Starting /dee2/code/volunteer_pipeline.sh SRR7804087 current disk space = 1541754417152 free memory = 1464935616 SRR7804087 SRAfilesize 7a946a679288624b237d07e057709ffa SRR7804087.sra SRR7804087.sra file validated SRR7804087 is paired end SRR7804087 is conventional basespace SRR7804087 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804087_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.209 37.0 37.0 37.0 37.0 37.0 2 36.25075 37.0 37.0 37.0 37.0 37.0 3 36.3735 37.0 37.0 37.0 37.0 37.0 4 36.3905 37.0 37.0 37.0 37.0 37.0 5 36.467 37.0 37.0 37.0 37.0 37.0 6 36.419 37.0 37.0 37.0 37.0 37.0 7 36.444 37.0 37.0 37.0 37.0 37.0 8 36.4385 37.0 37.0 37.0 37.0 37.0 9 36.4945 37.0 37.0 37.0 37.0 37.0 10-14 36.513 37.0 37.0 37.0 37.0 37.0 15-19 36.51429999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.493199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4323 37.0 37.0 37.0 37.0 37.0 30-34 36.427499999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.452600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4171 37.0 37.0 37.0 37.0 37.0 45-49 36.38250000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.325399999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3851 37.0 37.0 37.0 37.0 37.0 60-64 36.369600000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3234 37.0 37.0 37.0 37.0 37.0 70-74 36.2516 37.0 37.0 37.0 37.0 37.0 75-79 36.2307 37.0 37.0 37.0 37.0 37.0 80-84 36.188399999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.171600000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.1757 37.0 37.0 37.0 37.0 37.0 95-99 36.119 37.0 37.0 37.0 37.0 37.0 100-104 36.1123 37.0 37.0 37.0 37.0 37.0 105-109 36.0581 37.0 37.0 37.0 37.0 37.0 110-114 36.0499 37.0 37.0 37.0 37.0 37.0 115-119 36.053399999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0125 37.0 37.0 37.0 37.0 37.0 125-129 35.9183 37.0 37.0 37.0 37.0 37.0 130-134 35.8867 37.0 37.0 37.0 37.0 37.0 135-139 35.919200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.789300000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.805099999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.316500000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 0.0 25 1.0 26 6.0 27 8.0 28 12.0 29 22.0 30 32.0 31 32.0 32 59.0 33 78.0 34 148.0 35 358.0 36 2877.0 37 365.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.875 11.35 8.625 35.15 2 26.157697121401753 12.640801001251564 31.714643304130163 29.486858573216523 3 22.525000000000002 16.975 26.075 34.425 4 26.650000000000002 23.75 21.025 28.575 5 26.650000000000002 28.125 22.8 22.425 6 23.5 30.975 22.85 22.675 7 18.525 24.0 36.85 20.625 8 21.625 24.875 27.175 26.325 9 21.75 21.175 31.6 25.474999999999998 10-14 23.41 25.85 25.124999999999996 25.615 15-19 24.29 24.15 24.92 26.640000000000004 20-24 24.135 24.54 24.92 26.405 25-29 23.93 25.245 24.54 26.284999999999997 30-34 24.14 25.27 24.935 25.655 35-39 23.62 24.59 25.06 26.729999999999997 40-44 24.395 24.09 24.995 26.52 45-49 24.01 24.349999999999998 24.695 26.945000000000004 50-54 24.65 24.33 24.82 26.200000000000003 55-59 25.105 24.36 24.2 26.334999999999997 60-64 24.46 24.165 24.41 26.965 65-69 24.51 24.560000000000002 24.654999999999998 26.275 70-74 24.959999999999997 24.445 24.195 26.400000000000002 75-79 24.5 24.310000000000002 24.29 26.900000000000002 80-84 24.490000000000002 24.16 24.279999999999998 27.07 85-89 24.315 24.435000000000002 24.925 26.325 90-94 24.84 24.26 24.759999999999998 26.14 95-99 24.73 24.04 24.825 26.405 100-104 24.88 23.445 24.81 26.865 105-109 23.9 24.3 24.725 27.075 110-114 24.959999999999997 23.945 23.724999999999998 27.37 115-119 24.44 23.875 24.46 27.224999999999998 120-124 25.19 23.265 24.675 26.87 125-129 24.955 23.735 24.575 26.735 130-134 25.39 23.65 24.365000000000002 26.595000000000002 135-139 25.15 24.295 23.669999999999998 26.884999999999998 140-144 25.85 23.695 24.035 26.419999999999998 145-149 24.79 24.025 24.03 27.155 150-151 24.6625 24.625 23.9 26.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 2.0 29 3.5 30 4.5 31 7.5 32 11.5 33 20.5 34 31.0 35 34.5 36 39.0 37 57.0 38 84.5 39 101.5 40 106.5 41 110.5 42 135.0 43 156.5 44 167.0 45 171.0 46 180.5 47 196.5 48 182.0 49 168.5 50 153.5 51 136.0 52 137.5 53 127.5 54 107.5 55 92.0 56 92.0 57 91.5 58 86.5 59 85.0 60 78.0 61 79.5 62 74.0 63 72.5 64 74.0 65 72.0 66 67.5 67 65.5 68 66.0 69 56.5 70 40.5 71 33.0 72 34.5 73 30.0 74 26.5 75 21.5 76 13.5 77 6.0 78 3.0 79 2.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.27798607391537 87.075 2 6.320299946438136 11.799999999999999 3 0.4017139796464917 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0125 96-97 0.075 0.0 0.0 0.0 0.025 98-99 0.075 0.0 0.0 0.0 0.025 100-101 0.075 0.0 0.0 0.0 0.025 102-103 0.1 0.0 0.0 0.0 0.025 104-105 0.175 0.0 0.0 0.0 0.025 106-107 0.21250000000000002 0.0 0.0 0.0 0.025 108-109 0.2625 0.0 0.0 0.0 0.025 110-111 0.2875 0.0 0.0 0.0 0.025 112-113 0.3375 0.0 0.0 0.0 0.025 114-115 0.3625 0.0 0.0 0.0 0.025 116-117 0.4 0.0 0.0 0.0 0.025 118-119 0.525 0.0 0.0 0.0 0.025 120-121 0.5625 0.0 0.0 0.0 0.025 122-123 0.65 0.0 0.0 0.0 0.025 124-125 0.7375 0.0 0.0 0.0 0.025 126-127 0.9375 0.0 0.0 0.0 0.025 128-129 1.1375 0.0 0.0 0.0 0.025 130-131 1.2999999999999998 0.0 0.0 0.0 0.025 132-133 1.4249999999999998 0.0 0.0 0.0 0.025 134-135 1.475 0.0 0.0 0.0 0.025 136-137 1.525 0.0 0.0 0.0 0.025 138-139 1.6375000000000002 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804087 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804087_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.27225 37.0 37.0 37.0 37.0 37.0 2 36.067 37.0 37.0 37.0 37.0 37.0 3 36.081 37.0 37.0 37.0 37.0 37.0 4 36.224 37.0 37.0 37.0 37.0 37.0 5 36.1715 37.0 37.0 37.0 37.0 37.0 6 36.168 37.0 37.0 37.0 37.0 37.0 7 36.0415 37.0 37.0 37.0 37.0 37.0 8 36.241 37.0 37.0 37.0 37.0 37.0 9 36.0745 37.0 37.0 37.0 37.0 37.0 10-14 36.1631 37.0 37.0 37.0 37.0 37.0 15-19 36.1183 37.0 37.0 37.0 37.0 37.0 20-24 36.0811 37.0 37.0 37.0 37.0 37.0 25-29 36.0577 37.0 37.0 37.0 37.0 37.0 30-34 36.0256 37.0 37.0 37.0 37.0 37.0 35-39 36.0226 37.0 37.0 37.0 37.0 37.0 40-44 35.9867 37.0 37.0 37.0 37.0 37.0 45-49 35.9692 37.0 37.0 37.0 37.0 37.0 50-54 35.907000000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.8514 37.0 37.0 37.0 37.0 37.0 60-64 35.871 37.0 37.0 37.0 37.0 37.0 65-69 35.7684 37.0 37.0 37.0 37.0 37.0 70-74 35.858000000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.7506 37.0 37.0 37.0 37.0 37.0 80-84 35.7423 37.0 37.0 37.0 37.0 37.0 85-89 35.7122 37.0 37.0 37.0 37.0 37.0 90-94 35.781600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.6856 37.0 37.0 37.0 37.0 37.0 100-104 35.71849999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.6646 37.0 37.0 37.0 37.0 37.0 110-114 35.49329999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.5354 37.0 37.0 37.0 37.0 37.0 120-124 35.453199999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.438 37.0 37.0 37.0 37.0 37.0 130-134 35.5235 37.0 37.0 37.0 37.0 37.0 135-139 35.327999999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.3891 37.0 37.0 37.0 37.0 37.0 145-149 35.1426 37.0 37.0 37.0 25.0 37.0 150-151 34.71825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 2.0 14 2.0 15 5.0 16 3.0 17 0.0 18 0.0 19 7.0 20 3.0 21 3.0 22 7.0 23 9.0 24 2.0 25 9.0 26 11.0 27 12.0 28 13.0 29 18.0 30 31.0 31 37.0 32 70.0 33 113.0 34 216.0 35 596.0 36 2593.0 37 235.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.58489622405602 19.4048512128032 10.002500625156289 31.007751937984494 2 32.425 21.8 25.474999999999998 20.3 3 23.1 24.975 26.674999999999997 25.25 4 27.325 30.099999999999998 19.1 23.474999999999998 5 28.525 32.2 17.575 21.7 6 24.925 35.099999999999994 17.8 22.175 7 22.375 19.625 32.025 25.974999999999998 8 25.45 22.675 22.125 29.75 9 23.375 22.400000000000002 26.650000000000002 27.575 10-14 26.66 24.975 21.97 26.395000000000003 15-19 27.025 24.25 23.25 25.474999999999998 20-24 26.575 24.805 22.855 25.765 25-29 27.27 24.445 22.42 25.865 30-34 26.790000000000003 24.305 23.665 25.240000000000002 35-39 26.755000000000003 24.36 23.315 25.569999999999997 40-44 27.169999999999998 24.715 22.5 25.615 45-49 26.44 24.7 23.085 25.775 50-54 26.83 24.635 23.169999999999998 25.365 55-59 27.27 24.39 22.715 25.624999999999996 60-64 27.11 24.404999999999998 22.86 25.624999999999996 65-69 26.96 24.099999999999998 23.265 25.674999999999997 70-74 26.55 24.315 23.305 25.83 75-79 26.8 24.19 23.5 25.509999999999998 80-84 27.33 24.11 22.95 25.61 85-89 26.91 24.325 22.57 26.195 90-94 26.61 23.655 23.615 26.119999999999997 95-99 27.04 24.03 23.244999999999997 25.685000000000002 100-104 27.589999999999996 23.805 23.03 25.575 105-109 26.484999999999996 24.355 23.59 25.569999999999997 110-114 27.185 24.445 22.775000000000002 25.595000000000002 115-119 27.165 24.38 23.055 25.4 120-124 27.065 25.240000000000002 22.95 24.745 125-129 26.790000000000003 24.825 22.84 25.545 130-134 27.595 24.865000000000002 22.655 24.884999999999998 135-139 27.29 24.51 23.235 24.965 140-144 27.33 24.21 23.275000000000002 25.185000000000002 145-149 27.515 24.845 22.919999999999998 24.72 150-151 27.750000000000004 25.7625 22.0875 24.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 2.5 14 2.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 0.5 24 0.0 25 0.5 26 0.5 27 2.5 28 4.0 29 2.5 30 2.5 31 5.0 32 7.0 33 10.5 34 14.0 35 19.5 36 32.0 37 42.0 38 51.5 39 74.5 40 96.5 41 107.0 42 130.0 43 140.5 44 150.0 45 166.5 46 169.5 47 162.0 48 152.5 49 151.5 50 151.0 51 142.5 52 123.5 53 113.0 54 112.5 55 115.5 56 100.5 57 82.0 58 95.0 59 100.5 60 97.0 61 88.0 62 88.0 63 104.0 64 102.0 65 95.0 66 84.0 67 60.5 68 63.0 69 75.0 70 71.5 71 60.5 72 42.5 73 35.0 74 27.5 75 19.5 76 15.0 77 9.0 78 3.0 79 3.0 80 2.0 81 0.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 1.0 94 1.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.1989247311828 86.675 2 6.263440860215054 11.65 3 0.456989247311828 1.275 4 0.026881720430107527 0.1 5 0.026881720430107527 0.125 6 0.0 0.0 7 0.026881720430107527 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.1125 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.45 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138-139 1.6124999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCGAT 10 0.006830828 145.0 1 GCCGATC 10 0.006830828 145.0 2 CCGATCG 10 0.006830828 145.0 3 >>END_MODULE Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623170 spots for SRR7804087.sra Written 1623170 spots for SRR7804087.sra Read 1623178 spots for SRR7804087.sra Written 1623178 spots for SRR7804087.sra SRR ids: ['SRR7804087.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tj4pg_fq SRR7804087.sra spots: 32463408 blocks: [[1, 1623170], [1623171, 3246340], [3246341, 4869510], [4869511, 6492680], [6492681, 8115850], [8115851, 9739020], [9739021, 11362190], [11362191, 12985360], [12985361, 14608530], [14608531, 16231700], [16231701, 17854870], [17854871, 19478040], [19478041, 21101210], [21101211, 22724380], [22724381, 24347550], [24347551, 25970720], [25970721, 27593890], [27593891, 29217060], [29217061, 30840230], [30840231, 32463408]] SRR7804087 file size 10979083 SRR7804087 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804087 SRR7804087_1.fastq SRR7804087_2.fastq Input file: SRR7804087_1.fastq Paired file: SRR7804087_2.fastq trimmed: SRR7804087-trimmed-pair1.fastq, SRR7804087-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:38:33 2024 >> started Sat Dec 7 16:39:13 2024 >> done (40.492s) 32463408 read pairs processed; of these: 132 ( 0.00%) short read pairs filtered out after trimming by size control 1286 ( 0.00%) empty read pairs filtered out after trimming by size control 32461990 (100.00%) read pairs available; of these: 953885 ( 2.94%) trimmed read pairs available after processing 31508105 (97.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 19 0.00% 20 10 0.00% 21 11 0.00% 22 18 0.00% 23 15 0.00% 24 20 0.00% 25 19 0.00% 26 32 0.00% 27 24 0.00% 28 29 0.00% 29 32 0.00% 30 26 0.00% 31 23 0.00% 32 43 0.00% 33 33 0.00% 34 29 0.00% 35 42 0.00% 36 36 0.00% 37 27 0.00% 38 49 0.00% 39 29 0.00% 40 46 0.00% 41 39 0.00% 42 42 0.00% 43 40 0.00% 44 51 0.00% 45 41 0.00% 46 51 0.00% 47 64 0.00% 48 42 0.00% 49 59 0.00% 50 63 0.00% 51 58 0.00% 52 79 0.00% 53 72 0.00% 54 63 0.00% 55 70 0.00% 56 65 0.00% 57 80 0.00% 58 79 0.00% 59 78 0.00% 60 83 0.00% 61 85 0.00% 62 102 0.00% 63 133 0.00% 64 104 0.00% 65 136 0.00% 66 123 0.00% 67 140 0.00% 68 151 0.00% 69 172 0.00% 70 170 0.00% 71 204 0.00% 72 213 0.00% 73 266 0.00% 74 318 0.00% 75 343 0.00% 76 362 0.00% 77 349 0.00% 78 459 0.00% 79 522 0.00% 80 573 0.00% 81 608 0.00% 82 713 0.00% 83 794 0.00% 84 890 0.00% 85 928 0.00% 86 1116 0.00% 87 1149 0.00% 88 1273 0.00% 89 1394 0.00% 90 1579 0.00% 91 1723 0.01% 92 1978 0.01% 93 2123 0.01% 94 2416 0.01% 95 2542 0.01% 96 2846 0.01% 97 3021 0.01% 98 3118 0.01% 99 3503 0.01% 100 3651 0.01% 101 4059 0.01% 102 4430 0.01% 103 4632 0.01% 104 4987 0.02% 105 5288 0.02% 106 5834 0.02% 107 6012 0.02% 108 6307 0.02% 109 6828 0.02% 110 7240 0.02% 111 7468 0.02% 112 8141 0.03% 113 8539 0.03% 114 9225 0.03% 115 9591 0.03% 116 10309 0.03% 117 10869 0.03% 118 11031 0.03% 119 11554 0.04% 120 12232 0.04% 121 12700 0.04% 122 13364 0.04% 123 14145 0.04% 124 15055 0.05% 125 15772 0.05% 126 16612 0.05% 127 17309 0.05% 128 18023 0.06% 129 18601 0.06% 130 19146 0.06% 131 20086 0.06% 132 21061 0.06% 133 22061 0.07% 134 22853 0.07% 135 24003 0.07% 136 24564 0.08% 137 25451 0.08% 138 26713 0.08% 139 28230 0.09% 140 28347 0.09% 141 29421 0.09% 142 30870 0.10% 143 31371 0.10% 144 33188 0.10% 145 34845 0.11% 146 35991 0.11% 147 37745 0.12% 148 38216 0.12% 149 39083 0.12% 150 40349 0.12% 151 31508105 97.06% 32461990 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=21 prefix-density=0.87 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=19.69 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.6 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=30 prefix-density=0.57 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=53.64 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=5.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804087 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:40:13 Started mapping on | Dec 07 16:40:13 Finished on | Dec 07 16:44:36 Mapping speed, Million of reads per hour | 444.35 Number of input reads | 32461990 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30414978 Uniquely mapped reads % | 93.69% Average mapped length | 299.67 Number of splices: Total | 32161392 Number of splices: Annotated (sjdb) | 30384509 Number of splices: GT/AG | 31682850 Number of splices: GC/AG | 397210 Number of splices: AT/AC | 11548 Number of splices: Non-canonical | 69784 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416983 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 22334 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.46% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1630029 1630029 1630029 N_multimapping 416983 416983 416983 N_noFeature 872913 29505721 1101304 N_ambiguous 825326 4816 145330 UnstrandedReadsAssigned:28716739 PositiveStrandReadsAssigned:904441 NegativeStrandReadsAssigned:29168344 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804087 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804087-trimmed-pair1.fastq SRR7804087-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,461,990 reads, 29,374,634 reads pseudoaligned [quant] estimated average fragment length: 306.969 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR7804087.ke.tsv 35125 SRR7804087.se.tsv 88098 total ==> SRR7804087.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 630.741 0 0 PNS24247 1044 738.031 132.998 7.97269 PNS24249 1928 1622.03 108.48 2.95887 PNS24246 1044 738.031 132.998 7.97269 PNS24248 1044 738.031 132.998 7.97269 PNS24244 1471 1165.03 161.525 6.13391 PNS24243 293 73.8894 0 0 KQK14069 1603 1297.03 2571.75 87.723 KQK14071 474 198.634 94.0207 20.9413 ==> SRR7804087.se.tsv <== BRADI_1g14170v3 3195 BRADI_1g53295v3 800 BRADI_1g59795v3 941 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 612 BRADI_1g74790v3 454 BRADI_1g09890v3 4 BRADI_1g77505v3 402 BRADI_1g48960v3 0 SRR7804087 completed mapping pipeline successfully