Starting /dee2/code/volunteer_pipeline.sh SRR7804083 current disk space = 1541783515136 free memory = 1449678220 SRR7804083 SRAfilesize 1101f9e6d8190faac364f70da927b882 SRR7804083.sra SRR7804083.sra file validated SRR7804083 is paired end SRR7804083 is conventional basespace SRR7804083 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804083_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.157 37.0 37.0 37.0 37.0 37.0 2 36.22475 37.0 37.0 37.0 37.0 37.0 3 36.3205 37.0 37.0 37.0 37.0 37.0 4 36.358 37.0 37.0 37.0 37.0 37.0 5 36.419 37.0 37.0 37.0 37.0 37.0 6 36.395 37.0 37.0 37.0 37.0 37.0 7 36.2575 37.0 37.0 37.0 37.0 37.0 8 36.4295 37.0 37.0 37.0 37.0 37.0 9 36.3975 37.0 37.0 37.0 37.0 37.0 10-14 36.412400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.4285 37.0 37.0 37.0 37.0 37.0 20-24 36.3908 37.0 37.0 37.0 37.0 37.0 25-29 36.3686 37.0 37.0 37.0 37.0 37.0 30-34 36.3289 37.0 37.0 37.0 37.0 37.0 35-39 36.319100000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.3365 37.0 37.0 37.0 37.0 37.0 45-49 36.3293 37.0 37.0 37.0 37.0 37.0 50-54 36.2913 37.0 37.0 37.0 37.0 37.0 55-59 36.2649 37.0 37.0 37.0 37.0 37.0 60-64 36.3013 37.0 37.0 37.0 37.0 37.0 65-69 36.216499999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.22 37.0 37.0 37.0 37.0 37.0 75-79 36.1492 37.0 37.0 37.0 37.0 37.0 80-84 36.1029 37.0 37.0 37.0 37.0 37.0 85-89 36.0745 37.0 37.0 37.0 37.0 37.0 90-94 36.0465 37.0 37.0 37.0 37.0 37.0 95-99 36.0361 37.0 37.0 37.0 37.0 37.0 100-104 36.0095 37.0 37.0 37.0 37.0 37.0 105-109 35.9028 37.0 37.0 37.0 37.0 37.0 110-114 35.877599999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.9085 37.0 37.0 37.0 37.0 37.0 120-124 35.83669999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.759 37.0 37.0 37.0 37.0 37.0 130-134 35.687599999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.660399999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.6294 37.0 37.0 37.0 37.0 37.0 145-149 35.58 37.0 37.0 37.0 37.0 37.0 150-151 35.12975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 1.0 25 2.0 26 8.0 27 9.0 28 19.0 29 30.0 30 31.0 31 45.0 32 81.0 33 88.0 34 143.0 35 387.0 36 2791.0 37 362.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.675 11.924999999999999 9.049999999999999 34.35 2 26.394796097072803 13.284963722792096 30.572929697272954 29.74731048286215 3 22.15 18.825 24.525 34.5 4 26.5 25.15 20.849999999999998 27.500000000000004 5 24.85 27.825 22.675 24.65 6 23.575 31.225 21.95 23.25 7 18.775 22.75 38.824999999999996 19.650000000000002 8 20.4 23.9 27.625 28.075 9 19.725 22.275 32.525 25.474999999999998 10-14 23.025000000000002 25.97 25.635 25.369999999999997 15-19 23.335 25.445 25.224999999999998 25.995 20-24 23.56 25.46 25.19 25.790000000000003 25-29 23.73 25.105 25.365 25.8 30-34 23.52 24.88 25.31 26.290000000000003 35-39 23.375 25.03 25.580000000000002 26.015 40-44 23.925 25.319999999999997 25.275 25.480000000000004 45-49 23.74 24.86 25.25 26.150000000000002 50-54 23.405 24.925 25.779999999999998 25.89 55-59 23.365 25.1 25.34 26.195 60-64 23.435 24.575 25.330000000000002 26.66 65-69 23.990000000000002 24.990000000000002 24.95 26.07 70-74 23.54 24.88 25.25 26.33 75-79 23.375 24.645 25.324999999999996 26.655 80-84 23.695 24.715 24.759999999999998 26.83 85-89 23.605 25.405 25.0 25.990000000000002 90-94 24.099999999999998 24.95 24.83 26.119999999999997 95-99 24.085 23.915 25.755 26.245 100-104 23.745 24.79 24.615000000000002 26.85 105-109 24.435000000000002 24.545 24.240000000000002 26.779999999999998 110-114 24.14 24.08 25.245 26.534999999999997 115-119 24.46 23.69 25.124999999999996 26.724999999999998 120-124 24.375 24.46 25.064999999999998 26.1 125-129 24.060000000000002 23.89 25.369999999999997 26.68 130-134 24.310000000000002 24.884999999999998 24.785 26.02 135-139 24.15 24.07 25.305 26.474999999999998 140-144 25.055 24.4 24.925 25.619999999999997 145-149 23.685000000000002 25.069999999999997 24.605 26.640000000000004 150-151 24.474999999999998 23.9125 25.8 25.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 0.5 28 2.0 29 6.0 30 6.0 31 11.0 32 17.5 33 14.5 34 21.0 35 32.0 36 41.0 37 66.5 38 93.0 39 106.0 40 120.0 41 131.0 42 157.5 43 175.5 44 170.5 45 189.5 46 207.0 47 192.0 48 189.5 49 193.0 50 165.0 51 132.5 52 114.5 53 117.5 54 117.5 55 109.5 56 105.5 57 86.0 58 85.5 59 85.5 60 71.0 61 72.0 62 60.5 63 51.0 64 58.0 65 62.5 66 57.0 67 47.5 68 39.0 69 37.5 70 34.5 71 29.5 72 28.0 73 16.5 74 9.5 75 11.0 76 12.0 77 12.0 78 12.0 79 8.5 80 2.0 81 0.5 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.65801445009366 87.5 2 5.806796895905807 10.85 3 0.3746320578003747 1.05 4 0.16055659620016055 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.775 0.0 0.0 0.0 0.0 132-133 0.825 0.0 0.0 0.0 0.0 134-135 0.925 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138-139 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACAC 10 0.006830828 145.0 1 TGATGTA 10 0.006830828 145.0 4 >>END_MODULE SRR7804083 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804083_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.231 37.0 37.0 37.0 37.0 37.0 2 35.958 37.0 37.0 37.0 37.0 37.0 3 36.0765 37.0 37.0 37.0 37.0 37.0 4 36.052 37.0 37.0 37.0 37.0 37.0 5 36.039 37.0 37.0 37.0 37.0 37.0 6 36.1775 37.0 37.0 37.0 37.0 37.0 7 36.1305 37.0 37.0 37.0 37.0 37.0 8 36.25 37.0 37.0 37.0 37.0 37.0 9 36.0885 37.0 37.0 37.0 37.0 37.0 10-14 36.157799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.0013 37.0 37.0 37.0 37.0 37.0 20-24 36.0638 37.0 37.0 37.0 37.0 37.0 25-29 36.042699999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.9657 37.0 37.0 37.0 37.0 37.0 35-39 35.940799999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.88940000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.8405 37.0 37.0 37.0 37.0 37.0 50-54 35.7802 37.0 37.0 37.0 37.0 37.0 55-59 35.7327 37.0 37.0 37.0 37.0 37.0 60-64 35.751400000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.7033 37.0 37.0 37.0 37.0 37.0 70-74 35.702799999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.6958 37.0 37.0 37.0 37.0 37.0 80-84 35.716300000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.671800000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.6529 37.0 37.0 37.0 37.0 37.0 95-99 35.5578 37.0 37.0 37.0 37.0 37.0 100-104 35.6049 37.0 37.0 37.0 37.0 37.0 105-109 35.5318 37.0 37.0 37.0 37.0 37.0 110-114 35.4111 37.0 37.0 37.0 37.0 37.0 115-119 35.385200000000005 37.0 37.0 37.0 34.6 37.0 120-124 35.4028 37.0 37.0 37.0 37.0 37.0 125-129 35.309400000000004 37.0 37.0 37.0 34.6 37.0 130-134 35.3175 37.0 37.0 37.0 34.6 37.0 135-139 35.11560000000001 37.0 37.0 37.0 27.4 37.0 140-144 35.197900000000004 37.0 37.0 37.0 32.2 37.0 145-149 35.032000000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.4765 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 7.0 15 6.0 16 2.0 17 1.0 18 2.0 19 0.0 20 2.0 21 5.0 22 3.0 23 8.0 24 8.0 25 5.0 26 7.0 27 22.0 28 22.0 29 19.0 30 37.0 31 49.0 32 80.0 33 115.0 34 219.0 35 647.0 36 2552.0 37 176.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.875 18.6 10.925 28.599999999999998 2 32.25 22.875 23.625 21.25 3 24.875 25.2 25.825 24.099999999999998 4 26.1 31.85 18.9 23.150000000000002 5 29.475 29.975 19.8 20.75 6 25.025 33.900000000000006 17.65 23.425 7 23.150000000000002 20.525 32.074999999999996 24.25 8 24.925 23.474999999999998 21.075 30.525000000000002 9 23.95 23.375 25.474999999999998 27.200000000000003 10-14 25.915 25.695 22.645 25.745 15-19 26.284999999999997 24.759999999999998 23.335 25.619999999999997 20-24 26.61 24.83 23.04 25.52 25-29 26.31 25.324999999999996 22.994999999999997 25.369999999999997 30-34 25.8 25.540000000000003 23.095 25.564999999999998 35-39 26.825 24.415 23.715 25.045 40-44 25.874999999999996 24.545 23.39 26.19 45-49 25.765 25.86 23.294999999999998 25.080000000000002 50-54 26.3 24.63 23.93 25.14 55-59 26.979999999999997 23.9 23.78 25.34 60-64 26.119999999999997 24.795 23.435 25.650000000000002 65-69 26.740000000000002 25.205 23.3 24.755 70-74 26.68 24.990000000000002 23.0 25.330000000000002 75-79 26.27 25.430000000000003 23.225 25.074999999999996 80-84 27.05 24.85 23.16 24.94 85-89 26.615 25.064999999999998 23.355 24.965 90-94 26.605 25.115 23.400000000000002 24.88 95-99 27.055 25.27 22.775000000000002 24.9 100-104 26.685 24.985 24.065 24.265 105-109 27.355 24.97 23.04 24.635 110-114 26.19 25.275 23.745 24.79 115-119 26.775 25.335 23.105 24.785 120-124 26.935 25.064999999999998 23.595 24.404999999999998 125-129 26.505000000000003 25.66 23.244999999999997 24.59 130-134 27.089999999999996 25.230000000000004 23.494999999999997 24.185000000000002 135-139 26.634999999999998 24.895 23.525 24.945 140-144 26.8 25.619999999999997 23.615 23.965 145-149 27.529999999999998 25.255 23.07 24.145 150-151 25.4875 25.95 23.7125 24.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 0.5 22 0.5 23 0.5 24 0.0 25 1.5 26 2.0 27 1.5 28 2.5 29 2.5 30 5.0 31 7.5 32 10.0 33 18.0 34 24.0 35 24.5 36 40.5 37 54.0 38 58.5 39 80.0 40 109.5 41 130.5 42 141.0 43 150.5 44 167.0 45 195.5 46 189.0 47 151.0 48 144.0 49 154.5 50 137.5 51 126.5 52 119.5 53 112.5 54 112.5 55 105.5 56 95.5 57 83.5 58 90.5 59 88.5 60 80.5 61 84.0 62 83.5 63 76.5 64 73.0 65 77.0 66 78.5 67 75.0 68 68.5 69 63.5 70 57.5 71 49.0 72 45.5 73 38.5 74 29.5 75 23.5 76 15.0 77 8.0 78 6.5 79 5.0 80 2.0 81 1.5 82 2.5 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.5 93 1.0 94 0.0 95 0.5 96 0.5 97 0.5 98 1.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.62784471218207 87.425 2 5.809906291834003 10.85 3 0.4016064257028112 1.125 4 0.1606425702811245 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.2625 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.44999999999999996 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.725 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.875 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898040 spots for SRR7804083.sra Written 1898040 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra Read 1898027 spots for SRR7804083.sra Written 1898027 spots for SRR7804083.sra SRR ids: ['SRR7804083.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cg3acnwa SRR7804083.sra spots: 37960553 blocks: [[1, 1898027], [1898028, 3796054], [3796055, 5694081], [5694082, 7592108], [7592109, 9490135], [9490136, 11388162], [11388163, 13286189], [13286190, 15184216], [15184217, 17082243], [17082244, 18980270], [18980271, 20878297], [20878298, 22776324], [22776325, 24674351], [24674352, 26572378], [26572379, 28470405], [28470406, 30368432], [30368433, 32266459], [32266460, 34164486], [34164487, 36062513], [36062514, 37960553]] SRR7804083 file size 12841885 SRR7804083 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804083 SRR7804083_1.fastq SRR7804083_2.fastq Input file: SRR7804083_1.fastq Paired file: SRR7804083_2.fastq trimmed: SRR7804083-trimmed-pair1.fastq, SRR7804083-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:25:44 2024 >> started Sat Dec 7 16:26:32 2024 >> done (47.149s) 37960553 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 1237 ( 0.00%) empty read pairs filtered out after trimming by size control 37959189 (100.00%) read pairs available; of these: 739972 ( 1.95%) trimmed read pairs available after processing 37219217 (98.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 19 0.00% 20 18 0.00% 21 18 0.00% 22 26 0.00% 23 26 0.00% 24 22 0.00% 25 26 0.00% 26 27 0.00% 27 25 0.00% 28 34 0.00% 29 38 0.00% 30 36 0.00% 31 54 0.00% 32 35 0.00% 33 30 0.00% 34 40 0.00% 35 51 0.00% 36 36 0.00% 37 45 0.00% 38 52 0.00% 39 47 0.00% 40 60 0.00% 41 61 0.00% 42 69 0.00% 43 40 0.00% 44 50 0.00% 45 82 0.00% 46 69 0.00% 47 67 0.00% 48 56 0.00% 49 71 0.00% 50 49 0.00% 51 77 0.00% 52 82 0.00% 53 80 0.00% 54 79 0.00% 55 80 0.00% 56 85 0.00% 57 86 0.00% 58 97 0.00% 59 98 0.00% 60 100 0.00% 61 81 0.00% 62 109 0.00% 63 145 0.00% 64 129 0.00% 65 91 0.00% 66 129 0.00% 67 135 0.00% 68 129 0.00% 69 149 0.00% 70 141 0.00% 71 161 0.00% 72 185 0.00% 73 229 0.00% 74 206 0.00% 75 242 0.00% 76 276 0.00% 77 283 0.00% 78 299 0.00% 79 331 0.00% 80 386 0.00% 81 454 0.00% 82 525 0.00% 83 543 0.00% 84 586 0.00% 85 624 0.00% 86 716 0.00% 87 763 0.00% 88 893 0.00% 89 924 0.00% 90 1099 0.00% 91 1189 0.00% 92 1375 0.00% 93 1448 0.00% 94 1554 0.00% 95 1755 0.00% 96 1886 0.00% 97 2114 0.01% 98 2240 0.01% 99 2447 0.01% 100 2614 0.01% 101 2787 0.01% 102 3102 0.01% 103 3351 0.01% 104 3597 0.01% 105 3934 0.01% 106 4238 0.01% 107 4252 0.01% 108 4552 0.01% 109 4871 0.01% 110 5148 0.01% 111 5531 0.01% 112 6079 0.02% 113 6375 0.02% 114 6866 0.02% 115 7189 0.02% 116 7545 0.02% 117 7726 0.02% 118 8121 0.02% 119 8653 0.02% 120 9111 0.02% 121 9707 0.03% 122 10161 0.03% 123 10890 0.03% 124 11533 0.03% 125 12136 0.03% 126 12675 0.03% 127 13310 0.04% 128 13430 0.04% 129 14151 0.04% 130 14503 0.04% 131 15249 0.04% 132 16362 0.04% 133 17159 0.05% 134 18178 0.05% 135 18890 0.05% 136 19974 0.05% 137 20535 0.05% 138 20904 0.06% 139 21583 0.06% 140 22120 0.06% 141 23385 0.06% 142 24506 0.06% 143 25029 0.07% 144 26539 0.07% 145 28302 0.07% 146 28735 0.08% 147 30085 0.08% 148 31029 0.08% 149 31292 0.08% 150 32751 0.09% 151 37219217 98.05% 37959189 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.79 fanout-score-rank=26 prefix-density=0.36 prefix-fanout=3.5 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=102.58 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.8 sequence=ATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=28 prefix-density=0.44 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=193.36 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=23.7 sequence=CGCCGCCGCCGC SRR7804083 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:29:09 Started mapping on | Dec 07 16:29:09 Finished on | Dec 07 16:34:35 Mapping speed, Million of reads per hour | 419.18 Number of input reads | 37959189 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 34452257 Uniquely mapped reads % | 90.76% Average mapped length | 299.90 Number of splices: Total | 36679736 Number of splices: Annotated (sjdb) | 34198789 Number of splices: GT/AG | 36112431 Number of splices: GC/AG | 448202 Number of splices: AT/AC | 19777 Number of splices: Non-canonical | 99326 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 3.08 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 580723 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 60188 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.21% % of reads unmapped: other | 1.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2926209 2926209 2926209 N_multimapping 580723 580723 580723 N_noFeature 1550768 33272889 1986127 N_ambiguous 921835 10325 175166 UnstrandedReadsAssigned:31979654 PositiveStrandReadsAssigned:1169043 NegativeStrandReadsAssigned:32290964 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804083 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804083-trimmed-pair1.fastq SRR7804083-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,959,189 reads, 32,693,443 reads pseudoaligned [quant] estimated average fragment length: 321.828 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR7804083.ke.tsv 35125 SRR7804083.se.tsv 88098 total ==> SRR7804083.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 616.081 0 0 PNS24247 1044 723.172 134.096 7.39383 PNS24249 1928 1607.17 313.451 7.77682 PNS24246 1044 723.172 134.096 7.39383 PNS24248 1044 723.172 134.096 7.39383 PNS24244 1471 1150.17 203.26 7.04667 PNS24243 293 68.6269 0 0 KQK14069 1603 1282.17 113.916 3.54268 KQK14071 474 187.864 1.75976 0.373511 ==> SRR7804083.se.tsv <== BRADI_1g14170v3 118 BRADI_1g53295v3 8034 BRADI_1g59795v3 1328 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 1962 BRADI_1g74790v3 1023 BRADI_1g09890v3 0 BRADI_1g77505v3 565 BRADI_1g48960v3 0 SRR7804083 completed mapping pipeline successfully