Starting /dee2/code/volunteer_pipeline.sh SRR7804086 current disk space = 1541846044672 free memory = 1601319340 SRR7804086 SRAfilesize a6b3752bc90989c836ee31eb43cf6ad4 SRR7804086.sra SRR7804086.sra file validated SRR7804086 is paired end SRR7804086 is conventional basespace SRR7804086 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804086_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.13 37.0 37.0 37.0 37.0 37.0 2 36.32125 37.0 37.0 37.0 37.0 37.0 3 36.417 37.0 37.0 37.0 37.0 37.0 4 36.374 37.0 37.0 37.0 37.0 37.0 5 36.5305 37.0 37.0 37.0 37.0 37.0 6 36.469 37.0 37.0 37.0 37.0 37.0 7 36.4015 37.0 37.0 37.0 37.0 37.0 8 36.484 37.0 37.0 37.0 37.0 37.0 9 36.493 37.0 37.0 37.0 37.0 37.0 10-14 36.503699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.485699999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4861 37.0 37.0 37.0 37.0 37.0 25-29 36.39469999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.450399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.386900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.406000000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3226 37.0 37.0 37.0 37.0 37.0 50-54 36.356500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3082 37.0 37.0 37.0 37.0 37.0 60-64 36.359500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.268 37.0 37.0 37.0 37.0 37.0 70-74 36.2796 37.0 37.0 37.0 37.0 37.0 75-79 36.25 37.0 37.0 37.0 37.0 37.0 80-84 36.1999 37.0 37.0 37.0 37.0 37.0 85-89 36.1911 37.0 37.0 37.0 37.0 37.0 90-94 36.1447 37.0 37.0 37.0 37.0 37.0 95-99 36.1249 37.0 37.0 37.0 37.0 37.0 100-104 36.121 37.0 37.0 37.0 37.0 37.0 105-109 36.0833 37.0 37.0 37.0 37.0 37.0 110-114 36.0372 37.0 37.0 37.0 37.0 37.0 115-119 36.0282 37.0 37.0 37.0 37.0 37.0 120-124 35.9088 37.0 37.0 37.0 37.0 37.0 125-129 35.9209 37.0 37.0 37.0 37.0 37.0 130-134 35.827600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.8138 37.0 37.0 37.0 37.0 37.0 140-144 35.753499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.8017 37.0 37.0 37.0 37.0 37.0 150-151 35.2435 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 5.0 26 2.0 27 9.0 28 14.0 29 26.0 30 29.0 31 61.0 32 59.0 33 89.0 34 118.0 35 338.0 36 2801.0 37 448.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.45 10.875 8.125 37.55 2 26.494871153365025 13.58518889166875 28.821616212159118 31.098323742807104 3 22.475 16.275000000000002 22.775000000000002 38.475 4 28.000000000000004 20.325 22.1 29.575000000000003 5 27.05 24.5 23.0 25.45 6 26.075 29.4 20.925 23.599999999999998 7 20.95 22.975 34.75 21.325 8 21.975 22.95 26.5 28.575 9 22.725 20.375 32.2 24.7 10-14 24.975 24.32 24.310000000000002 26.395000000000003 15-19 25.130000000000003 24.315 23.845 26.71 20-24 24.67 23.41 25.319999999999997 26.6 25-29 25.545 23.425 23.935000000000002 27.095000000000002 30-34 24.79 23.745 24.05 27.415 35-39 24.965 23.835 24.195 27.005000000000003 40-44 24.82 24.060000000000002 23.674999999999997 27.445000000000004 45-49 25.36 23.150000000000002 24.16 27.33 50-54 25.580000000000002 22.88 24.705 26.834999999999997 55-59 24.89 23.98 24.0 27.13 60-64 25.34 23.23 24.25 27.18 65-69 26.085 22.97 23.895 27.05 70-74 26.025 24.015 23.435 26.525 75-79 25.085 22.97 24.4 27.544999999999998 80-84 25.545 23.345 24.14 26.97 85-89 25.590000000000003 23.285 23.665 27.46 90-94 26.26 23.375 23.745 26.619999999999997 95-99 25.779999999999998 23.14 23.535 27.544999999999998 100-104 26.105 23.135 23.815 26.945000000000004 105-109 26.545 22.81 23.549999999999997 27.095000000000002 110-114 26.055 23.11 23.57 27.265 115-119 25.72 23.1 23.419999999999998 27.76 120-124 26.575 23.115 23.125 27.185 125-129 26.384999999999998 23.080000000000002 23.255 27.279999999999998 130-134 26.495 22.66 23.465 27.38 135-139 26.340000000000003 22.735 22.85 28.075 140-144 26.355 22.56 23.765 27.32 145-149 26.369999999999997 22.475 23.990000000000002 27.165 150-151 26.1625 23.35 23.0 27.487499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 3.5 29 3.5 30 3.0 31 3.5 32 5.5 33 14.0 34 22.5 35 25.5 36 28.5 37 45.0 38 55.5 39 67.5 40 93.0 41 114.0 42 128.0 43 145.5 44 149.0 45 154.0 46 171.5 47 171.5 48 156.5 49 152.5 50 156.0 51 143.5 52 134.5 53 116.0 54 101.0 55 97.5 56 89.0 57 90.5 58 98.5 59 89.0 60 91.0 61 97.5 62 97.5 63 92.0 64 90.5 65 98.0 66 83.5 67 73.0 68 70.0 69 69.0 70 62.0 71 49.0 72 43.0 73 35.0 74 28.5 75 23.5 76 19.0 77 15.0 78 10.5 79 9.0 80 5.5 81 3.5 82 2.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.75 #Duplication Level Percentage of deduplicated Percentage of total 1 92.77628032345014 86.05000000000001 2 6.684636118598383 12.4 3 0.48517520215633425 1.35 4 0.05390835579514825 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.1375000000000002 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.5125000000000002 0.0 0.0 0.0 0.0 138-139 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGCTT 10 0.006830828 145.0 1 >>END_MODULE SRR7804086 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804086_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.35925 37.0 37.0 37.0 37.0 37.0 2 36.033 37.0 37.0 37.0 37.0 37.0 3 36.0745 37.0 37.0 37.0 37.0 37.0 4 36.224 37.0 37.0 37.0 37.0 37.0 5 36.0975 37.0 37.0 37.0 37.0 37.0 6 36.1325 37.0 37.0 37.0 37.0 37.0 7 36.0805 37.0 37.0 37.0 37.0 37.0 8 36.1785 37.0 37.0 37.0 37.0 37.0 9 36.051 37.0 37.0 37.0 37.0 37.0 10-14 36.13720000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.0861 37.0 37.0 37.0 37.0 37.0 20-24 36.0983 37.0 37.0 37.0 37.0 37.0 25-29 35.9892 37.0 37.0 37.0 37.0 37.0 30-34 35.9972 37.0 37.0 37.0 37.0 37.0 35-39 35.99 37.0 37.0 37.0 37.0 37.0 40-44 35.938900000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.849199999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.806200000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.779 37.0 37.0 37.0 37.0 37.0 60-64 35.826 37.0 37.0 37.0 37.0 37.0 65-69 35.7351 37.0 37.0 37.0 37.0 37.0 70-74 35.7679 37.0 37.0 37.0 37.0 37.0 75-79 35.7274 37.0 37.0 37.0 37.0 37.0 80-84 35.6713 37.0 37.0 37.0 37.0 37.0 85-89 35.702 37.0 37.0 37.0 37.0 37.0 90-94 35.670300000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.602999999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.6265 37.0 37.0 37.0 37.0 37.0 105-109 35.598 37.0 37.0 37.0 37.0 37.0 110-114 35.4218 37.0 37.0 37.0 37.0 37.0 115-119 35.418499999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.3811 37.0 37.0 37.0 37.0 37.0 125-129 35.378 37.0 37.0 37.0 34.6 37.0 130-134 35.3718 37.0 37.0 37.0 37.0 37.0 135-139 35.2213 37.0 37.0 37.0 29.8 37.0 140-144 35.2716 37.0 37.0 37.0 32.2 37.0 145-149 35.0818 37.0 37.0 37.0 25.0 37.0 150-151 34.533 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 5.0 15 6.0 16 2.0 17 2.0 18 1.0 19 4.0 20 4.0 21 3.0 22 5.0 23 10.0 24 7.0 25 8.0 26 15.0 27 13.0 28 17.0 29 26.0 30 39.0 31 45.0 32 62.0 33 112.0 34 209.0 35 547.0 36 2635.0 37 218.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.10952738184546 18.254563640910227 12.10302575643911 31.532883220805203 2 32.175 21.8 22.175 23.849999999999998 3 26.325 24.099999999999998 23.775 25.8 4 29.099999999999998 28.775000000000002 18.825 23.3 5 29.475 29.325000000000003 17.4 23.799999999999997 6 24.825 33.875 18.7 22.6 7 23.875 19.675 31.5 24.95 8 26.1 21.325 20.575 32.0 9 24.55 22.325 24.099999999999998 29.025000000000002 10-14 27.58 24.310000000000002 21.224999999999998 26.884999999999998 15-19 26.76 23.995 22.175 27.07 20-24 26.584999999999997 24.11 22.12 27.185 25-29 27.26 23.78 21.81 27.150000000000002 30-34 26.255 24.740000000000002 22.065 26.939999999999998 35-39 27.11 24.19 21.990000000000002 26.71 40-44 27.384999999999998 23.41 22.32 26.884999999999998 45-49 27.029999999999998 23.745 21.86 27.365000000000002 50-54 27.11 23.685000000000002 22.28 26.924999999999997 55-59 27.38 23.419999999999998 22.035 27.165 60-64 27.02 23.44 22.03 27.51 65-69 27.189999999999998 23.21 22.07 27.529999999999998 70-74 27.284999999999997 23.474999999999998 22.075 27.165 75-79 27.11 23.055 22.55 27.284999999999997 80-84 27.700000000000003 23.599999999999998 21.61 27.089999999999996 85-89 27.589999999999996 23.685000000000002 21.765 26.96 90-94 27.134999999999998 23.745 21.535 27.584999999999997 95-99 27.455000000000002 23.77 21.865000000000002 26.91 100-104 28.189999999999998 23.68 21.545 26.584999999999997 105-109 27.785 23.305 21.87 27.04 110-114 28.084999999999997 23.875 21.7 26.340000000000003 115-119 27.894999999999996 23.51 22.33 26.265 120-124 28.04 24.12 21.98 25.86 125-129 27.27 24.23 21.325 27.175 130-134 28.12 23.674999999999997 21.775 26.43 135-139 27.96 23.205000000000002 22.56 26.275 140-144 28.050000000000004 23.875 22.15 25.924999999999997 145-149 27.825 24.32 21.834999999999997 26.02 150-151 27.800000000000004 24.55 21.8625 25.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 1.5 24 0.0 25 1.0 26 1.5 27 0.5 28 2.0 29 4.0 30 2.5 31 2.5 32 6.0 33 8.0 34 11.0 35 16.5 36 24.5 37 29.5 38 36.5 39 53.0 40 69.5 41 96.0 42 121.5 43 140.0 44 140.5 45 145.5 46 159.5 47 152.0 48 141.5 49 130.5 50 121.0 51 116.5 52 108.5 53 99.0 54 112.5 55 124.5 56 104.0 57 94.5 58 104.5 59 102.0 60 109.5 61 121.5 62 119.0 63 108.0 64 98.5 65 92.5 66 80.0 67 79.5 68 77.5 69 74.5 70 78.0 71 76.5 72 71.0 73 59.0 74 42.5 75 27.5 76 19.5 77 17.5 78 15.5 79 10.5 80 6.5 81 6.5 82 5.5 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 1.0 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.36205490622453 84.95 2 6.740962217994021 12.4 3 0.7610763794509378 2.1 4 0.08154389779831477 0.3 5 0.05436259853220984 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit CCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.1375000000000002 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.475 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827558 spots for SRR7804086.sra Written 1827558 spots for SRR7804086.sra Read 1827561 spots for SRR7804086.sra Written 1827561 spots for SRR7804086.sra SRR ids: ['SRR7804086.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8elzn8va SRR7804086.sra spots: 36551163 blocks: [[1, 1827558], [1827559, 3655116], [3655117, 5482674], [5482675, 7310232], [7310233, 9137790], [9137791, 10965348], [10965349, 12792906], [12792907, 14620464], [14620465, 16448022], [16448023, 18275580], [18275581, 20103138], [20103139, 21930696], [21930697, 23758254], [23758255, 25585812], [25585813, 27413370], [27413371, 29240928], [29240929, 31068486], [31068487, 32896044], [32896045, 34723602], [34723603, 36551163]] SRR7804086 file size 12364289 SRR7804086 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804086 SRR7804086_1.fastq SRR7804086_2.fastq Input file: SRR7804086_1.fastq Paired file: SRR7804086_2.fastq trimmed: SRR7804086-trimmed-pair1.fastq, SRR7804086-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:27:22 2024 >> started Sat Dec 7 16:28:00 2024 >> done (37.574s) 36551163 read pairs processed; of these: 117 ( 0.00%) short read pairs filtered out after trimming by size control 1160 ( 0.00%) empty read pairs filtered out after trimming by size control 36549886 (100.00%) read pairs available; of these: 1099259 ( 3.01%) trimmed read pairs available after processing 35450627 (96.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 11 0.00% 20 15 0.00% 21 11 0.00% 22 18 0.00% 23 23 0.00% 24 24 0.00% 25 33 0.00% 26 29 0.00% 27 34 0.00% 28 35 0.00% 29 36 0.00% 30 42 0.00% 31 49 0.00% 32 42 0.00% 33 40 0.00% 34 44 0.00% 35 55 0.00% 36 44 0.00% 37 51 0.00% 38 72 0.00% 39 60 0.00% 40 51 0.00% 41 52 0.00% 42 77 0.00% 43 56 0.00% 44 58 0.00% 45 59 0.00% 46 86 0.00% 47 52 0.00% 48 62 0.00% 49 71 0.00% 50 62 0.00% 51 72 0.00% 52 84 0.00% 53 103 0.00% 54 83 0.00% 55 106 0.00% 56 85 0.00% 57 99 0.00% 58 99 0.00% 59 96 0.00% 60 103 0.00% 61 127 0.00% 62 108 0.00% 63 134 0.00% 64 142 0.00% 65 141 0.00% 66 142 0.00% 67 157 0.00% 68 185 0.00% 69 190 0.00% 70 203 0.00% 71 214 0.00% 72 243 0.00% 73 288 0.00% 74 328 0.00% 75 317 0.00% 76 382 0.00% 77 414 0.00% 78 481 0.00% 79 545 0.00% 80 595 0.00% 81 606 0.00% 82 778 0.00% 83 763 0.00% 84 903 0.00% 85 1029 0.00% 86 1179 0.00% 87 1358 0.00% 88 1450 0.00% 89 1627 0.00% 90 1667 0.00% 91 1939 0.01% 92 2164 0.01% 93 2353 0.01% 94 2552 0.01% 95 2865 0.01% 96 3079 0.01% 97 3190 0.01% 98 3394 0.01% 99 3976 0.01% 100 4244 0.01% 101 4550 0.01% 102 4554 0.01% 103 5194 0.01% 104 5485 0.02% 105 5932 0.02% 106 6408 0.02% 107 6812 0.02% 108 7210 0.02% 109 7570 0.02% 110 8209 0.02% 111 8688 0.02% 112 9141 0.03% 113 9842 0.03% 114 10286 0.03% 115 11052 0.03% 116 11550 0.03% 117 12245 0.03% 118 12748 0.03% 119 13369 0.04% 120 14123 0.04% 121 14701 0.04% 122 15391 0.04% 123 16452 0.05% 124 17380 0.05% 125 18230 0.05% 126 19182 0.05% 127 19891 0.05% 128 20545 0.06% 129 21572 0.06% 130 22564 0.06% 131 23199 0.06% 132 24424 0.07% 133 25467 0.07% 134 26747 0.07% 135 27667 0.08% 136 28956 0.08% 137 29771 0.08% 138 30913 0.08% 139 31932 0.09% 140 33222 0.09% 141 34219 0.09% 142 35850 0.10% 143 36986 0.10% 144 38558 0.11% 145 40388 0.11% 146 41277 0.11% 147 43131 0.12% 148 44191 0.12% 149 45824 0.13% 150 46807 0.13% 151 35450627 96.99% 36549886 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=24 prefix-density=0.69 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=18.16 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.4 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=24 prefix-density=0.74 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=78.99 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.6 sequence=CAACAACCACAAAGCAATTAAGCAAAAGCAATGGCCTCCCAGCTCTCCGCCATGGCCTCCGTGCCGCAGTTCCACGGCCTCCGGAGCTACTCGGCGCCGAGGTCATCCATGGCGATGCTGCCAACGCTTAGAGCGTCCAGGAAGAGGTCCCAGGGCATCCGGTGCGACTTCATCGGCTCCTCCACCAACCTCATCATGGTGACGACGACGA SRR7804086 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:29:06 Started mapping on | Dec 07 16:29:07 Finished on | Dec 07 16:33:22 Mapping speed, Million of reads per hour | 516.00 Number of input reads | 36549886 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 34198401 Uniquely mapped reads % | 93.57% Average mapped length | 299.68 Number of splices: Total | 34945631 Number of splices: Annotated (sjdb) | 33044834 Number of splices: GT/AG | 34428474 Number of splices: GC/AG | 431234 Number of splices: AT/AC | 11536 Number of splices: Non-canonical | 74387 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450731 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 24355 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.63% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1900754 1900754 1900754 N_multimapping 450731 450731 450731 N_noFeature 856553 33182228 1104545 N_ambiguous 938776 5314 171255 UnstrandedReadsAssigned:32403072 PositiveStrandReadsAssigned:1010859 NegativeStrandReadsAssigned:32922601 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804086 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804086-trimmed-pair1.fastq SRR7804086-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,549,886 reads, 33,080,750 reads pseudoaligned [quant] estimated average fragment length: 300.887 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR7804086.ke.tsv 35125 SRR7804086.se.tsv 88098 total ==> SRR7804086.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 636.731 0 0 PNS24247 1044 744.113 119.523 6.07815 PNS24249 1928 1628.11 176.644 4.10554 PNS24246 1044 744.113 119.523 6.07815 PNS24248 1044 744.113 119.523 6.07815 PNS24244 1471 1171.11 117.786 3.80586 PNS24243 293 73.9214 0 0 KQK14069 1603 1303.11 3522.54 102.289 KQK14071 474 200.368 118.83 22.4416 ==> SRR7804086.se.tsv <== BRADI_1g14170v3 4211 BRADI_1g53295v3 854 BRADI_1g59795v3 869 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 808 BRADI_1g74790v3 640 BRADI_1g09890v3 3 BRADI_1g77505v3 568 BRADI_1g48960v3 0 SRR7804086 completed mapping pipeline successfully