Starting /dee2/code/volunteer_pipeline.sh SRR7804081 current disk space = 1541886353408 free memory = 1414390852 SRR7804081 SRAfilesize 9a1bbea80d8a6aca2af0fca02874b31f SRR7804081.sra SRR7804081.sra file validated SRR7804081 is paired end SRR7804081 is conventional basespace SRR7804081 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804081_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.182 37.0 37.0 37.0 37.0 37.0 2 36.25575 37.0 37.0 37.0 37.0 37.0 3 36.428 37.0 37.0 37.0 37.0 37.0 4 36.4015 37.0 37.0 37.0 37.0 37.0 5 36.517 37.0 37.0 37.0 37.0 37.0 6 36.528 37.0 37.0 37.0 37.0 37.0 7 36.428 37.0 37.0 37.0 37.0 37.0 8 36.3805 37.0 37.0 37.0 37.0 37.0 9 36.4255 37.0 37.0 37.0 37.0 37.0 10-14 36.4488 37.0 37.0 37.0 37.0 37.0 15-19 36.4486 37.0 37.0 37.0 37.0 37.0 20-24 36.4567 37.0 37.0 37.0 37.0 37.0 25-29 36.402300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.3769 37.0 37.0 37.0 37.0 37.0 35-39 36.352199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.339 37.0 37.0 37.0 37.0 37.0 45-49 36.3306 37.0 37.0 37.0 37.0 37.0 50-54 36.304899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.293400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3217 37.0 37.0 37.0 37.0 37.0 65-69 36.26709999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2183 37.0 37.0 37.0 37.0 37.0 75-79 36.21320000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.16330000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1577 37.0 37.0 37.0 37.0 37.0 90-94 36.1282 37.0 37.0 37.0 37.0 37.0 95-99 36.1608 37.0 37.0 37.0 37.0 37.0 100-104 36.1426 37.0 37.0 37.0 37.0 37.0 105-109 36.013999999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.0184 37.0 37.0 37.0 37.0 37.0 115-119 35.988800000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.931 37.0 37.0 37.0 37.0 37.0 125-129 35.8501 37.0 37.0 37.0 37.0 37.0 130-134 35.796200000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.767199999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.6945 37.0 37.0 37.0 37.0 37.0 145-149 35.6874 37.0 37.0 37.0 37.0 37.0 150-151 35.272999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 5.0 27 8.0 28 19.0 29 25.0 30 33.0 31 41.0 32 55.0 33 95.0 34 154.0 35 344.0 36 2906.0 37 312.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.625 11.825 8.649999999999999 34.9 2 25.93241551939925 13.591989987484354 32.390488110137674 28.085106382978726 3 22.900000000000002 19.575 25.775 31.75 4 26.400000000000002 26.325 21.475 25.8 5 26.55 31.574999999999996 21.575 20.3 6 23.150000000000002 30.975 23.200000000000003 22.675 7 17.125 23.400000000000002 40.025 19.45 8 20.9 23.525 28.4 27.175 9 20.974999999999998 21.9 31.474999999999998 25.650000000000002 10-14 23.64 26.119999999999997 25.355 24.884999999999998 15-19 22.745 25.82 25.985000000000003 25.45 20-24 22.465 26.545 25.16 25.83 25-29 23.73 25.069999999999997 25.455 25.745 30-34 22.89 25.945 25.215 25.95 35-39 23.375 25.195 25.624999999999996 25.805 40-44 23.04 25.19 25.72 26.05 45-49 23.86 25.180000000000003 25.21 25.75 50-54 23.335 25.669999999999998 25.009999999999998 25.985000000000003 55-59 23.185 24.985 24.9 26.93 60-64 23.555 25.335 25.455 25.655 65-69 23.755000000000003 25.31 24.935 26.0 70-74 23.625 25.715 24.060000000000002 26.6 75-79 23.465 24.7 25.419999999999998 26.415 80-84 23.265 25.335 25.55 25.85 85-89 23.365 25.435000000000002 24.985 26.215 90-94 23.935000000000002 25.590000000000003 24.884999999999998 25.590000000000003 95-99 23.189999999999998 25.245 25.44 26.125 100-104 23.845 25.424999999999997 24.65 26.08 105-109 24.14 24.665 25.03 26.165 110-114 23.46 24.745 25.835 25.96 115-119 24.07 25.555 24.63 25.745 120-124 24.02 24.65 24.925 26.405 125-129 24.224999999999998 25.06 24.95 25.765 130-134 24.41 24.9 24.990000000000002 25.7 135-139 24.7 25.055 24.595 25.650000000000002 140-144 24.51 24.245 25.575 25.669999999999998 145-149 24.245 24.995 24.675 26.085 150-151 24.4875 24.962500000000002 24.5625 25.9875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.0 27 2.5 28 2.0 29 4.0 30 6.5 31 9.0 32 16.0 33 22.5 34 31.0 35 40.0 36 47.0 37 69.5 38 97.0 39 105.0 40 120.5 41 147.5 42 157.5 43 169.0 44 198.5 45 212.5 46 201.0 47 198.0 48 184.0 49 172.0 50 169.0 51 146.0 52 127.0 53 113.0 54 109.0 55 90.0 56 82.5 57 85.0 58 78.0 59 83.0 60 76.0 61 54.5 62 45.0 63 57.0 64 59.5 65 54.0 66 51.0 67 50.0 68 43.5 69 36.5 70 37.0 71 28.5 72 20.0 73 23.0 74 20.0 75 16.5 76 13.0 77 6.0 78 2.5 79 2.5 80 2.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.88844408860422 87.94999999999999 2 5.497731518548172 10.299999999999999 3 0.5871363757672805 1.6500000000000001 4 0.02668801708033093 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.1375 0.0 0.0 0.0 0.0 134-135 1.2625000000000002 0.0 0.0 0.0 0.0 136-137 1.475 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAGC 10 0.006830828 145.0 6 GTCACGC 10 0.006830828 145.0 2 GGTCACG 10 0.006830828 145.0 1 TTGAGCA 10 0.006830828 145.0 7 >>END_MODULE SRR7804081 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804081_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.207 37.0 37.0 37.0 37.0 37.0 2 36.0625 37.0 37.0 37.0 37.0 37.0 3 36.024 37.0 37.0 37.0 37.0 37.0 4 36.228 37.0 37.0 37.0 37.0 37.0 5 36.175 37.0 37.0 37.0 37.0 37.0 6 36.2795 37.0 37.0 37.0 37.0 37.0 7 36.008 37.0 37.0 37.0 37.0 37.0 8 36.291 37.0 37.0 37.0 37.0 37.0 9 36.1245 37.0 37.0 37.0 37.0 37.0 10-14 36.193599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.072500000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.0889 37.0 37.0 37.0 37.0 37.0 25-29 36.0468 37.0 37.0 37.0 37.0 37.0 30-34 36.070800000000006 37.0 37.0 37.0 37.0 37.0 35-39 35.9473 37.0 37.0 37.0 37.0 37.0 40-44 35.9622 37.0 37.0 37.0 37.0 37.0 45-49 35.939 37.0 37.0 37.0 37.0 37.0 50-54 35.8288 37.0 37.0 37.0 37.0 37.0 55-59 35.8497 37.0 37.0 37.0 37.0 37.0 60-64 35.9313 37.0 37.0 37.0 37.0 37.0 65-69 35.8269 37.0 37.0 37.0 37.0 37.0 70-74 35.807900000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.7427 37.0 37.0 37.0 37.0 37.0 80-84 35.6827 37.0 37.0 37.0 37.0 37.0 85-89 35.7907 37.0 37.0 37.0 37.0 37.0 90-94 35.7239 37.0 37.0 37.0 37.0 37.0 95-99 35.658 37.0 37.0 37.0 37.0 37.0 100-104 35.664500000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.58919999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.444599999999994 37.0 37.0 37.0 34.6 37.0 115-119 35.49550000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.4426 37.0 37.0 37.0 37.0 37.0 125-129 35.3954 37.0 37.0 37.0 37.0 37.0 130-134 35.4456 37.0 37.0 37.0 37.0 37.0 135-139 35.2526 37.0 37.0 37.0 32.2 37.0 140-144 35.2813 37.0 37.0 37.0 32.2 37.0 145-149 35.0218 37.0 37.0 37.0 25.0 37.0 150-151 34.7535 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 2.0 16 3.0 17 1.0 18 5.0 19 1.0 20 5.0 21 5.0 22 5.0 23 3.0 24 6.0 25 4.0 26 7.0 27 9.0 28 22.0 29 31.0 30 38.0 31 63.0 32 69.0 33 104.0 34 214.0 35 574.0 36 2621.0 37 202.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.400000000000006 17.474999999999998 11.5 30.625000000000004 2 31.374999999999996 21.875 25.874999999999996 20.875 3 24.175 24.775 27.05 24.0 4 26.450000000000003 31.3 19.925 22.325 5 28.000000000000004 32.925 17.349999999999998 21.725 6 25.2 34.625 19.900000000000002 20.275000000000002 7 22.2 19.35 34.825 23.625 8 25.724999999999998 21.425 23.400000000000002 29.45 9 24.025 20.925 26.775 28.275 10-14 26.02 25.495 23.395 25.09 15-19 26.235000000000003 24.995 23.845 24.925 20-24 26.26 24.82 24.2 24.72 25-29 25.324999999999996 25.695 24.11 24.87 30-34 25.465 24.625 24.33 25.580000000000002 35-39 25.430000000000003 24.83 24.215 25.525 40-44 25.775 25.240000000000002 24.175 24.81 45-49 26.029999999999998 24.795 24.015 25.16 50-54 26.355 25.95 23.46 24.235 55-59 26.195 24.91 23.875 25.019999999999996 60-64 26.395000000000003 24.875 24.055 24.675 65-69 25.874999999999996 24.555 24.365000000000002 25.205 70-74 26.179999999999996 25.005 23.87 24.945 75-79 26.119999999999997 25.06 23.955000000000002 24.865000000000002 80-84 26.284999999999997 25.335 23.974999999999998 24.404999999999998 85-89 26.665 25.22 23.745 24.37 90-94 26.07 25.19 24.485 24.255 95-99 26.33 24.775 24.224999999999998 24.67 100-104 25.695 25.490000000000002 24.115000000000002 24.7 105-109 26.61 25.174999999999997 23.745 24.47 110-114 25.66 25.4 24.375 24.565 115-119 26.484999999999996 25.09 24.349999999999998 24.075 120-124 26.08 25.590000000000003 23.87 24.46 125-129 26.155 25.21 23.995 24.64 130-134 26.05 25.485000000000003 24.05 24.415 135-139 26.38 25.564999999999998 24.215 23.84 140-144 26.384999999999998 25.61 23.674999999999997 24.33 145-149 26.224999999999998 25.0 24.87 23.905 150-151 26.650000000000002 25.6 23.95 23.799999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 1.5 26 1.5 27 2.5 28 3.5 29 6.0 30 10.0 31 8.5 32 11.5 33 19.5 34 28.5 35 38.5 36 43.5 37 58.5 38 73.0 39 86.5 40 106.0 41 130.0 42 147.0 43 155.5 44 176.0 45 190.5 46 187.5 47 169.5 48 168.5 49 155.0 50 135.5 51 135.0 52 124.5 53 116.5 54 109.5 55 98.5 56 86.0 57 78.0 58 81.5 59 87.0 60 79.0 61 76.5 62 82.0 63 77.0 64 60.5 65 59.0 66 67.5 67 65.5 68 69.0 69 70.0 70 62.5 71 44.5 72 30.0 73 28.0 74 22.5 75 17.5 76 14.0 77 10.5 78 7.0 79 3.5 80 2.0 81 1.5 82 0.0 83 0.0 84 2.0 85 2.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.16932907348243 88.425 2 5.271565495207668 9.9 3 0.4792332268370607 1.35 4 0.05324813631522897 0.2 5 0.026624068157614485 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.8999999999999999 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.2875 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138-139 1.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685872 spots for SRR7804081.sra Written 1685872 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra Read 1685866 spots for SRR7804081.sra Written 1685866 spots for SRR7804081.sra SRR ids: ['SRR7804081.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1rq8283l SRR7804081.sra spots: 33717326 blocks: [[1, 1685866], [1685867, 3371732], [3371733, 5057598], [5057599, 6743464], [6743465, 8429330], [8429331, 10115196], [10115197, 11801062], [11801063, 13486928], [13486929, 15172794], [15172795, 16858660], [16858661, 18544526], [18544527, 20230392], [20230393, 21916258], [21916259, 23602124], [23602125, 25287990], [25287991, 26973856], [26973857, 28659722], [28659723, 30345588], [30345589, 32031454], [32031455, 33717326]] SRR7804081 file size 11403995 SRR7804081 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804081 SRR7804081_1.fastq SRR7804081_2.fastq Input file: SRR7804081_1.fastq Paired file: SRR7804081_2.fastq trimmed: SRR7804081-trimmed-pair1.fastq, SRR7804081-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:19:31 2024 >> started Sat Dec 7 16:20:16 2024 >> done (45.082s) 33717326 read pairs processed; of these: 130 ( 0.00%) short read pairs filtered out after trimming by size control 5021 ( 0.01%) empty read pairs filtered out after trimming by size control 33712175 (99.98%) read pairs available; of these: 694976 ( 2.06%) trimmed read pairs available after processing 33017199 (97.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 14 0.00% 20 11 0.00% 21 15 0.00% 22 22 0.00% 23 24 0.00% 24 21 0.00% 25 22 0.00% 26 28 0.00% 27 21 0.00% 28 31 0.00% 29 43 0.00% 30 30 0.00% 31 33 0.00% 32 48 0.00% 33 30 0.00% 34 27 0.00% 35 45 0.00% 36 30 0.00% 37 35 0.00% 38 52 0.00% 39 45 0.00% 40 48 0.00% 41 41 0.00% 42 50 0.00% 43 37 0.00% 44 51 0.00% 45 47 0.00% 46 54 0.00% 47 61 0.00% 48 40 0.00% 49 53 0.00% 50 67 0.00% 51 51 0.00% 52 69 0.00% 53 74 0.00% 54 50 0.00% 55 64 0.00% 56 64 0.00% 57 75 0.00% 58 73 0.00% 59 70 0.00% 60 92 0.00% 61 76 0.00% 62 105 0.00% 63 100 0.00% 64 93 0.00% 65 92 0.00% 66 129 0.00% 67 91 0.00% 68 112 0.00% 69 143 0.00% 70 132 0.00% 71 147 0.00% 72 138 0.00% 73 178 0.00% 74 208 0.00% 75 189 0.00% 76 230 0.00% 77 230 0.00% 78 276 0.00% 79 288 0.00% 80 365 0.00% 81 368 0.00% 82 402 0.00% 83 491 0.00% 84 509 0.00% 85 602 0.00% 86 602 0.00% 87 673 0.00% 88 748 0.00% 89 816 0.00% 90 931 0.00% 91 1032 0.00% 92 1219 0.00% 93 1259 0.00% 94 1381 0.00% 95 1613 0.00% 96 1630 0.00% 97 1840 0.01% 98 1938 0.01% 99 2131 0.01% 100 2227 0.01% 101 2527 0.01% 102 2880 0.01% 103 3122 0.01% 104 3263 0.01% 105 3553 0.01% 106 3911 0.01% 107 3998 0.01% 108 4260 0.01% 109 4600 0.01% 110 4905 0.01% 111 5118 0.02% 112 5618 0.02% 113 5901 0.02% 114 6404 0.02% 115 6811 0.02% 116 7255 0.02% 117 7508 0.02% 118 7704 0.02% 119 8143 0.02% 120 8629 0.03% 121 9046 0.03% 122 9725 0.03% 123 10359 0.03% 124 10981 0.03% 125 11433 0.03% 126 12074 0.04% 127 12463 0.04% 128 12809 0.04% 129 13560 0.04% 130 13793 0.04% 131 14598 0.04% 132 15486 0.05% 133 16063 0.05% 134 16884 0.05% 135 17559 0.05% 136 18484 0.05% 137 19022 0.06% 138 19660 0.06% 139 20236 0.06% 140 21042 0.06% 141 21790 0.06% 142 22737 0.07% 143 23725 0.07% 144 25260 0.07% 145 26621 0.08% 146 27646 0.08% 147 28636 0.08% 148 29077 0.09% 149 29526 0.09% 150 30974 0.09% 151 33017199 97.94% 33712175 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=31 prefix-density=0.34 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=202.29 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=13.5 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTGGTA criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=159.76 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=22.9 sequence=CGCCGCCGCCGTCG SRR7804081 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:21:41 Started mapping on | Dec 07 16:21:41 Finished on | Dec 07 16:26:04 Mapping speed, Million of reads per hour | 461.46 Number of input reads | 33712175 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 31355935 Uniquely mapped reads % | 93.01% Average mapped length | 299.95 Number of splices: Total | 33846264 Number of splices: Annotated (sjdb) | 31863382 Number of splices: GT/AG | 33337539 Number of splices: GC/AG | 409897 Number of splices: AT/AC | 15174 Number of splices: Non-canonical | 83654 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379125 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 30110 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.12% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1977115 1977115 1977115 N_multimapping 379125 379125 379125 N_noFeature 1285543 30425995 1525915 N_ambiguous 824001 6493 134345 UnstrandedReadsAssigned:29246391 PositiveStrandReadsAssigned:923447 NegativeStrandReadsAssigned:29695675 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804081 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804081-trimmed-pair1.fastq SRR7804081-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,712,175 reads, 29,924,128 reads pseudoaligned [quant] estimated average fragment length: 323.275 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52973 SRR7804081.ke.tsv 35125 SRR7804081.se.tsv 88098 total ==> SRR7804081.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 614.589 0 0 PNS24247 1044 721.725 98.9605 6.41032 PNS24249 1928 1605.73 171.548 4.99465 PNS24246 1044 721.725 98.9605 6.41032 PNS24248 1044 721.725 98.9605 6.41032 PNS24244 1471 1148.73 212.57 8.65119 PNS24243 293 69.6837 0 0 KQK14069 1603 1280.73 6935.79 253.18 KQK14071 474 190.597 213.427 52.3507 ==> SRR7804081.se.tsv <== BRADI_1g14170v3 8334 BRADI_1g53295v3 856 BRADI_1g59795v3 475 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 2451 BRADI_1g74790v3 731 BRADI_1g09890v3 12 BRADI_1g77505v3 550 BRADI_1g48960v3 0 SRR7804081 completed mapping pipeline successfully