Starting /dee2/code/volunteer_pipeline.sh SRR7804082 current disk space = 1541969338368 free memory = 1414692336 SRR7804082 SRAfilesize e95c8a07831df664af1954621001f696 SRR7804082.sra SRR7804082.sra file validated SRR7804082 is paired end SRR7804082 is conventional basespace SRR7804082 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804082_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.413 37.0 37.0 37.0 37.0 37.0 2 36.298 37.0 37.0 37.0 37.0 37.0 3 36.483 37.0 37.0 37.0 37.0 37.0 4 36.6115 37.0 37.0 37.0 37.0 37.0 5 36.506 37.0 37.0 37.0 37.0 37.0 6 36.5525 37.0 37.0 37.0 37.0 37.0 7 36.499 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.533 37.0 37.0 37.0 37.0 37.0 10-14 36.5597 37.0 37.0 37.0 37.0 37.0 15-19 36.5154 37.0 37.0 37.0 37.0 37.0 20-24 36.556799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5474 37.0 37.0 37.0 37.0 37.0 30-34 36.4474 37.0 37.0 37.0 37.0 37.0 35-39 36.4722 37.0 37.0 37.0 37.0 37.0 40-44 36.4587 37.0 37.0 37.0 37.0 37.0 45-49 36.462199999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4139 37.0 37.0 37.0 37.0 37.0 55-59 36.39209999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.3697 37.0 37.0 37.0 37.0 37.0 65-69 36.3705 37.0 37.0 37.0 37.0 37.0 70-74 36.336299999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.3254 37.0 37.0 37.0 37.0 37.0 80-84 36.3004 37.0 37.0 37.0 37.0 37.0 85-89 36.3425 37.0 37.0 37.0 37.0 37.0 90-94 36.1856 37.0 37.0 37.0 37.0 37.0 95-99 36.2217 37.0 37.0 37.0 37.0 37.0 100-104 36.201499999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1019 37.0 37.0 37.0 37.0 37.0 110-114 36.1043 37.0 37.0 37.0 37.0 37.0 115-119 36.0943 37.0 37.0 37.0 37.0 37.0 120-124 36.0758 37.0 37.0 37.0 37.0 37.0 125-129 36.0054 37.0 37.0 37.0 37.0 37.0 130-134 35.9795 37.0 37.0 37.0 37.0 37.0 135-139 35.900099999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.945100000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.836 37.0 37.0 37.0 37.0 37.0 150-151 35.373000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 3.0 25 3.0 26 4.0 27 12.0 28 16.0 29 21.0 30 19.0 31 37.0 32 45.0 33 70.0 34 127.0 35 291.0 36 2830.0 37 520.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.775 11.75 8.55 36.925000000000004 2 27.775 14.825 30.175 27.224999999999998 3 23.75 19.1 23.1 34.050000000000004 4 27.275 24.875 19.5 28.349999999999998 5 27.575 27.625 21.575 23.225 6 26.450000000000003 29.275000000000002 20.125 24.15 7 19.325 23.7 36.199999999999996 20.775 8 22.75 21.55 26.200000000000003 29.5 9 21.525 20.849999999999998 30.599999999999998 27.025 10-14 25.130000000000003 24.11 23.755000000000003 27.005000000000003 15-19 25.46 23.105 24.185000000000002 27.250000000000004 20-24 25.71 24.02 23.095 27.175 25-29 25.319999999999997 24.240000000000002 23.635 26.805 30-34 25.595000000000002 23.32 24.279999999999998 26.805 35-39 25.935000000000002 23.02 23.97 27.075 40-44 25.8 23.669999999999998 23.9 26.63 45-49 25.34 23.025000000000002 23.915 27.72 50-54 25.955000000000002 23.84 23.25 26.955000000000002 55-59 25.985000000000003 24.015 22.775000000000002 27.224999999999998 60-64 25.545 23.685000000000002 23.965 26.805 65-69 25.874999999999996 22.725 24.099999999999998 27.3 70-74 25.72 23.785 23.294999999999998 27.200000000000003 75-79 26.235000000000003 22.725 23.45 27.589999999999996 80-84 26.215 23.294999999999998 23.115 27.375 85-89 26.685 23.26 22.695 27.36 90-94 26.200000000000003 23.544999999999998 22.919999999999998 27.334999999999997 95-99 26.640000000000004 23.665 22.86 26.834999999999997 100-104 27.365000000000002 23.03 22.825 26.779999999999998 105-109 26.66 23.150000000000002 22.545 27.644999999999996 110-114 26.47 22.445 24.01 27.075 115-119 26.625 22.915 22.685 27.775 120-124 26.545 22.689999999999998 23.35 27.415 125-129 26.525 22.73 23.325000000000003 27.42 130-134 26.495 23.05 22.805 27.650000000000002 135-139 26.275 23.474999999999998 22.795 27.455000000000002 140-144 26.155 23.205000000000002 22.939999999999998 27.700000000000003 145-149 27.185 23.51 22.615 26.69 150-151 27.55 23.0875 22.625 26.737499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 0.5 28 2.0 29 2.5 30 4.5 31 6.5 32 8.0 33 15.0 34 21.0 35 21.0 36 26.5 37 38.0 38 47.0 39 60.5 40 81.0 41 111.0 42 129.0 43 133.5 44 147.0 45 150.0 46 159.5 47 156.0 48 152.0 49 157.0 50 139.5 51 131.5 52 129.0 53 120.0 54 110.5 55 110.5 56 110.0 57 97.0 58 91.5 59 91.0 60 98.0 61 94.5 62 105.0 63 110.0 64 98.0 65 97.0 66 81.5 67 87.5 68 91.5 69 71.5 70 52.0 71 46.5 72 47.0 73 43.5 74 34.5 75 26.0 76 17.0 77 10.5 78 10.0 79 6.5 80 3.5 81 2.0 82 2.5 83 1.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.34853062345509 83.15 2 7.607800054929964 13.850000000000001 3 0.8788794287283713 2.4 4 0.16478989288656962 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.5374999999999996 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 2.975 0.0 0.0 0.0 0.0 128-129 3.325 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 5.05 0.0 0.0 0.0 0.0 138-139 5.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACCTT 10 0.006830828 145.0 2 GCCGATC 10 0.006830828 145.0 4 >>END_MODULE SRR7804082 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804082_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.495 37.0 37.0 37.0 37.0 37.0 2 36.277 37.0 37.0 37.0 37.0 37.0 3 36.4125 37.0 37.0 37.0 37.0 37.0 4 36.428 37.0 37.0 37.0 37.0 37.0 5 36.435 37.0 37.0 37.0 37.0 37.0 6 36.431 37.0 37.0 37.0 37.0 37.0 7 36.335 37.0 37.0 37.0 37.0 37.0 8 36.4435 37.0 37.0 37.0 37.0 37.0 9 36.3975 37.0 37.0 37.0 37.0 37.0 10-14 36.4735 37.0 37.0 37.0 37.0 37.0 15-19 36.431799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4208 37.0 37.0 37.0 37.0 37.0 25-29 36.4089 37.0 37.0 37.0 37.0 37.0 30-34 36.3611 37.0 37.0 37.0 37.0 37.0 35-39 36.3566 37.0 37.0 37.0 37.0 37.0 40-44 36.3383 37.0 37.0 37.0 37.0 37.0 45-49 36.3002 37.0 37.0 37.0 37.0 37.0 50-54 36.2589 37.0 37.0 37.0 37.0 37.0 55-59 36.2306 37.0 37.0 37.0 37.0 37.0 60-64 36.22090000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2645 37.0 37.0 37.0 37.0 37.0 70-74 36.2109 37.0 37.0 37.0 37.0 37.0 75-79 36.1858 37.0 37.0 37.0 37.0 37.0 80-84 36.0788 37.0 37.0 37.0 37.0 37.0 85-89 36.107 37.0 37.0 37.0 37.0 37.0 90-94 36.117 37.0 37.0 37.0 37.0 37.0 95-99 36.132999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1031 37.0 37.0 37.0 37.0 37.0 105-109 35.9923 37.0 37.0 37.0 37.0 37.0 110-114 35.8774 37.0 37.0 37.0 37.0 37.0 115-119 35.8734 37.0 37.0 37.0 37.0 37.0 120-124 35.8444 37.0 37.0 37.0 37.0 37.0 125-129 35.768299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.7977 37.0 37.0 37.0 37.0 37.0 135-139 35.6656 37.0 37.0 37.0 37.0 37.0 140-144 35.6352 37.0 37.0 37.0 37.0 37.0 145-149 35.4009 37.0 37.0 37.0 37.0 37.0 150-151 34.98025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 4.0 22 3.0 23 6.0 24 2.0 25 4.0 26 8.0 27 8.0 28 13.0 29 21.0 30 25.0 31 31.0 32 38.0 33 77.0 34 151.0 35 398.0 36 2820.0 37 384.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.188188188188185 18.943943943943946 10.135135135135135 32.732732732732735 2 33.050000000000004 20.075000000000003 23.474999999999998 23.400000000000002 3 24.5 24.275 25.724999999999998 25.5 4 26.174999999999997 30.0 19.225 24.6 5 28.1 29.799999999999997 18.35 23.75 6 26.474999999999998 31.874999999999996 17.325 24.325 7 23.575 18.85 31.525 26.05 8 23.849999999999998 21.95 21.75 32.45 9 24.425 21.475 25.974999999999998 28.125 10-14 26.815 23.785 21.335 28.065 15-19 26.87 24.08 21.595 27.455000000000002 20-24 26.965 23.73 22.025 27.279999999999998 25-29 26.85 23.455000000000002 21.845 27.85 30-34 27.18 22.795 22.095000000000002 27.93 35-39 27.1 23.75 22.07 27.08 40-44 27.22 23.765 21.83 27.185 45-49 27.1 23.53 21.945 27.425 50-54 27.229999999999997 23.3 22.16 27.310000000000002 55-59 28.050000000000004 23.115 21.834999999999997 27.0 60-64 27.255000000000003 23.29 22.615 26.840000000000003 65-69 26.88 23.294999999999998 22.185 27.639999999999997 70-74 27.18 23.225 22.115000000000002 27.48 75-79 27.32 23.195 22.17 27.315 80-84 27.415 23.07 22.38 27.134999999999998 85-89 27.005000000000003 23.02 22.919999999999998 27.055 90-94 27.955000000000002 22.99 22.515 26.540000000000003 95-99 26.919999999999998 23.599999999999998 22.505 26.974999999999998 100-104 27.525 23.630000000000003 22.155 26.69 105-109 27.18 22.865 22.955000000000002 27.0 110-114 27.755000000000003 23.335 22.125 26.784999999999997 115-119 27.395000000000003 23.98 21.740000000000002 26.884999999999998 120-124 27.73 23.835 22.12 26.314999999999998 125-129 28.08 23.325000000000003 22.045 26.55 130-134 28.515 23.395 22.2 25.89 135-139 27.834999999999997 24.32 22.35 25.495 140-144 28.7 24.25 22.225 24.825 145-149 28.775000000000002 24.365000000000002 22.145 24.715 150-151 28.625 24.9375 21.8 24.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 2.5 17 2.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 1.0 29 3.0 30 5.0 31 5.0 32 6.0 33 7.5 34 8.5 35 13.5 36 21.0 37 28.0 38 40.5 39 60.5 40 69.5 41 84.0 42 102.0 43 116.5 44 129.5 45 141.0 46 135.5 47 135.5 48 145.5 49 133.0 50 127.0 51 120.0 52 114.0 53 115.0 54 117.5 55 121.0 56 114.5 57 109.5 58 122.0 59 126.5 60 120.0 61 120.0 62 117.0 63 112.5 64 104.0 65 95.0 66 97.0 67 89.5 68 91.0 69 81.5 70 61.5 71 64.0 72 62.5 73 52.0 74 37.5 75 26.5 76 20.5 77 18.0 78 12.5 79 7.5 80 5.5 81 3.5 82 2.0 83 0.0 84 1.0 85 1.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.825 #Duplication Level Percentage of deduplicated Percentage of total 1 91.21937792458024 82.85 2 7.7071290944123305 14.000000000000002 3 0.8808147536471236 2.4 4 0.13762730525736308 0.5 5 0.055050922102945224 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAACGATCTAGTGCAGCAGCAGCTTGCTCTCTCCTCCATCTAGTAGAAGA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.4625000000000004 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.9 0.0 0.0 0.0 0.0 128-129 3.2625 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 3.975 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.9625 0.0 0.0 0.0 0.0 138-139 5.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425360 spots for SRR7804082.sra Written 425360 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra Read 425359 spots for SRR7804082.sra Written 425359 spots for SRR7804082.sra SRR ids: ['SRR7804082.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mvhgxqd1 SRR7804082.sra spots: 8507181 blocks: [[1, 425359], [425360, 850718], [850719, 1276077], [1276078, 1701436], [1701437, 2126795], [2126796, 2552154], [2552155, 2977513], [2977514, 3402872], [3402873, 3828231], [3828232, 4253590], [4253591, 4678949], [4678950, 5104308], [5104309, 5529667], [5529668, 5955026], [5955027, 6380385], [6380386, 6805744], [6805745, 7231103], [7231104, 7656462], [7656463, 8081821], [8081822, 8507181]] SRR7804082 file size 2864019 SRR7804082 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804082 SRR7804082_1.fastq SRR7804082_2.fastq Input file: SRR7804082_1.fastq Paired file: SRR7804082_2.fastq trimmed: SRR7804082-trimmed-pair1.fastq, SRR7804082-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:18:23 2024 >> started Sat Dec 7 16:18:32 2024 >> done (9.271s) 8507181 read pairs processed; of these: 109 ( 0.00%) short read pairs filtered out after trimming by size control 59 ( 0.00%) empty read pairs filtered out after trimming by size control 8507013 (100.00%) read pairs available; of these: 734726 ( 8.64%) trimmed read pairs available after processing 7772287 (91.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 3 0.00% 20 6 0.00% 21 11 0.00% 22 9 0.00% 23 15 0.00% 24 7 0.00% 25 6 0.00% 26 8 0.00% 27 7 0.00% 28 6 0.00% 29 5 0.00% 30 6 0.00% 31 8 0.00% 32 3 0.00% 33 7 0.00% 34 6 0.00% 35 9 0.00% 36 8 0.00% 37 13 0.00% 38 15 0.00% 39 11 0.00% 40 10 0.00% 41 4 0.00% 42 9 0.00% 43 15 0.00% 44 12 0.00% 45 9 0.00% 46 11 0.00% 47 10 0.00% 48 14 0.00% 49 13 0.00% 50 17 0.00% 51 11 0.00% 52 10 0.00% 53 19 0.00% 54 11 0.00% 55 17 0.00% 56 17 0.00% 57 23 0.00% 58 14 0.00% 59 16 0.00% 60 19 0.00% 61 24 0.00% 62 21 0.00% 63 32 0.00% 64 24 0.00% 65 36 0.00% 66 29 0.00% 67 46 0.00% 68 54 0.00% 69 54 0.00% 70 62 0.00% 71 69 0.00% 72 99 0.00% 73 113 0.00% 74 121 0.00% 75 163 0.00% 76 157 0.00% 77 183 0.00% 78 205 0.00% 79 244 0.00% 80 271 0.00% 81 314 0.00% 82 407 0.00% 83 442 0.01% 84 534 0.01% 85 596 0.01% 86 635 0.01% 87 741 0.01% 88 761 0.01% 89 955 0.01% 90 1065 0.01% 91 1251 0.01% 92 1392 0.02% 93 1616 0.02% 94 1751 0.02% 95 1896 0.02% 96 1961 0.02% 97 2289 0.03% 98 2429 0.03% 99 2631 0.03% 100 2813 0.03% 101 3118 0.04% 102 3525 0.04% 103 3881 0.05% 104 4179 0.05% 105 4518 0.05% 106 4741 0.06% 107 5025 0.06% 108 5207 0.06% 109 5476 0.06% 110 5931 0.07% 111 6456 0.08% 112 6793 0.08% 113 7365 0.09% 114 7914 0.09% 115 8361 0.10% 116 8674 0.10% 117 9048 0.11% 118 9447 0.11% 119 9760 0.11% 120 10048 0.12% 121 10705 0.13% 122 11211 0.13% 123 11976 0.14% 124 12739 0.15% 125 13166 0.15% 126 13938 0.16% 127 14187 0.17% 128 14655 0.17% 129 15170 0.18% 130 15498 0.18% 131 15933 0.19% 132 16868 0.20% 133 17573 0.21% 134 18311 0.22% 135 19171 0.23% 136 19643 0.23% 137 19996 0.24% 138 20221 0.24% 139 21460 0.25% 140 21523 0.25% 141 21755 0.26% 142 22994 0.27% 143 23324 0.27% 144 24507 0.29% 145 25320 0.30% 146 25867 0.30% 147 26460 0.31% 148 27032 0.32% 149 27342 0.32% 150 27770 0.33% 151 7772287 91.36% 8507013 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=24 prefix-density=0.90 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=129.86 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=11.7 sequence=AGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCAAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTCACTGGGTCGGACAGGTGGTCGGCCAGGTTCTCGAG criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=23 prefix-density=0.80 prefix-fanout=2.3 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=135.75 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=10.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804082 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:19:24 Started mapping on | Dec 07 16:19:24 Finished on | Dec 07 16:20:42 Mapping speed, Million of reads per hour | 392.63 Number of input reads | 8507013 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 7496726 Uniquely mapped reads % | 88.12% Average mapped length | 296.95 Number of splices: Total | 7462138 Number of splices: Annotated (sjdb) | 7013296 Number of splices: GT/AG | 7351411 Number of splices: GC/AG | 91518 Number of splices: AT/AC | 3724 Number of splices: Non-canonical | 15485 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 110321 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 10085 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.67% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 899966 899966 899966 N_multimapping 110321 110321 110321 N_noFeature 190886 7297545 243600 N_ambiguous 179021 1169 32584 UnstrandedReadsAssigned:7126819 PositiveStrandReadsAssigned:198012 NegativeStrandReadsAssigned:7220542 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804082 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804082-trimmed-pair1.fastq SRR7804082-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,507,013 reads, 7,278,620 reads pseudoaligned [quant] estimated average fragment length: 247.277 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR7804082.ke.tsv 35125 SRR7804082.se.tsv 88098 total ==> SRR7804082.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.034 0 0 PNS24247 1044 797.723 13.2417 2.93741 PNS24249 1928 1681.72 44.1424 4.64488 PNS24246 1044 797.723 13.2417 2.93741 PNS24248 1044 797.723 13.2417 2.93741 PNS24244 1471 1224.72 32.1325 4.64278 PNS24243 293 91.6095 0 0 KQK14069 1603 1356.72 295.497 38.542 KQK14071 474 239.239 10.1603 7.51533 ==> SRR7804082.se.tsv <== BRADI_1g14170v3 323 BRADI_1g53295v3 216 BRADI_1g59795v3 124 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 690 BRADI_1g74790v3 136 BRADI_1g09890v3 2 BRADI_1g77505v3 131 BRADI_1g48960v3 0 SRR7804082 completed mapping pipeline successfully