25.195 24.875 26.075 15-19 23.655 25.085 24.925 26.334999999999997 20-24 24.125 24.565 24.815 26.495 25-29 24.19 24.585 24.215 27.01 30-34 23.885 25.11 24.945 26.06 35-39 23.74 24.57 24.695 26.995 40-44 24.19 24.455 24.740000000000002 26.615 45-49 24.03 24.529999999999998 24.86 26.58 50-54 23.849999999999998 24.27 24.765 27.115000000000002 55-59 24.16 24.15 24.81 26.88 60-64 24.26 23.815 24.79 27.134999999999998 65-69 24.065 24.035 24.6 27.3 70-74 24.685000000000002 23.94 24.01 27.365000000000002 75-79 24.505 24.7 23.765 27.029999999999998 80-84 24.545 24.015 24.474999999999998 26.965 85-89 25.419999999999998 23.805 24.005000000000003 26.77 90-94 24.815 24.065 24.355 26.765 95-99 24.95 23.345 24.41 27.295 100-104 24.725 23.435 24.395 27.445000000000004 105-109 24.845 23.189999999999998 24.485 27.48 110-114 25.064999999999998 24.02 24.395 26.52 115-119 25.03 23.395 24.43 27.145000000000003 120-124 25.135 23.625 24.529999999999998 26.71 125-129 25.240000000000002 23.095 24.26 27.405 130-134 25.205 23.275000000000002 24.04 27.48 135-139 25.575 23.575 24.099999999999998 26.75 140-144 25.455 23.165 24.09 27.29 145-149 25.505 23.625 23.03 27.839999999999996 150-151 24.325 23.875 24.224999999999998 27.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 2.0 26 1.5 27 1.5 28 1.5 29 3.0 30 7.5 31 9.5 32 12.5 33 14.5 34 25.5 35 36.0 36 61.5 37 75.0 38 63.0 39 66.5 40 96.0 41 121.0 42 127.5 43 142.0 44 166.5 45 172.0 46 165.5 47 175.0 48 176.0 49 153.0 50 128.5 51 121.5 52 120.5 53 123.0 54 126.0 55 123.5 56 127.5 57 129.5 58 110.0 59 98.0 60 95.5 61 82.5 62 68.0 63 63.0 64 67.0 65 67.5 66 64.5 67 62.0 68 55.0 69 46.5 70 42.0 71 46.5 72 40.0 73 23.5 74 17.0 75 17.5 76 15.5 77 11.5 78 11.0 79 7.5 80 2.5 81 2.0 82 1.5 83 0.5 84 0.5 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.8823208934895 84.325 2 7.409425224734405 13.600000000000001 3 0.6265322800326887 1.725 4 0.05448106782892945 0.2 5 0.0 0.0 6 0.027240533914464723 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0125 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0125 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.037500000000000006 0.0 0.0 0.0 0.025 84-85 0.075 0.0 0.0 0.0 0.025 86-87 0.0875 0.0 0.0 0.0 0.025 88-89 0.125 0.0 0.0 0.0 0.025 90-91 0.15 0.0 0.0 0.0 0.025 92-93 0.175 0.0 0.0 0.0 0.025 94-95 0.2625 0.0 0.0 0.0 0.025 96-97 0.325 0.0 0.0 0.0 0.025 98-99 0.3375 0.0 0.0 0.0 0.025 100-101 0.3875 0.0 0.0 0.0 0.025 102-103 0.42500000000000004 0.0 0.0 0.0 0.025 104-105 0.4875 0.0 0.0 0.0 0.025 106-107 0.5 0.0 0.0 0.0 0.025 108-109 0.575 0.0 0.0 0.0 0.025 110-111 0.75 0.0 0.0 0.0 0.025 112-113 0.8625 0.0 0.0 0.0 0.025 114-115 0.9625 0.0 0.0 0.0 0.025 116-117 1.0750000000000002 0.0 0.0 0.0 0.025 118-119 1.2875 0.0 0.0 0.0 0.025 120-121 1.3875 0.0 0.0 0.0 0.025 122-123 1.525 0.0 0.0 0.0 0.025 124-125 1.65 0.0 0.0 0.0 0.025 126-127 1.85 0.0 0.0 0.0 0.025 128-129 1.9500000000000002 0.0 0.0 0.0 0.025 130-131 2.1875 0.0 0.0 0.0 0.025 132-133 2.3875 0.0 0.0 0.0 0.025 134-135 2.6125 0.0 0.0 0.0 0.025 136-137 3.025 0.0 0.0 0.0 0.025 138-139 3.5 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGAC 10 0.006830828 145.0 5 AGCTTAA 10 0.006830828 145.0 3 GCGACGG 10 0.006830828 145.0 7 TATGTAT 10 0.006830828 145.0 3 GAGTCTC 10 0.006830828 145.0 145 CGACGGC 10 0.006830828 145.0 8 AGCGACG 10 0.006830828 145.0 6 GCTTAAA 10 0.006830828 145.0 4 >>END_MODULE SRR7804080 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804080_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.26125 37.0 37.0 37.0 37.0 37.0 2 36.085 37.0 37.0 37.0 37.0 37.0 3 35.9485 37.0 37.0 37.0 37.0 37.0 4 36.057 37.0 37.0 37.0 37.0 37.0 5 36.0395 37.0 37.0 37.0 37.0 37.0 6 36.135 37.0 37.0 37.0 37.0 37.0 7 35.9575 37.0 37.0 37.0 37.0 37.0 8 36.1965 37.0 37.0 37.0 37.0 37.0 9 35.969 37.0 37.0 37.0 37.0 37.0 10-14 36.07770000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.0256 37.0 37.0 37.0 37.0 37.0 20-24 36.038700000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.0159 37.0 37.0 37.0 37.0 37.0 30-34 35.9225 37.0 37.0 37.0 37.0 37.0 35-39 35.9081 37.0 37.0 37.0 37.0 37.0 40-44 35.8598 37.0 37.0 37.0 37.0 37.0 45-49 35.8377 37.0 37.0 37.0 37.0 37.0 50-54 35.7248 37.0 37.0 37.0 37.0 37.0 55-59 35.716899999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.724599999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.660399999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.699200000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.6943 37.0 37.0 37.0 37.0 37.0 80-84 35.6031 37.0 37.0 37.0 37.0 37.0 85-89 35.6217 37.0 37.0 37.0 37.0 37.0 90-94 35.624 37.0 37.0 37.0 37.0 37.0 95-99 35.5411 37.0 37.0 37.0 37.0 37.0 100-104 35.585 37.0 37.0 37.0 37.0 37.0 105-109 35.514 37.0 37.0 37.0 37.0 37.0 110-114 35.43169999999999 37.0 37.0 37.0 34.6 37.0 115-119 35.3698 37.0 37.0 37.0 34.6 37.0 120-124 35.3407 37.0 37.0 37.0 34.6 37.0 125-129 35.2482 37.0 37.0 37.0 29.8 37.0 130-134 35.3169 37.0 37.0 37.0 37.0 37.0 135-139 35.2008 37.0 37.0 37.0 32.2 37.0 140-144 35.0796 37.0 37.0 37.0 25.0 37.0 145-149 34.9561 37.0 37.0 37.0 25.0 37.0 150-151 34.30975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 4.0 14 7.0 15 4.0 16 6.0 17 4.0 18 6.0 19 1.0 20 7.0 21 4.0 22 9.0 23 6.0 24 7.0 25 10.0 26 10.0 27 16.0 28 15.0 29 21.0 30 37.0 31 48.0 32 60.0 33 112.0 34 213.0 35 578.0 36 2610.0 37 202.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.735183795948984 18.72968242060515 10.327581895473868 30.207551887971995 2 31.55 23.225 24.325 20.9 3 24.8 26.35 25.75 23.1 4 28.675 29.7 19.875 21.75 5 29.4 31.25 18.025 21.325 6 26.650000000000002 33.95 18.45 20.95 7 25.75 19.85 30.9 23.5 8 26.400000000000002 22.45 21.7 29.45 9 25.650000000000002 22.175 23.849999999999998 28.325 10-14 27.625 25.185000000000002 21.455 25.735000000000003 15-19 27.235 24.375 22.49 25.900000000000002 20-24 27.85 24.865000000000002 21.9 25.385 25-29 27.155 24.779999999999998 22.1 25.965 30-34 27.275 24.635 22.900000000000002 25.19 35-39 26.840000000000003 25.855 22.21 25.095 40-44 27.685 24.104999999999997 22.695 25.515 45-49 27.650000000000002 24.505 21.81 26.035000000000004 50-54 27.205000000000002 24.965 22.17 25.66 55-59 27.589999999999996 24.585 22.63 25.195 60-64 27.405 24.224999999999998 22.705000000000002 25.665 65-69 27.76 24.224999999999998 22.685 25.330000000000002 70-74 27.655 23.47 22.58 26.295 75-79 27.605 23.98 22.015 26.400000000000002 80-84 27.125 24.63 22.43 25.814999999999998 85-89 27.57 24.545 22.215 25.669999999999998 90-94 27.74 24.01 22.665 25.585 95-99 27.169999999999998 24.535 22.715 25.580000000000002 100-104 27.67 24.18 22.695 25.455 105-109 27.565 24.169999999999998 22.759999999999998 25.505 110-114 27.534999999999997 24.7 22.509999999999998 25.255 115-119 27.625 24.58 22.235 25.56 120-124 27.515 24.77 21.95 25.765 125-129 28.435 24.560000000000002 22.220000000000002 24.785 130-134 27.884999999999998 24.445 22.88 24.79 135-139 27.834999999999997 24.3 22.6 25.264999999999997 140-144 28.32 25.21 22.400000000000002 24.07 145-149 28.115000000000002 25.005 22.400000000000002 24.48 150-151 26.75 25.837500000000002 22.6375 24.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 1.0 12 0.5 13 1.0 14 2.0 15 1.5 16 1.0 17 0.5 18 0.5 19 1.5 20 1.5 21 1.0 22 0.5 23 1.5 24 2.0 25 2.0 26 2.5 27 2.5 28 3.5 29 4.5 30 5.5 31 8.5 32 12.0 33 13.0 34 14.5 35 20.0 36 24.0 37 38.0 38 48.0 39 55.5 40 81.0 41 104.5 42 111.0 43 115.0 44 139.0 45 157.5 46 154.5 47 144.5 48 150.0 49 162.5 50 156.0 51 136.0 52 120.0 53 125.0 54 134.0 55 130.5 56 114.5 57 101.0 58 112.0 59 114.5 60 96.5 61 91.0 62 85.0 63 74.0 64 76.0 65 89.5 66 89.5 67 76.5 68 74.5 69 69.5 70 60.0 71 57.5 72 48.5 73 33.0 74 30.5 75 29.5 76 19.5 77 13.0 78 10.0 79 9.0 80 7.5 81 3.5 82 2.5 83 2.5 84 1.0 85 0.0 86 0.5 87 0.5 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 2.5 97 3.0 98 1.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.88080918534719 84.025 2 7.217058501913614 13.200000000000001 3 0.683433570256971 1.875 4 0.19136139967195187 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027337342810278838 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.9874999999999999 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.5499999999999998 0.0 0.0 0.0 0.0 124-125 1.6749999999999998 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439460 spots for SRR7804080.sra Written 1439460 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra Read 1439450 spots for SRR7804080.sra Written 1439450 spots for SRR7804080.sra SRR ids: ['SRR7804080.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ut_pz8il SRR7804080.sra spots: 28789010 blocks: [[1, 1439450], [1439451, 2878900], [2878901, 4318350], [4318351, 5757800], [5757801, 7197250], [7197251, 8636700], [8636701, 10076150], [10076151, 11515600], [11515601, 12955050], [12955051, 14394500], [14394501, 15833950], [15833951, 17273400], [17273401, 18712850], [18712851, 20152300], [20152301, 21591750], [21591751, 23031200], [23031201, 24470650], [24470651, 25910100], [25910101, 27349550], [27349551, 28789010]] SRR7804080 file size 9733950 SRR7804080 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804080 SRR7804080_1.fastq SRR7804080_2.fastq Input file: SRR7804080_1.fastq Paired file: SRR7804080_2.fastq trimmed: SRR7804080-trimmed-pair1.fastq, SRR7804080-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:14:58 2024 >> started Sat Dec 7 16:15:29 2024 >> done (30.655s) 28789010 read pairs processed; of these: 186 ( 0.00%) short read pairs filtered out after trimming by size control 1027 ( 0.00%) empty read pairs filtered out after trimming by size control 28787797 (100.00%) read pairs available; of these: 1490791 ( 5.18%) trimmed read pairs available after processing 27297006 (94.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 19 0.00% 20 23 0.00% 21 14 0.00% 22 20 0.00% 23 20 0.00% 24 22 0.00% 25 12 0.00% 26 15 0.00% 27 27 0.00% 28 23 0.00% 29 24 0.00% 30 22 0.00% 31 34 0.00% 32 21 0.00% 33 20 0.00% 34 23 0.00% 35 22 0.00% 36 25 0.00% 37 38 0.00% 38 34 0.00% 39 43 0.00% 40 30 0.00% 41 25 0.00% 42 24 0.00% 43 43 0.00% 44 40 0.00% 45 51 0.00% 46 36 0.00% 47 43 0.00% 48 41 0.00% 49 46 0.00% 50 45 0.00% 51 54 0.00% 52 47 0.00% 53 71 0.00% 54 67 0.00% 55 60 0.00% 56 71 0.00% 57 81 0.00% 58 93 0.00% 59 75 0.00% 60 103 0.00% 61 93 0.00% 62 104 0.00% 63 89 0.00% 64 132 0.00% 65 107 0.00% 66 157 0.00% 67 160 0.00% 68 167 0.00% 69 165 0.00% 70 219 0.00% 71 217 0.00% 72 250 0.00% 73 288 0.00% 74 322 0.00% 75 395 0.00% 76 391 0.00% 77 439 0.00% 78 500 0.00% 79 573 0.00% 80 689 0.00% 81 780 0.00% 82 841 0.00% 83 1039 0.00% 84 1104 0.00% 85 1335 0.00% 86 1361 0.00% 87 1571 0.01% 88 1722 0.01% 89 1937 0.01% 90 2163 0.01% 91 2441 0.01% 92 2804 0.01% 93 3055 0.01% 94 3477 0.01% 95 3681 0.01% 96 4096 0.01% 97 4475 0.02% 98 4862 0.02% 99 5271 0.02% 100 5647 0.02% 101 6136 0.02% 102 6685 0.02% 103 7394 0.03% 104 8034 0.03% 105 8548 0.03% 106 9149 0.03% 107 9789 0.03% 108 10256 0.04% 109 11333 0.04% 110 11602 0.04% 111 12331 0.04% 112 13193 0.05% 113 14531 0.05% 114 15112 0.05% 115 16444 0.06% 116 17174 0.06% 117 17703 0.06% 118 18546 0.06% 119 19118 0.07% 120 20010 0.07% 121 20457 0.07% 122 22300 0.08% 123 23403 0.08% 124 24545 0.09% 125 26133 0.09% 126 27372 0.10% 127 28409 0.10% 128 29253 0.10% 129 29897 0.10% 130 31218 0.11% 131 32017 0.11% 132 33784 0.12% 133 35267 0.12% 134 36974 0.13% 135 38207 0.13% 136 39666 0.14% 137 40578 0.14% 138 41909 0.15% 139 42932 0.15% 140 44135 0.15% 141 44887 0.16% 142 47189 0.16% 143 48799 0.17% 144 50628 0.18% 145 52934 0.18% 146 53913 0.19% 147 55365 0.19% 148 57163 0.20% 149 57808 0.20% 150 59777 0.21% 151 27297006 94.82% 28787797 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=34 prefix-density=0.68 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=58.94 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.9 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=13 prefix-density=0.95 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=15.30 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.0 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804080 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:16:12 Started mapping on | Dec 07 16:16:12 Finished on | Dec 07 16:22:01 Mapping speed, Million of reads per hour | 296.95 Number of input reads | 28787797 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 24772855 Uniquely mapped reads % | 86.05% Average mapped length | 298.84 Number of splices: Total | 24909255 Number of splices: Annotated (sjdb) | 23568922 Number of splices: GT/AG | 24532818 Number of splices: GC/AG | 311980 Number of splices: AT/AC | 9391 Number of splices: Non-canonical | 55066 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1137729 % of reads mapped to multiple loci | 3.95% Number of reads mapped to too many loci | 141196 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.85% % of reads unmapped: other | 3.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2877213 2877213 2877213 N_multimapping 1137729 1137729 1137729 N_noFeature 1549226 24024768 1717845 N_ambiguous 733684 4105 155667 UnstrandedReadsAssigned:22489945 PositiveStrandReadsAssigned:743982 NegativeStrandReadsAssigned:22899343 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804080 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804080-trimmed-pair1.fastq SRR7804080-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,787,797 reads, 23,469,312 reads pseudoaligned [quant] estimated average fragment length: 282.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52973 SRR7804080.ke.tsv 35125 SRR7804080.se.tsv 88098 total ==> SRR7804080.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.779 0 0 PNS24247 1044 762.255 65.4202 4.27153 PNS24249 1928 1646.25 193.571 5.85212 PNS24246 1044 762.255 65.4202 4.27153 PNS24248 1044 762.255 65.4202 4.27153 PNS24244 1471 1189.25 103.169 4.31762 PNS24243 293 82.1384 0 0 KQK14069 1603 1321.25 3446.68 129.833 KQK14071 474 214.024 34.8095 8.0948 ==> SRR7804080.se.tsv <== BRADI_1g14170v3 3576 BRADI_1g53295v3 820 BRADI_1g59795v3 288 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 259 BRADI_1g74790v3 461 BRADI_1g09890v3 0 BRADI_1g77505v3 687 BRADI_1g48960v3 0 SRR7804080 completed mapping pipeline successfully