Starting /dee2/code/volunteer_pipeline.sh SRR7804085 current disk space = 1541808300032 free memory = 1474089272 SRR7804085 SRAfilesize 91d8aa1479b67dc10c6422317df1b165 SRR7804085.sra SRR7804085.sra file validated SRR7804085 is paired end SRR7804085 is conventional basespace SRR7804085 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804085_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2785 37.0 37.0 37.0 37.0 37.0 2 36.221 37.0 37.0 37.0 37.0 37.0 3 36.407 37.0 37.0 37.0 37.0 37.0 4 36.48 37.0 37.0 37.0 37.0 37.0 5 36.507 37.0 37.0 37.0 37.0 37.0 6 36.4725 37.0 37.0 37.0 37.0 37.0 7 36.4945 37.0 37.0 37.0 37.0 37.0 8 36.4435 37.0 37.0 37.0 37.0 37.0 9 36.444 37.0 37.0 37.0 37.0 37.0 10-14 36.5221 37.0 37.0 37.0 37.0 37.0 15-19 36.467299999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.447599999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.421800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4471 37.0 37.0 37.0 37.0 37.0 35-39 36.391099999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.391999999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3677 37.0 37.0 37.0 37.0 37.0 50-54 36.3402 37.0 37.0 37.0 37.0 37.0 55-59 36.3177 37.0 37.0 37.0 37.0 37.0 60-64 36.3108 37.0 37.0 37.0 37.0 37.0 65-69 36.3015 37.0 37.0 37.0 37.0 37.0 70-74 36.243399999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.26540000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1983 37.0 37.0 37.0 37.0 37.0 85-89 36.2056 37.0 37.0 37.0 37.0 37.0 90-94 36.159800000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.147 37.0 37.0 37.0 37.0 37.0 100-104 36.1332 37.0 37.0 37.0 37.0 37.0 105-109 36.1063 37.0 37.0 37.0 37.0 37.0 110-114 36.1211 37.0 37.0 37.0 37.0 37.0 115-119 36.0286 37.0 37.0 37.0 37.0 37.0 120-124 35.9563 37.0 37.0 37.0 37.0 37.0 125-129 35.8729 37.0 37.0 37.0 37.0 37.0 130-134 35.8827 37.0 37.0 37.0 37.0 37.0 135-139 35.8457 37.0 37.0 37.0 37.0 37.0 140-144 35.8058 37.0 37.0 37.0 37.0 37.0 145-149 35.8006 37.0 37.0 37.0 37.0 37.0 150-151 35.28125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 3.0 26 7.0 27 10.0 28 18.0 29 20.0 30 31.0 31 46.0 32 55.0 33 75.0 34 117.0 35 330.0 36 2894.0 37 394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.175000000000004 12.475 8.55 36.8 2 25.576152304609217 13.451903807615231 32.364729458917836 28.607214428857713 3 22.15 19.45 25.75 32.65 4 27.85 25.25 20.150000000000002 26.75 5 25.374999999999996 29.099999999999998 23.724999999999998 21.8 6 23.45 31.374999999999996 22.95 22.225 7 18.224999999999998 23.400000000000002 37.95 20.424999999999997 8 22.325 23.275000000000002 26.075 28.325 9 20.825 20.625 31.724999999999998 26.825 10-14 23.49 25.665 24.47 26.375 15-19 23.580000000000002 25.15 25.19 26.08 20-24 24.240000000000002 24.77 25.230000000000004 25.759999999999998 25-29 23.595 25.369999999999997 24.5 26.534999999999997 30-34 24.154999999999998 25.330000000000002 24.72 25.795 35-39 24.490000000000002 24.705 24.175 26.63 40-44 23.98 24.93 24.45 26.640000000000004 45-49 24.03 24.865000000000002 24.87 26.235000000000003 50-54 24.605 24.875 24.654999999999998 25.865 55-59 24.55 25.0 24.385 26.064999999999998 60-64 24.035 24.94 24.38 26.645000000000003 65-69 24.505 24.605 24.195 26.695 70-74 24.115000000000002 25.069999999999997 24.779999999999998 26.035000000000004 75-79 24.104999999999997 24.48 24.4 27.015 80-84 24.325 24.275 24.709999999999997 26.69 85-89 24.395 24.12 25.2 26.284999999999997 90-94 24.15 24.135 24.83 26.884999999999998 95-99 24.92 23.51 24.675 26.895000000000003 100-104 24.725 24.26 24.665 26.35 105-109 25.06 24.255 24.305 26.38 110-114 24.8 24.060000000000002 24.065 27.075 115-119 24.485 23.46 24.905 27.150000000000002 120-124 24.560000000000002 23.97 24.785 26.685 125-129 24.935 24.3 24.415 26.35 130-134 25.305 24.41 23.7 26.584999999999997 135-139 24.495 24.279999999999998 24.5 26.724999999999998 140-144 25.045 23.775 24.474999999999998 26.705000000000002 145-149 25.295 23.995 23.825 26.884999999999998 150-151 24.425 24.625 24.45 26.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 2.0 29 4.0 30 6.0 31 6.5 32 9.5 33 16.0 34 23.0 35 30.5 36 43.0 37 57.0 38 67.5 39 93.0 40 109.0 41 126.0 42 146.0 43 162.5 44 183.5 45 185.0 46 177.0 47 178.5 48 191.5 49 176.0 50 156.5 51 158.5 52 149.0 53 120.5 54 114.5 55 114.5 56 99.5 57 86.0 58 80.5 59 89.0 60 82.5 61 61.5 62 62.0 63 66.5 64 61.5 65 64.0 66 59.0 67 55.0 68 53.0 69 49.0 70 44.0 71 38.5 72 31.0 73 25.0 74 24.0 75 18.0 76 10.0 77 10.5 78 9.5 79 5.5 80 3.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 92.7007299270073 85.725 2 6.596377399297107 12.2 3 0.5947553392808868 1.6500000000000001 4 0.08110300081103002 0.3 5 0.027034333603676672 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAGAAGTACACCTTTTTGCTAGCATCTCGCACGGCAAGAGCGATTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.11249999999999999 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 0.9875 0.0 0.0 0.0 0.0 128-129 1.075 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.5875 0.0 0.0 0.0 0.0 138-139 1.7625000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAGAG 10 0.006830828 145.0 145 >>END_MODULE SRR7804085 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804085_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.35975 37.0 37.0 37.0 37.0 37.0 2 36.1575 37.0 37.0 37.0 37.0 37.0 3 36.1395 37.0 37.0 37.0 37.0 37.0 4 36.3805 37.0 37.0 37.0 37.0 37.0 5 36.125 37.0 37.0 37.0 37.0 37.0 6 36.299 37.0 37.0 37.0 37.0 37.0 7 36.1965 37.0 37.0 37.0 37.0 37.0 8 36.379 37.0 37.0 37.0 37.0 37.0 9 36.132 37.0 37.0 37.0 37.0 37.0 10-14 36.26469999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.1654 37.0 37.0 37.0 37.0 37.0 20-24 36.178599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1879 37.0 37.0 37.0 37.0 37.0 30-34 36.1717 37.0 37.0 37.0 37.0 37.0 35-39 36.0946 37.0 37.0 37.0 37.0 37.0 40-44 36.0632 37.0 37.0 37.0 37.0 37.0 45-49 36.0028 37.0 37.0 37.0 37.0 37.0 50-54 35.9612 37.0 37.0 37.0 37.0 37.0 55-59 35.9784 37.0 37.0 37.0 37.0 37.0 60-64 35.9242 37.0 37.0 37.0 37.0 37.0 65-69 35.833299999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.894099999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.8464 37.0 37.0 37.0 37.0 37.0 80-84 35.8071 37.0 37.0 37.0 37.0 37.0 85-89 35.855599999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.7938 37.0 37.0 37.0 37.0 37.0 95-99 35.694700000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.755700000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.696000000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.5668 37.0 37.0 37.0 37.0 37.0 115-119 35.6296 37.0 37.0 37.0 37.0 37.0 120-124 35.5518 37.0 37.0 37.0 37.0 37.0 125-129 35.4542 37.0 37.0 37.0 37.0 37.0 130-134 35.5032 37.0 37.0 37.0 37.0 37.0 135-139 35.441199999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.364799999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.237700000000004 37.0 37.0 37.0 29.8 37.0 150-151 34.7475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 4.0 15 2.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 7.0 23 4.0 24 11.0 25 7.0 26 6.0 27 19.0 28 20.0 29 21.0 30 27.0 31 39.0 32 65.0 33 96.0 34 191.0 35 577.0 36 2694.0 37 202.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.109777444361086 18.579644911227806 10.252563140785197 32.05801450362591 2 28.925 22.875 26.275 21.925 3 24.025 24.6 26.150000000000002 25.224999999999998 4 26.05 30.8 18.875 24.275 5 27.975 31.724999999999998 17.599999999999998 22.7 6 22.7 36.275 17.549999999999997 23.474999999999998 7 23.375 18.3 33.475 24.85 8 25.1 22.25 21.05 31.6 9 23.225 22.1 26.025 28.65 10-14 26.650000000000002 24.635 21.775 26.939999999999998 15-19 26.19 24.585 23.185 26.040000000000003 20-24 26.290000000000003 24.66 23.105 25.945 25-29 26.215 24.575 22.84 26.369999999999997 30-34 26.284999999999997 24.47 22.975 26.27 35-39 25.474999999999998 24.98 22.54 27.005000000000003 40-44 26.790000000000003 24.5 23.09 25.619999999999997 45-49 27.32 24.315 22.32 26.045 50-54 26.634999999999998 24.945 22.6 25.82 55-59 26.505000000000003 24.72 22.71 26.064999999999998 60-64 26.865 24.055 22.955000000000002 26.125 65-69 26.669999999999998 24.45 23.035 25.845000000000002 70-74 26.974999999999998 24.035 23.31 25.679999999999996 75-79 26.43 24.834999999999997 22.919999999999998 25.814999999999998 80-84 26.650000000000002 24.85 22.965 25.535000000000004 85-89 26.985 24.795 22.465 25.755 90-94 27.215 24.740000000000002 22.86 25.185000000000002 95-99 26.474999999999998 24.745 23.305 25.474999999999998 100-104 27.24 24.64 22.78 25.34 105-109 27.095000000000002 24.59 23.11 25.205 110-114 27.250000000000004 24.375 23.56 24.815 115-119 27.339999999999996 24.535 22.6 25.525 120-124 27.1 24.38 23.205000000000002 25.314999999999998 125-129 27.33 24.765 23.025000000000002 24.88 130-134 27.05 24.21 23.855 24.884999999999998 135-139 27.105 24.675 23.41 24.81 140-144 27.105 25.05 23.235 24.610000000000003 145-149 27.115000000000002 24.515 23.11 25.259999999999998 150-151 27.3375 24.65 23.125 24.887500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 0.5 25 0.0 26 0.5 27 1.5 28 2.0 29 2.5 30 3.5 31 4.5 32 9.0 33 10.0 34 15.0 35 24.0 36 33.0 37 45.0 38 57.5 39 76.5 40 98.0 41 110.5 42 122.5 43 135.5 44 151.0 45 170.0 46 169.0 47 161.5 48 163.5 49 161.0 50 152.5 51 143.5 52 127.0 53 109.5 54 110.0 55 96.0 56 76.5 57 83.0 58 93.0 59 104.5 60 99.0 61 88.0 62 90.0 63 96.5 64 93.0 65 76.0 66 78.5 67 84.5 68 83.0 69 76.5 70 60.0 71 50.5 72 42.5 73 37.5 74 32.5 75 24.0 76 20.5 77 12.0 78 2.5 79 3.0 80 4.5 81 2.5 82 1.0 83 1.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.37242128121606 85.075 2 6.867535287730727 12.65 3 0.6514657980456027 1.7999999999999998 4 0.02714440825190011 0.1 5 0.08143322475570033 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGCGCTGACGAGCTGGCGCAATGACGACCTAATTGGCGCACAGTACTAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GGATCAGGTGCATGCAGGTGTGGCCAATTGAGGGCATCAAGAAGTTCGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.11249999999999999 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.3625 0.0 0.0 0.0 0.0 134-135 1.45 0.0 0.0 0.0 0.0 136-137 1.6375 0.0 0.0 0.0 0.0 138-139 1.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTACCA 10 0.006830828 145.0 7 GTTGTAT 10 0.006830828 145.0 1 >>END_MODULE Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra Read 2009567 spots for SRR7804085.sra Written 2009567 spots for SRR7804085.sra Read 2009558 spots for SRR7804085.sra Written 2009558 spots for SRR7804085.sra SRR ids: ['SRR7804085.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7uy2aqn4 SRR7804085.sra spots: 40191169 blocks: [[1, 2009558], [2009559, 4019116], [4019117, 6028674], [6028675, 8038232], [8038233, 10047790], [10047791, 12057348], [12057349, 14066906], [14066907, 16076464], [16076465, 18086022], [18086023, 20095580], [20095581, 22105138], [22105139, 24114696], [24114697, 26124254], [26124255, 28133812], [28133813, 30143370], [30143371, 32152928], [32152929, 34162486], [34162487, 36172044], [36172045, 38181602], [38181603, 40191169]] SRR7804085 file size 13597768 SRR7804085 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804085 SRR7804085_1.fastq SRR7804085_2.fastq Input file: SRR7804085_1.fastq Paired file: SRR7804085_2.fastq trimmed: SRR7804085-trimmed-pair1.fastq, SRR7804085-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:28:12 2024 >> started Sat Dec 7 16:29:09 2024 >> done (57.099s) 40191169 read pairs processed; of these: 122 ( 0.00%) short read pairs filtered out after trimming by size control 407 ( 0.00%) empty read pairs filtered out after trimming by size control 40190640 (100.00%) read pairs available; of these: 971742 ( 2.42%) trimmed read pairs available after processing 39218898 (97.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 16 0.00% 20 18 0.00% 21 16 0.00% 22 22 0.00% 23 19 0.00% 24 14 0.00% 25 16 0.00% 26 18 0.00% 27 13 0.00% 28 29 0.00% 29 23 0.00% 30 31 0.00% 31 34 0.00% 32 42 0.00% 33 31 0.00% 34 27 0.00% 35 41 0.00% 36 41 0.00% 37 33 0.00% 38 47 0.00% 39 35 0.00% 40 43 0.00% 41 33 0.00% 42 45 0.00% 43 39 0.00% 44 45 0.00% 45 46 0.00% 46 59 0.00% 47 49 0.00% 48 61 0.00% 49 52 0.00% 50 51 0.00% 51 64 0.00% 52 73 0.00% 53 74 0.00% 54 82 0.00% 55 66 0.00% 56 71 0.00% 57 68 0.00% 58 81 0.00% 59 66 0.00% 60 96 0.00% 61 93 0.00% 62 101 0.00% 63 93 0.00% 64 120 0.00% 65 118 0.00% 66 146 0.00% 67 132 0.00% 68 138 0.00% 69 136 0.00% 70 150 0.00% 71 192 0.00% 72 217 0.00% 73 247 0.00% 74 272 0.00% 75 291 0.00% 76 308 0.00% 77 353 0.00% 78 360 0.00% 79 438 0.00% 80 427 0.00% 81 496 0.00% 82 609 0.00% 83 718 0.00% 84 777 0.00% 85 830 0.00% 86 876 0.00% 87 999 0.00% 88 1098 0.00% 89 1258 0.00% 90 1389 0.00% 91 1543 0.00% 92 1734 0.00% 93 1972 0.00% 94 2102 0.01% 95 2185 0.01% 96 2501 0.01% 97 2788 0.01% 98 2888 0.01% 99 3136 0.01% 100 3376 0.01% 101 3631 0.01% 102 4159 0.01% 103 4442 0.01% 104 4824 0.01% 105 5171 0.01% 106 5473 0.01% 107 5746 0.01% 108 6099 0.02% 109 6352 0.02% 110 6851 0.02% 111 7443 0.02% 112 8031 0.02% 113 8443 0.02% 114 8992 0.02% 115 9751 0.02% 116 10183 0.03% 117 10505 0.03% 118 11269 0.03% 119 11433 0.03% 120 12004 0.03% 121 12795 0.03% 122 13648 0.03% 123 14457 0.04% 124 15517 0.04% 125 16137 0.04% 126 16830 0.04% 127 17500 0.04% 128 18090 0.05% 129 18924 0.05% 130 19106 0.05% 131 19948 0.05% 132 21457 0.05% 133 22643 0.06% 134 23856 0.06% 135 24931 0.06% 136 26053 0.06% 137 26771 0.07% 138 27157 0.07% 139 28766 0.07% 140 28855 0.07% 141 30354 0.08% 142 31895 0.08% 143 33266 0.08% 144 35240 0.09% 145 36503 0.09% 146 37969 0.09% 147 39476 0.10% 148 40295 0.10% 149 40640 0.10% 150 42415 0.11% 151 39218898 97.58% 40190640 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=23 prefix-density=0.80 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=194.85 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=11.9 sequence=AGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCAAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTCACTGGGTCGGACAGGTGGTCGGCCAGGTTCTCGAG criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=11 prefix-density=0.69 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=102.16 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804085 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:30:02 Started mapping on | Dec 07 16:30:02 Finished on | Dec 07 16:34:51 Mapping speed, Million of reads per hour | 500.64 Number of input reads | 40190640 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 37379370 Uniquely mapped reads % | 93.01% Average mapped length | 299.87 Number of splices: Total | 39718462 Number of splices: Annotated (sjdb) | 37481175 Number of splices: GT/AG | 39133920 Number of splices: GC/AG | 478612 Number of splices: AT/AC | 20507 Number of splices: Non-canonical | 85423 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 547975 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 42464 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.73% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2263295 2263295 2263295 N_multimapping 547975 547975 547975 N_noFeature 1096790 36343953 1338882 N_ambiguous 968431 6716 175771 UnstrandedReadsAssigned:35314149 PositiveStrandReadsAssigned:1028701 NegativeStrandReadsAssigned:35864717 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804085 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804085-trimmed-pair1.fastq SRR7804085-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,190,640 reads, 36,176,090 reads pseudoaligned [quant] estimated average fragment length: 306.262 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR7804085.ke.tsv 35125 SRR7804085.se.tsv 88098 total ==> SRR7804085.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 631.527 0 0 PNS24247 1044 738.738 126.12 6.15738 PNS24249 1928 1622.74 313.454 6.96672 PNS24246 1044 738.738 126.12 6.15738 PNS24248 1044 738.738 126.12 6.15738 PNS24244 1471 1165.74 151.187 4.67754 PNS24243 293 70.5337 0 0 KQK14069 1603 1297.74 1357.97 37.7404 KQK14071 474 198.832 18.2123 3.30355 ==> SRR7804085.se.tsv <== BRADI_1g14170v3 1451 BRADI_1g53295v3 1432 BRADI_1g59795v3 732 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 4085 BRADI_1g74790v3 642 BRADI_1g09890v3 7 BRADI_1g77505v3 699 BRADI_1g48960v3 0 SRR7804085 completed mapping pipeline successfully