Starting /dee2/code/volunteer_pipeline.sh SRR7804088 current disk space = 1541710671872 free memory = 1414991080 SRR7804088 SRAfilesize e63c5429d60113f3aa45429644e373b2 SRR7804088.sra SRR7804088.sra file validated SRR7804088 is paired end SRR7804088 is conventional basespace SRR7804088 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804088_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.14 37.0 37.0 37.0 37.0 37.0 2 36.249 37.0 37.0 37.0 37.0 37.0 3 36.3485 37.0 37.0 37.0 37.0 37.0 4 36.451 37.0 37.0 37.0 37.0 37.0 5 36.5145 37.0 37.0 37.0 37.0 37.0 6 36.4695 37.0 37.0 37.0 37.0 37.0 7 36.3835 37.0 37.0 37.0 37.0 37.0 8 36.4955 37.0 37.0 37.0 37.0 37.0 9 36.3955 37.0 37.0 37.0 37.0 37.0 10-14 36.4757 37.0 37.0 37.0 37.0 37.0 15-19 36.452200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.3916 37.0 37.0 37.0 37.0 37.0 25-29 36.3824 37.0 37.0 37.0 37.0 37.0 30-34 36.3754 37.0 37.0 37.0 37.0 37.0 35-39 36.358599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.375899999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.362 37.0 37.0 37.0 37.0 37.0 50-54 36.3438 37.0 37.0 37.0 37.0 37.0 55-59 36.3217 37.0 37.0 37.0 37.0 37.0 60-64 36.349399999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.23479999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.211200000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.204600000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.159000000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.1237 37.0 37.0 37.0 37.0 37.0 90-94 36.1444 37.0 37.0 37.0 37.0 37.0 95-99 36.0559 37.0 37.0 37.0 37.0 37.0 100-104 36.0954 37.0 37.0 37.0 37.0 37.0 105-109 36.0145 37.0 37.0 37.0 37.0 37.0 110-114 35.9928 37.0 37.0 37.0 37.0 37.0 115-119 36.0017 37.0 37.0 37.0 37.0 37.0 120-124 35.9581 37.0 37.0 37.0 37.0 37.0 125-129 35.8233 37.0 37.0 37.0 37.0 37.0 130-134 35.8427 37.0 37.0 37.0 37.0 37.0 135-139 35.811699999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.71079999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.73729999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.1685 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 1.0 26 10.0 27 8.0 28 12.0 29 31.0 30 46.0 31 37.0 32 62.0 33 76.0 34 131.0 35 336.0 36 2899.0 37 349.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.15 11.425 9.275 35.15 2 27.01350675337669 12.8064032016008 30.740370185092548 29.439719859929962 3 22.75 17.474999999999998 24.55 35.225 4 25.724999999999998 23.9 22.1 28.275 5 28.425 26.375 21.575 23.625 6 25.3 30.599999999999998 21.775 22.325 7 18.275 24.4 37.375 19.950000000000003 8 22.125 23.549999999999997 27.925 26.400000000000002 9 21.65 20.65 30.2 27.500000000000004 10-14 23.785 25.355 24.779999999999998 26.08 15-19 23.825 24.415 25.009999999999998 26.75 20-24 24.205 24.315 24.8 26.68 25-29 24.565 24.529999999999998 24.345 26.56 30-34 24.195 24.560000000000002 25.0 26.245 35-39 24.19 25.105 24.36 26.345000000000002 40-44 24.295 24.685000000000002 24.745 26.275 45-49 25.095 24.169999999999998 24.645 26.090000000000003 50-54 23.685000000000002 24.865000000000002 24.63 26.82 55-59 24.07 23.905 25.06 26.965 60-64 24.715 24.815 24.185000000000002 26.284999999999997 65-69 24.7 24.375 24.779999999999998 26.145000000000003 70-74 24.48 24.04 24.615000000000002 26.865 75-79 24.865000000000002 24.395 23.635 27.105 80-84 24.645 24.48 23.965 26.91 85-89 24.735 24.165 24.455 26.645000000000003 90-94 24.8 24.605 23.9 26.695 95-99 24.775 24.37 24.355 26.5 100-104 24.745 24.154999999999998 24.13 26.97 105-109 25.09 23.990000000000002 24.33 26.590000000000003 110-114 25.35 23.605 24.69 26.355 115-119 25.945 24.37 23.84 25.845000000000002 120-124 25.014999999999997 23.97 24.355 26.66 125-129 25.014999999999997 24.085 24.575 26.325 130-134 25.215 24.44 24.07 26.275 135-139 25.205 23.95 23.84 27.005000000000003 140-144 25.285000000000004 23.695 23.97 27.05 145-149 25.380000000000003 23.915 24.305 26.400000000000002 150-151 25.2 23.849999999999998 24.55 26.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.0 27 1.0 28 3.5 29 5.0 30 4.0 31 6.5 32 13.0 33 15.0 34 19.0 35 25.5 36 35.5 37 53.5 38 67.0 39 83.0 40 103.0 41 126.0 42 143.5 43 146.5 44 167.5 45 188.5 46 194.5 47 194.5 48 177.0 49 162.5 50 156.0 51 139.5 52 120.5 53 119.0 54 112.5 55 99.0 56 98.0 57 92.5 58 88.5 59 89.5 60 88.5 61 85.0 62 84.0 63 77.0 64 71.5 65 75.0 66 67.5 67 62.5 68 65.5 69 57.0 70 46.5 71 38.5 72 31.0 73 26.0 74 17.5 75 17.0 76 14.5 77 9.0 78 7.5 79 3.0 80 1.5 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.18789808917197 88.725 2 5.520169851380043 10.4 3 0.23885350318471338 0.675 4 0.05307855626326964 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.38749999999999996 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.9125000000000001 0.0 0.0 0.0 0.0 134-135 1.0125 0.0 0.0 0.0 0.0 136-137 1.225 0.0 0.0 0.0 0.0 138-139 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804088 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804088_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.242 37.0 37.0 37.0 37.0 37.0 2 36.035 37.0 37.0 37.0 37.0 37.0 3 35.9655 37.0 37.0 37.0 37.0 37.0 4 36.1815 37.0 37.0 37.0 37.0 37.0 5 36.2415 37.0 37.0 37.0 37.0 37.0 6 36.255 37.0 37.0 37.0 37.0 37.0 7 36.133 37.0 37.0 37.0 37.0 37.0 8 36.234 37.0 37.0 37.0 37.0 37.0 9 36.044 37.0 37.0 37.0 37.0 37.0 10-14 36.17040000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.0546 37.0 37.0 37.0 37.0 37.0 20-24 36.061099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.037099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.048 37.0 37.0 37.0 37.0 37.0 35-39 36.0028 37.0 37.0 37.0 37.0 37.0 40-44 35.9445 37.0 37.0 37.0 37.0 37.0 45-49 35.94179999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.8478 37.0 37.0 37.0 37.0 37.0 55-59 35.7933 37.0 37.0 37.0 37.0 37.0 60-64 35.834 37.0 37.0 37.0 37.0 37.0 65-69 35.789100000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.723699999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.71300000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.680099999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.7208 37.0 37.0 37.0 37.0 37.0 90-94 35.673 37.0 37.0 37.0 37.0 37.0 95-99 35.584999999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.6725 37.0 37.0 37.0 37.0 37.0 105-109 35.5116 37.0 37.0 37.0 37.0 37.0 110-114 35.419500000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.431 37.0 37.0 37.0 37.0 37.0 120-124 35.389799999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.3554 37.0 37.0 37.0 37.0 37.0 130-134 35.4097 37.0 37.0 37.0 37.0 37.0 135-139 35.3 37.0 37.0 37.0 37.0 37.0 140-144 35.2512 37.0 37.0 37.0 32.2 37.0 145-149 35.033500000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.60525 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 6.0 15 2.0 16 1.0 17 3.0 18 0.0 19 3.0 20 6.0 21 5.0 22 4.0 23 3.0 24 6.0 25 10.0 26 12.0 27 9.0 28 23.0 29 31.0 30 36.0 31 52.0 32 51.0 33 104.0 34 220.0 35 596.0 36 2620.0 37 191.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.925 18.35 11.75 30.975 2 30.9 21.925 24.224999999999998 22.95 3 25.05 24.6 26.825 23.525 4 27.3 29.725 19.6 23.375 5 28.999999999999996 30.675 18.925 21.4 6 24.925 33.975 18.099999999999998 23.0 7 23.45 19.0 32.35 25.2 8 25.6 23.1 21.9 29.4 9 24.224999999999998 23.375 25.624999999999996 26.775 10-14 26.565 25.064999999999998 21.905 26.465 15-19 26.590000000000003 24.18 22.919999999999998 26.31 20-24 26.700000000000003 24.709999999999997 22.475 26.115 25-29 26.71 24.125 23.03 26.135 30-34 25.919999999999998 24.75 23.105 26.224999999999998 35-39 26.419999999999998 24.73 23.24 25.61 40-44 26.740000000000002 24.29 23.155 25.814999999999998 45-49 26.590000000000003 24.67 22.825 25.915 50-54 26.634999999999998 24.86 22.64 25.865 55-59 26.77 24.235 22.54 26.455000000000002 60-64 26.8 23.9 23.36 25.94 65-69 26.640000000000004 24.385 22.93 26.045 70-74 27.075 23.75 23.41 25.765 75-79 27.029999999999998 24.235 23.005 25.729999999999997 80-84 27.305 24.37 22.98 25.345000000000002 85-89 27.305 24.060000000000002 22.439999999999998 26.195 90-94 27.075 24.205 22.875 25.845000000000002 95-99 27.195000000000004 24.5 22.439999999999998 25.865 100-104 27.05 24.099999999999998 22.919999999999998 25.929999999999996 105-109 26.784999999999997 24.18 22.935 26.1 110-114 27.0 24.375 22.97 25.655 115-119 26.939999999999998 24.38 22.715 25.965 120-124 27.295 24.07 22.61 26.025 125-129 27.310000000000002 24.044999999999998 23.05 25.595000000000002 130-134 26.6 23.645 23.32 26.435 135-139 26.745 24.75 23.315 25.19 140-144 26.82 25.105 22.58 25.495 145-149 26.63 24.525 23.7 25.145 150-151 26.575 25.5375 22.7375 25.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 1.5 26 1.0 27 1.0 28 1.5 29 2.5 30 4.0 31 6.5 32 5.0 33 6.5 34 14.0 35 23.5 36 34.5 37 43.5 38 47.5 39 60.0 40 89.5 41 108.0 42 122.5 43 141.5 44 146.0 45 156.5 46 177.0 47 178.5 48 150.5 49 156.0 50 162.5 51 133.5 52 125.0 53 110.0 54 101.0 55 103.0 56 93.0 57 95.5 58 92.5 59 91.5 60 100.0 61 92.0 62 103.5 63 106.0 64 90.5 65 93.5 66 79.0 67 76.0 68 87.5 69 79.0 70 67.5 71 55.0 72 44.0 73 38.5 74 32.0 75 19.0 76 13.0 77 10.0 78 5.0 79 2.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 1.0 89 1.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.15220293724967 88.14999999999999 2 5.367156208277703 10.05 3 0.32042723631508674 0.8999999999999999 4 0.0534045393858478 0.2 5 0.0267022696929239 0.125 6 0.0267022696929239 0.15 7 0.0267022696929239 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0267022696929239 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 10 0.25 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.025 112-113 0.3 0.0 0.0 0.0 0.025 114-115 0.325 0.0 0.0 0.0 0.025 116-117 0.38749999999999996 0.0 0.0 0.0 0.025 118-119 0.475 0.0 0.0 0.0 0.025 120-121 0.5 0.0 0.0 0.0 0.025 122-123 0.525 0.0 0.0 0.0 0.025 124-125 0.6375 0.0 0.0 0.0 0.025 126-127 0.7 0.0 0.0 0.0 0.025 128-129 0.7375 0.0 0.0 0.0 0.025 130-131 0.8375 0.0 0.0 0.0 0.025 132-133 0.9375 0.0 0.0 0.0 0.025 134-135 1.0375 0.0 0.0 0.0 0.025 136-137 1.25 0.0 0.0 0.0 0.025 138-139 1.3125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542424 spots for SRR7804088.sra Written 1542424 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra Read 1542417 spots for SRR7804088.sra Written 1542417 spots for SRR7804088.sra SRR ids: ['SRR7804088.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kpgcilt8 SRR7804088.sra spots: 30848347 blocks: [[1, 1542417], [1542418, 3084834], [3084835, 4627251], [4627252, 6169668], [6169669, 7712085], [7712086, 9254502], [9254503, 10796919], [10796920, 12339336], [12339337, 13881753], [13881754, 15424170], [15424171, 16966587], [16966588, 18509004], [18509005, 20051421], [20051422, 21593838], [21593839, 23136255], [23136256, 24678672], [24678673, 26221089], [26221090, 27763506], [27763507, 29305923], [29305924, 30848347]] SRR7804088 file size 10431792 SRR7804088 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804088 SRR7804088_1.fastq SRR7804088_2.fastq Input file: SRR7804088_1.fastq Paired file: SRR7804088_2.fastq trimmed: SRR7804088-trimmed-pair1.fastq, SRR7804088-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:44:45 2024 >> started Sat Dec 7 16:45:24 2024 >> done (38.253s) 30848347 read pairs processed; of these: 124 ( 0.00%) short read pairs filtered out after trimming by size control 904 ( 0.00%) empty read pairs filtered out after trimming by size control 30847319 (100.00%) read pairs available; of these: 834782 ( 2.71%) trimmed read pairs available after processing 30012537 (97.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 11 0.00% 20 13 0.00% 21 12 0.00% 22 25 0.00% 23 21 0.00% 24 14 0.00% 25 19 0.00% 26 17 0.00% 27 20 0.00% 28 24 0.00% 29 24 0.00% 30 26 0.00% 31 25 0.00% 32 29 0.00% 33 32 0.00% 34 28 0.00% 35 41 0.00% 36 33 0.00% 37 30 0.00% 38 41 0.00% 39 42 0.00% 40 46 0.00% 41 18 0.00% 42 49 0.00% 43 48 0.00% 44 39 0.00% 45 50 0.00% 46 56 0.00% 47 50 0.00% 48 47 0.00% 49 45 0.00% 50 56 0.00% 51 49 0.00% 52 49 0.00% 53 56 0.00% 54 56 0.00% 55 75 0.00% 56 80 0.00% 57 64 0.00% 58 62 0.00% 59 73 0.00% 60 76 0.00% 61 82 0.00% 62 101 0.00% 63 96 0.00% 64 107 0.00% 65 87 0.00% 66 107 0.00% 67 106 0.00% 68 120 0.00% 69 136 0.00% 70 166 0.00% 71 161 0.00% 72 181 0.00% 73 233 0.00% 74 249 0.00% 75 255 0.00% 76 287 0.00% 77 341 0.00% 78 326 0.00% 79 349 0.00% 80 468 0.00% 81 506 0.00% 82 604 0.00% 83 641 0.00% 84 736 0.00% 85 840 0.00% 86 941 0.00% 87 985 0.00% 88 1002 0.00% 89 1149 0.00% 90 1284 0.00% 91 1448 0.00% 92 1581 0.01% 93 1745 0.01% 94 1967 0.01% 95 2194 0.01% 96 2274 0.01% 97 2439 0.01% 98 2781 0.01% 99 2990 0.01% 100 3027 0.01% 101 3324 0.01% 102 3637 0.01% 103 3879 0.01% 104 4172 0.01% 105 4462 0.01% 106 4746 0.02% 107 5028 0.02% 108 5340 0.02% 109 5723 0.02% 110 6056 0.02% 111 6389 0.02% 112 6859 0.02% 113 7377 0.02% 114 7993 0.03% 115 8258 0.03% 116 8589 0.03% 117 8734 0.03% 118 9429 0.03% 119 9777 0.03% 120 10316 0.03% 121 11125 0.04% 122 11504 0.04% 123 12136 0.04% 124 13283 0.04% 125 13555 0.04% 126 14392 0.05% 127 15044 0.05% 128 15526 0.05% 129 15918 0.05% 130 16856 0.05% 131 17555 0.06% 132 18290 0.06% 133 19272 0.06% 134 20248 0.07% 135 21184 0.07% 136 21897 0.07% 137 22622 0.07% 138 23514 0.08% 139 24327 0.08% 140 25068 0.08% 141 25819 0.08% 142 27286 0.09% 143 28555 0.09% 144 29692 0.10% 145 30956 0.10% 146 32213 0.10% 147 34213 0.11% 148 34000 0.11% 149 35407 0.11% 150 36465 0.12% 151 30012537 97.29% 30847319 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=17 prefix-density=0.84 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=21.69 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.5 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGCGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=16 prefix-density=0.57 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=93.11 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.2 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804088 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:49:30 Started mapping on | Dec 07 16:49:30 Finished on | Dec 07 16:54:43 Mapping speed, Million of reads per hour | 354.79 Number of input reads | 30847319 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 28081777 Uniquely mapped reads % | 91.03% Average mapped length | 291.99 Number of splices: Total | 29654707 Number of splices: Annotated (sjdb) | 28022956 Number of splices: GT/AG | 29210968 Number of splices: GC/AG | 369156 Number of splices: AT/AC | 10059 Number of splices: Non-canonical | 64524 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366065 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 27693 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.29% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2399477 2399477 2399477 N_multimapping 366065 366065 366065 N_noFeature 776838 27246971 974650 N_ambiguous 778412 4624 142579 UnstrandedReadsAssigned:26526527 PositiveStrandReadsAssigned:830182 NegativeStrandReadsAssigned:26964548 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804088 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804088-trimmed-pair1.fastq SRR7804088-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,847,319 reads, 27,852,993 reads pseudoaligned [quant] estimated average fragment length: 298.944 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 SRR7804088.ke.tsv 35125 SRR7804088.se.tsv 88098 total ==> SRR7804088.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 638.606 0 0 PNS24247 1044 746.056 147.689 9.40173 PNS24249 1928 1630.06 91.3253 2.66085 PNS24246 1044 746.056 147.689 9.40173 PNS24248 1044 746.056 147.689 9.40173 PNS24244 1471 1173.06 182.608 7.39321 PNS24243 293 77.5692 1 0.612269 KQK14069 1603 1305.06 2216.12 80.6484 KQK14071 474 205.557 90.8897 20.9997 ==> SRR7804088.se.tsv <== BRADI_1g14170v3 2505 BRADI_1g53295v3 806 BRADI_1g59795v3 851 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 528 BRADI_1g74790v3 526 BRADI_1g09890v3 0 BRADI_1g77505v3 371 BRADI_1g48960v3 0 SRR7804088 completed mapping pipeline successfully