Starting /dee2/code/volunteer_pipeline.sh SRR7804084 current disk space = 1541783515136 free memory = 1449483068 SRR7804084 SRAfilesize 7e1553e1358a8a51091d36fa2648c271 SRR7804084.sra SRR7804084.sra file validated SRR7804084 is paired end SRR7804084 is conventional basespace SRR7804084 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804084_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1655 37.0 37.0 37.0 37.0 37.0 2 36.18825 37.0 37.0 37.0 37.0 37.0 3 36.35 37.0 37.0 37.0 37.0 37.0 4 36.419 37.0 37.0 37.0 37.0 37.0 5 36.461 37.0 37.0 37.0 37.0 37.0 6 36.432 37.0 37.0 37.0 37.0 37.0 7 36.3135 37.0 37.0 37.0 37.0 37.0 8 36.3705 37.0 37.0 37.0 37.0 37.0 9 36.45 37.0 37.0 37.0 37.0 37.0 10-14 36.445499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3805 37.0 37.0 37.0 37.0 37.0 20-24 36.4079 37.0 37.0 37.0 37.0 37.0 25-29 36.368 37.0 37.0 37.0 37.0 37.0 30-34 36.3486 37.0 37.0 37.0 37.0 37.0 35-39 36.3343 37.0 37.0 37.0 37.0 37.0 40-44 36.3035 37.0 37.0 37.0 37.0 37.0 45-49 36.29110000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.228300000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.252100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.2553 37.0 37.0 37.0 37.0 37.0 65-69 36.196400000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1622 37.0 37.0 37.0 37.0 37.0 75-79 36.1486 37.0 37.0 37.0 37.0 37.0 80-84 36.0689 37.0 37.0 37.0 37.0 37.0 85-89 36.057199999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.0205 37.0 37.0 37.0 37.0 37.0 95-99 36.0019 37.0 37.0 37.0 37.0 37.0 100-104 36.00940000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.9721 37.0 37.0 37.0 37.0 37.0 110-114 35.932 37.0 37.0 37.0 37.0 37.0 115-119 35.9433 37.0 37.0 37.0 37.0 37.0 120-124 35.9048 37.0 37.0 37.0 37.0 37.0 125-129 35.7825 37.0 37.0 37.0 37.0 37.0 130-134 35.7693 37.0 37.0 37.0 37.0 37.0 135-139 35.7299 37.0 37.0 37.0 37.0 37.0 140-144 35.6427 37.0 37.0 37.0 37.0 37.0 145-149 35.68310000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.14975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 9.0 27 9.0 28 19.0 29 23.0 30 49.0 31 51.0 32 56.0 33 96.0 34 150.0 35 402.0 36 2777.0 37 356.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.825 11.675 8.575000000000001 36.925000000000004 2 25.431357839459867 12.328082020505127 28.732183045761438 33.50837709427357 3 21.9 16.400000000000002 24.5 37.2 4 26.924999999999997 20.75 22.725 29.599999999999998 5 29.299999999999997 24.55 21.099999999999998 25.05 6 25.0 25.900000000000002 24.325 24.775 7 18.6 23.45 36.225 21.725 8 21.375 21.8 28.249999999999996 28.575 9 21.425 21.349999999999998 31.175000000000004 26.05 10-14 23.474999999999998 24.495 24.25 27.779999999999998 15-19 23.91 23.235 25.645 27.21 20-24 24.38 22.830000000000002 25.290000000000003 27.500000000000004 25-29 24.6 23.34 24.88 27.18 30-34 24.345 23.35 24.895 27.41 35-39 24.545 23.41 24.66 27.384999999999998 40-44 24.575 23.18 24.785 27.46 45-49 24.525 23.095 25.105 27.275 50-54 24.654999999999998 23.205000000000002 24.545 27.595 55-59 25.0 22.91 24.685000000000002 27.405 60-64 24.89 22.900000000000002 24.73 27.48 65-69 24.66 23.330000000000002 23.95 28.060000000000002 70-74 25.180000000000003 23.23 24.265 27.325 75-79 24.685000000000002 23.18 24.09 28.044999999999998 80-84 24.905 22.67 24.9 27.525 85-89 24.97 22.695 24.39 27.944999999999997 90-94 25.275 22.830000000000002 24.315 27.58 95-99 25.480000000000004 23.055 24.415 27.05 100-104 25.474999999999998 23.135 23.544999999999998 27.845 105-109 25.1 22.869999999999997 24.525 27.505000000000003 110-114 25.595000000000002 22.58 24.165 27.66 115-119 25.395 22.57 24.11 27.925 120-124 25.525 22.994999999999997 23.595 27.884999999999998 125-129 25.455 23.0 23.549999999999997 27.994999999999997 130-134 25.09 22.965 24.490000000000002 27.455000000000002 135-139 25.445 22.56 24.834999999999997 27.16 140-144 26.005 22.515 24.055 27.425 145-149 25.34 23.205000000000002 24.04 27.415 150-151 24.925 22.775000000000002 24.6875 27.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.5 24 0.5 25 0.0 26 2.5 27 2.5 28 2.5 29 4.0 30 5.5 31 7.5 32 11.5 33 17.0 34 20.5 35 25.5 36 30.5 37 31.0 38 43.5 39 70.5 40 81.5 41 86.5 42 106.0 43 126.0 44 142.0 45 152.0 46 157.5 47 170.5 48 164.5 49 151.5 50 147.0 51 138.0 52 123.0 53 130.5 54 151.5 55 156.0 56 168.0 57 152.0 58 119.5 59 100.0 60 91.5 61 95.0 62 86.5 63 76.5 64 73.0 65 64.5 66 58.0 67 62.5 68 60.5 69 54.0 70 56.5 71 47.0 72 33.0 73 30.0 74 30.5 75 24.0 76 17.5 77 15.0 78 11.0 79 6.0 80 1.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.44975556762628 85.1 2 6.735469853340575 12.4 3 0.6246605105920695 1.725 4 0.10863661053775121 0.4 5 0.08147745790331341 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAT 5 0.125 No Hit ACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATT 5 0.125 No Hit ACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.1375 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAGCT 10 0.006830828 145.0 1 >>END_MODULE SRR7804084 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804084_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3705 37.0 37.0 37.0 37.0 37.0 2 36.0185 37.0 37.0 37.0 37.0 37.0 3 36.0485 37.0 37.0 37.0 37.0 37.0 4 36.1345 37.0 37.0 37.0 37.0 37.0 5 36.0235 37.0 37.0 37.0 37.0 37.0 6 36.0515 37.0 37.0 37.0 37.0 37.0 7 36.004 37.0 37.0 37.0 37.0 37.0 8 36.092 37.0 37.0 37.0 37.0 37.0 9 36.107 37.0 37.0 37.0 37.0 37.0 10-14 36.1211 37.0 37.0 37.0 37.0 37.0 15-19 36.02589999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.033100000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.9714 37.0 37.0 37.0 37.0 37.0 30-34 35.953500000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.9716 37.0 37.0 37.0 37.0 37.0 40-44 35.894 37.0 37.0 37.0 37.0 37.0 45-49 35.907000000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.8423 37.0 37.0 37.0 37.0 37.0 55-59 35.801100000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.865700000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.796499999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.7624 37.0 37.0 37.0 37.0 37.0 75-79 35.7544 37.0 37.0 37.0 37.0 37.0 80-84 35.7393 37.0 37.0 37.0 37.0 37.0 85-89 35.7666 37.0 37.0 37.0 37.0 37.0 90-94 35.7313 37.0 37.0 37.0 37.0 37.0 95-99 35.6428 37.0 37.0 37.0 37.0 37.0 100-104 35.6634 37.0 37.0 37.0 37.0 37.0 105-109 35.5587 37.0 37.0 37.0 37.0 37.0 110-114 35.4098 37.0 37.0 37.0 37.0 37.0 115-119 35.438100000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.485800000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.366200000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.4069 37.0 37.0 37.0 34.6 37.0 135-139 35.2952 37.0 37.0 37.0 34.6 37.0 140-144 35.276599999999995 37.0 37.0 37.0 34.6 37.0 145-149 35.1108 37.0 37.0 37.0 25.0 37.0 150-151 34.7625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 2.0 15 1.0 16 6.0 17 0.0 18 1.0 19 1.0 20 11.0 21 5.0 22 10.0 23 10.0 24 8.0 25 17.0 26 9.0 27 8.0 28 20.0 29 23.0 30 23.0 31 45.0 32 81.0 33 89.0 34 188.0 35 606.0 36 2627.0 37 203.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 17.625 11.525 31.075000000000003 2 32.425 21.825 21.475 24.275 3 26.35 25.924999999999997 24.775 22.95 4 27.474999999999998 30.225 18.275 24.025 5 28.875 32.074999999999996 17.95 21.099999999999998 6 25.775 34.8 18.325 21.099999999999998 7 25.374999999999996 20.025000000000002 30.95 23.65 8 26.05 23.375 19.5 31.075000000000003 9 25.424999999999997 22.35 24.825 27.400000000000002 10-14 27.12 25.195 21.175 26.51 15-19 27.169999999999998 24.875 22.495 25.46 20-24 27.61 25.840000000000003 21.615000000000002 24.935 25-29 27.99 25.385 21.39 25.235000000000003 30-34 27.0 24.94 22.93 25.130000000000003 35-39 27.865000000000002 25.115 21.61 25.41 40-44 27.810000000000002 24.88 21.995 25.314999999999998 45-49 27.555000000000003 25.09 21.675 25.679999999999996 50-54 27.384999999999998 24.9 22.31 25.405 55-59 27.955000000000002 24.195 22.02 25.83 60-64 27.48 24.535 22.314999999999998 25.669999999999998 65-69 27.735 24.945 21.69 25.629999999999995 70-74 27.839999999999996 24.154999999999998 22.33 25.674999999999997 75-79 27.16 24.505 22.41 25.924999999999997 80-84 27.810000000000002 24.73 22.325 25.135 85-89 27.389999999999997 24.505 21.990000000000002 26.115 90-94 27.500000000000004 24.845 22.12 25.535000000000004 95-99 28.03 24.46 21.54 25.97 100-104 28.000000000000004 24.12 22.79 25.09 105-109 27.725 24.415 21.98 25.88 110-114 27.35 24.37 22.470000000000002 25.81 115-119 28.044999999999998 24.5 21.8 25.655 120-124 28.01 25.52 21.12 25.35 125-129 27.57 24.915000000000003 21.759999999999998 25.755 130-134 27.750000000000004 24.625 21.87 25.755 135-139 27.694999999999997 25.064999999999998 21.94 25.3 140-144 28.475 24.38 22.33 24.815 145-149 28.305000000000003 24.865000000000002 22.009999999999998 24.82 150-151 27.925 24.7375 22.287499999999998 25.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 2.0 19 2.0 20 2.0 21 1.0 22 0.5 23 1.0 24 2.0 25 2.0 26 1.0 27 1.5 28 3.5 29 5.5 30 4.5 31 5.0 32 7.5 33 11.0 34 16.5 35 21.5 36 28.0 37 36.5 38 51.0 39 58.5 40 71.5 41 93.0 42 106.5 43 119.0 44 130.5 45 138.0 46 159.5 47 169.0 48 145.5 49 136.0 50 127.5 51 131.5 52 134.5 53 128.0 54 130.5 55 137.5 56 138.0 57 138.0 58 126.0 59 111.0 60 109.0 61 94.5 62 96.5 63 96.0 64 80.0 65 79.0 66 73.5 67 66.5 68 64.0 69 64.5 70 60.5 71 51.5 72 46.5 73 42.5 74 39.0 75 29.0 76 19.5 77 10.0 78 10.0 79 8.5 80 4.0 81 3.0 82 1.5 83 1.0 84 1.5 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.63916391639164 83.3 2 7.37073707370737 13.4 3 0.6325632563256326 1.725 4 0.1925192519251925 0.7000000000000001 5 0.08250825082508251 0.375 6 0.055005500550055 0.3 7 0.0 0.0 8 0.0275027502750275 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 8 0.2 No Hit CCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTTCGGGGAGTTGA 6 0.15 No Hit CCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCC 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.1375 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACGGCA 10 0.006830828 145.0 2 AAACGGC 10 0.006830828 145.0 1 >>END_MODULE Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489230 spots for SRR7804084.sra Written 1489230 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra Read 1489216 spots for SRR7804084.sra Written 1489216 spots for SRR7804084.sra SRR ids: ['SRR7804084.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uvh080e9 SRR7804084.sra spots: 29784334 blocks: [[1, 1489216], [1489217, 2978432], [2978433, 4467648], [4467649, 5956864], [5956865, 7446080], [7446081, 8935296], [8935297, 10424512], [10424513, 11913728], [11913729, 13402944], [13402945, 14892160], [14892161, 16381376], [16381377, 17870592], [17870593, 19359808], [19359809, 20849024], [20849025, 22338240], [22338241, 23827456], [23827457, 25316672], [25316673, 26805888], [26805889, 28295104], [28295105, 29784334]] SRR7804084 file size 10071233 SRR7804084 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804084 SRR7804084_1.fastq SRR7804084_2.fastq Input file: SRR7804084_1.fastq Paired file: SRR7804084_2.fastq trimmed: SRR7804084-trimmed-pair1.fastq, SRR7804084-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:25:05 2024 >> started Sat Dec 7 16:25:42 2024 >> done (36.405s) 29784334 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 987 ( 0.00%) empty read pairs filtered out after trimming by size control 29783243 (100.00%) read pairs available; of these: 763097 ( 2.56%) trimmed read pairs available after processing 29020146 (97.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 19 0.00% 20 14 0.00% 21 19 0.00% 22 26 0.00% 23 29 0.00% 24 17 0.00% 25 31 0.00% 26 33 0.00% 27 40 0.00% 28 35 0.00% 29 45 0.00% 30 52 0.00% 31 47 0.00% 32 56 0.00% 33 54 0.00% 34 47 0.00% 35 52 0.00% 36 69 0.00% 37 52 0.00% 38 73 0.00% 39 59 0.00% 40 60 0.00% 41 74 0.00% 42 76 0.00% 43 88 0.00% 44 67 0.00% 45 76 0.00% 46 89 0.00% 47 86 0.00% 48 83 0.00% 49 84 0.00% 50 108 0.00% 51 79 0.00% 52 102 0.00% 53 93 0.00% 54 103 0.00% 55 93 0.00% 56 115 0.00% 57 112 0.00% 58 126 0.00% 59 109 0.00% 60 138 0.00% 61 126 0.00% 62 139 0.00% 63 129 0.00% 64 132 0.00% 65 118 0.00% 66 146 0.00% 67 150 0.00% 68 165 0.00% 69 169 0.00% 70 213 0.00% 71 205 0.00% 72 208 0.00% 73 250 0.00% 74 216 0.00% 75 276 0.00% 76 298 0.00% 77 294 0.00% 78 316 0.00% 79 402 0.00% 80 441 0.00% 81 447 0.00% 82 459 0.00% 83 539 0.00% 84 587 0.00% 85 655 0.00% 86 766 0.00% 87 759 0.00% 88 868 0.00% 89 905 0.00% 90 1046 0.00% 91 1163 0.00% 92 1271 0.00% 93 1489 0.00% 94 1608 0.01% 95 1744 0.01% 96 1879 0.01% 97 1928 0.01% 98 2154 0.01% 99 2245 0.01% 100 2562 0.01% 101 2780 0.01% 102 2876 0.01% 103 3151 0.01% 104 3493 0.01% 105 3746 0.01% 106 3974 0.01% 107 4275 0.01% 108 4543 0.02% 109 4968 0.02% 110 5122 0.02% 111 5466 0.02% 112 6043 0.02% 113 6193 0.02% 114 6659 0.02% 115 7202 0.02% 116 7495 0.03% 117 7852 0.03% 118 8236 0.03% 119 8551 0.03% 120 9542 0.03% 121 9722 0.03% 122 10176 0.03% 123 10926 0.04% 124 11433 0.04% 125 12283 0.04% 126 12825 0.04% 127 13583 0.05% 128 13996 0.05% 129 14730 0.05% 130 15440 0.05% 131 15851 0.05% 132 16705 0.06% 133 17803 0.06% 134 18678 0.06% 135 19155 0.06% 136 20396 0.07% 137 20897 0.07% 138 21716 0.07% 139 22457 0.08% 140 23609 0.08% 141 24032 0.08% 142 25579 0.09% 143 26621 0.09% 144 27784 0.09% 145 29392 0.10% 146 30417 0.10% 147 31614 0.11% 148 32349 0.11% 149 33648 0.11% 150 34802 0.12% 151 29020146 97.44% 29783243 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=34 prefix-density=0.36 prefix-fanout=2.3 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=130.37 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=6.8 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.40 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=15.92 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=4.8 sequence=TCTCCTCCTTCGGCGAGATCATCGACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGCTTCGTCACCTTCGCCAGC SRR7804084 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:28:24 Started mapping on | Dec 07 16:28:25 Finished on | Dec 07 16:32:22 Mapping speed, Million of reads per hour | 452.40 Number of input reads | 29783243 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 25676851 Uniquely mapped reads % | 86.21% Average mapped length | 299.90 Number of splices: Total | 22961501 Number of splices: Annotated (sjdb) | 21640573 Number of splices: GT/AG | 22649972 Number of splices: GC/AG | 252682 Number of splices: AT/AC | 7448 Number of splices: Non-canonical | 51399 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2267307 % of reads mapped to multiple loci | 7.61% Number of reads mapped to too many loci | 22211 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.54% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1839085 1839085 1839085 N_multimapping 2267307 2267307 2267307 N_noFeature 2672725 24953144 2860067 N_ambiguous 645065 12216 106323 UnstrandedReadsAssigned:22359061 PositiveStrandReadsAssigned:711491 NegativeStrandReadsAssigned:22710461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804084 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804084-trimmed-pair1.fastq SRR7804084-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,783,243 reads, 23,948,201 reads pseudoaligned [quant] estimated average fragment length: 298.438 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR7804084.ke.tsv 35125 SRR7804084.se.tsv 88098 total ==> SRR7804084.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 639.246 0 0 PNS24247 1044 746.562 70.256 4.28549 PNS24249 1928 1630.56 155.573 4.34491 PNS24246 1044 746.562 70.256 4.28549 PNS24248 1044 746.562 70.256 4.28549 PNS24244 1471 1173.56 104.659 4.06119 PNS24243 293 72.3805 0 0 KQK14069 1603 1305.56 983.295 34.2981 KQK14071 474 200.531 7.02206 1.59465 ==> SRR7804084.se.tsv <== BRADI_1g14170v3 1009 BRADI_1g53295v3 126 BRADI_1g59795v3 221 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 428 BRADI_1g74790v3 2610 BRADI_1g09890v3 0 BRADI_1g77505v3 206 BRADI_1g48960v3 0 SRR7804084 completed mapping pipeline successfully