Starting /dee2/code/volunteer_pipeline.sh SRR7804089 current disk space = 1523380568064 free memory = 1568074880 SRR7804089 SRAfilesize 828132e8bac20ce138b11e82d649d59f SRR7804089.sra SRR7804089.sra file validated SRR7804089 is paired end SRR7804089 is conventional basespace SRR7804089 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804089_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.21 37.0 37.0 37.0 37.0 37.0 2 36.30675 37.0 37.0 37.0 37.0 37.0 3 36.4345 37.0 37.0 37.0 37.0 37.0 4 36.53 37.0 37.0 37.0 37.0 37.0 5 36.554 37.0 37.0 37.0 37.0 37.0 6 36.481 37.0 37.0 37.0 37.0 37.0 7 36.503 37.0 37.0 37.0 37.0 37.0 8 36.478 37.0 37.0 37.0 37.0 37.0 9 36.53 37.0 37.0 37.0 37.0 37.0 10-14 36.552299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.523399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4938 37.0 37.0 37.0 37.0 37.0 25-29 36.4608 37.0 37.0 37.0 37.0 37.0 30-34 36.4494 37.0 37.0 37.0 37.0 37.0 35-39 36.4118 37.0 37.0 37.0 37.0 37.0 40-44 36.4148 37.0 37.0 37.0 37.0 37.0 45-49 36.393 37.0 37.0 37.0 37.0 37.0 50-54 36.3701 37.0 37.0 37.0 37.0 37.0 55-59 36.39190000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.376999999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3119 37.0 37.0 37.0 37.0 37.0 70-74 36.250899999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.2729 37.0 37.0 37.0 37.0 37.0 80-84 36.2666 37.0 37.0 37.0 37.0 37.0 85-89 36.2139 37.0 37.0 37.0 37.0 37.0 90-94 36.1769 37.0 37.0 37.0 37.0 37.0 95-99 36.1607 37.0 37.0 37.0 37.0 37.0 100-104 36.12329999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.116200000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.111399999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.042500000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0515 37.0 37.0 37.0 37.0 37.0 125-129 35.9015 37.0 37.0 37.0 37.0 37.0 130-134 35.8934 37.0 37.0 37.0 37.0 37.0 135-139 35.908100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.878 37.0 37.0 37.0 37.0 37.0 145-149 35.801199999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.4115 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 5.0 26 5.0 27 9.0 28 9.0 29 23.0 30 27.0 31 40.0 32 52.0 33 81.0 34 129.0 35 315.0 36 2839.0 37 461.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.7 11.700000000000001 8.525 33.074999999999996 2 26.720040030022517 13.485113835376533 30.222667000250187 29.572179134350762 3 23.474999999999998 16.625 22.55 37.35 4 26.200000000000003 22.575 21.425 29.799999999999997 5 26.650000000000002 25.924999999999997 23.325000000000003 24.099999999999998 6 25.825 27.05 22.650000000000002 24.474999999999998 7 21.325 23.5 34.775 20.4 8 23.200000000000003 22.8 27.625 26.375 9 20.275000000000002 21.0 33.0 25.724999999999998 10-14 24.495 24.755 24.099999999999998 26.650000000000002 15-19 24.575 23.799999999999997 24.79 26.834999999999997 20-24 24.795 24.2 24.385 26.619999999999997 25-29 25.135 24.135 24.26 26.47 30-34 25.105 24.095 24.2 26.6 35-39 24.77 24.115000000000002 24.33 26.784999999999997 40-44 25.205 24.025 23.64 27.13 45-49 25.380000000000003 24.135 23.625 26.86 50-54 24.82 23.77 24.395 27.015 55-59 25.505 24.205 23.51 26.779999999999998 60-64 25.025 24.41 23.9 26.665 65-69 25.06 24.005000000000003 23.505000000000003 27.43 70-74 25.16 23.78 23.61 27.450000000000003 75-79 25.03 23.095 24.385 27.49 80-84 25.44 23.76 24.43 26.369999999999997 85-89 25.47 23.705000000000002 23.595 27.229999999999997 90-94 25.974999999999998 23.189999999999998 23.54 27.295 95-99 25.22 23.525 24.465 26.790000000000003 100-104 26.3 23.255 23.715 26.729999999999997 105-109 25.47 23.580000000000002 23.880000000000003 27.07 110-114 25.795 22.725 24.015 27.465 115-119 25.19 23.71 23.49 27.61 120-124 25.645 23.085 23.98 27.29 125-129 25.575 22.58 23.95 27.894999999999996 130-134 26.040000000000003 23.03 23.494999999999997 27.435 135-139 25.865 22.84 24.135 27.16 140-144 25.71 23.385 23.945 26.96 145-149 26.095000000000002 23.29 23.44 27.175 150-151 25.662499999999998 23.0375 23.5125 27.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 2.0 28 3.0 29 3.5 30 5.0 31 8.0 32 17.0 33 19.0 34 19.0 35 28.0 36 32.5 37 48.0 38 68.0 39 73.5 40 76.0 41 103.0 42 132.5 43 143.5 44 146.5 45 141.0 46 152.5 47 168.5 48 160.5 49 152.0 50 151.0 51 154.5 52 142.5 53 123.5 54 112.0 55 99.0 56 100.0 57 104.5 58 105.0 59 99.5 60 94.0 61 101.0 62 100.0 63 90.0 64 87.5 65 90.0 66 80.5 67 69.5 68 68.0 69 57.0 70 53.5 71 53.0 72 43.5 73 29.5 74 23.0 75 18.0 76 12.5 77 11.0 78 8.0 79 6.0 80 3.5 81 2.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.55146262188516 85.425 2 6.6359696641386785 12.25 3 0.7313109425785482 2.025 4 0.08125677139761647 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.11249999999999999 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.6000000000000001 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 1.0125 0.0 0.0 0.0 0.0 126-127 1.1124999999999998 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.45 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.7625000000000002 0.0 0.0 0.0 0.0 136-137 1.8625 0.0 0.0 0.0 0.0 138-139 2.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGGATC 10 0.006830828 145.0 2 GTGCACG 10 0.006830828 145.0 6 CAAGGGG 10 0.006830828 145.0 5 TGTGCAC 10 0.006830828 145.0 5 >>END_MODULE SRR7804089 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804089_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3675 37.0 37.0 37.0 37.0 37.0 2 36.0825 37.0 37.0 37.0 37.0 37.0 3 36.119 37.0 37.0 37.0 37.0 37.0 4 36.3085 37.0 37.0 37.0 37.0 37.0 5 36.159 37.0 37.0 37.0 37.0 37.0 6 36.201 37.0 37.0 37.0 37.0 37.0 7 36.137 37.0 37.0 37.0 37.0 37.0 8 36.2535 37.0 37.0 37.0 37.0 37.0 9 36.2245 37.0 37.0 37.0 37.0 37.0 10-14 36.2573 37.0 37.0 37.0 37.0 37.0 15-19 36.1817 37.0 37.0 37.0 37.0 37.0 20-24 36.1918 37.0 37.0 37.0 37.0 37.0 25-29 36.2096 37.0 37.0 37.0 37.0 37.0 30-34 36.090999999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.081 37.0 37.0 37.0 37.0 37.0 40-44 36.0161 37.0 37.0 37.0 37.0 37.0 45-49 35.945 37.0 37.0 37.0 37.0 37.0 50-54 35.958400000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.9003 37.0 37.0 37.0 37.0 37.0 60-64 35.900400000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.790499999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.8377 37.0 37.0 37.0 37.0 37.0 75-79 35.7801 37.0 37.0 37.0 37.0 37.0 80-84 35.789300000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.7889 37.0 37.0 37.0 37.0 37.0 90-94 35.7562 37.0 37.0 37.0 37.0 37.0 95-99 35.6542 37.0 37.0 37.0 37.0 37.0 100-104 35.69590000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.6243 37.0 37.0 37.0 37.0 37.0 110-114 35.5523 37.0 37.0 37.0 37.0 37.0 115-119 35.5156 37.0 37.0 37.0 37.0 37.0 120-124 35.463800000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.36129999999999 37.0 37.0 37.0 34.6 37.0 130-134 35.460300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.3013 37.0 37.0 37.0 34.6 37.0 140-144 35.33240000000001 37.0 37.0 37.0 34.6 37.0 145-149 35.1071 37.0 37.0 37.0 25.0 37.0 150-151 34.60625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 4.0 16 2.0 17 2.0 18 1.0 19 2.0 20 2.0 21 5.0 22 5.0 23 9.0 24 9.0 25 5.0 26 13.0 27 15.0 28 15.0 29 18.0 30 38.0 31 44.0 32 56.0 33 104.0 34 196.0 35 624.0 36 2619.0 37 208.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.05 19.525000000000002 11.774999999999999 31.65 2 30.375000000000004 23.799999999999997 23.275000000000002 22.55 3 24.5 24.775 24.975 25.75 4 27.500000000000004 29.45 19.2 23.849999999999998 5 27.825 31.025000000000002 18.75 22.400000000000002 6 24.175 34.775 18.725 22.325 7 24.125 18.325 31.55 26.0 8 25.7 22.85 20.525 30.925000000000004 9 24.525 21.45 24.525 29.5 10-14 27.089999999999996 24.58 21.26 27.07 15-19 26.87 24.535 21.85 26.745 20-24 26.755000000000003 24.465 22.509999999999998 26.27 25-29 26.935 23.72 22.485 26.86 30-34 26.305 24.585 22.34 26.77 35-39 26.5 23.75 22.89 26.86 40-44 26.715 24.16 22.065 27.060000000000002 45-49 28.044999999999998 24.005000000000003 21.675 26.275 50-54 26.85 23.669999999999998 23.015 26.465 55-59 27.855 24.025 21.705 26.415 60-64 26.900000000000002 23.169999999999998 22.715 27.215 65-69 27.91 23.36 21.965 26.765 70-74 28.54 23.53 21.945 25.985000000000003 75-79 26.889999999999997 23.555 22.61 26.945000000000004 80-84 27.889999999999997 23.365 21.654999999999998 27.089999999999996 85-89 28.1 24.45 21.39 26.06 90-94 26.77 24.14 22.255 26.834999999999997 95-99 28.275 23.595 22.189999999999998 25.94 100-104 28.275 24.275 21.845 25.605 105-109 27.08 24.235 22.485 26.200000000000003 110-114 27.26 24.52 21.965 26.255 115-119 28.044999999999998 23.695 22.345000000000002 25.915 120-124 27.584999999999997 23.974999999999998 22.38 26.06 125-129 27.775 24.355 21.92 25.95 130-134 28.139999999999997 24.16 22.439999999999998 25.259999999999998 135-139 27.889999999999997 24.445 22.07 25.595000000000002 140-144 28.355000000000004 24.785 21.72 25.14 145-149 28.235 23.93 22.595000000000002 25.240000000000002 150-151 28.075 23.925 22.525000000000002 25.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 0.5 24 0.0 25 1.0 26 1.0 27 1.0 28 3.0 29 2.5 30 1.5 31 1.5 32 2.5 33 7.0 34 12.0 35 15.5 36 17.5 37 28.5 38 48.0 39 69.0 40 81.0 41 91.0 42 105.5 43 114.5 44 128.0 45 150.5 46 155.0 47 140.0 48 144.5 49 150.5 50 149.5 51 144.0 52 142.5 53 118.0 54 107.0 55 113.5 56 106.5 57 114.5 58 114.5 59 103.5 60 93.0 61 106.0 62 114.5 63 113.5 64 106.0 65 96.5 66 94.0 67 79.5 68 79.0 69 77.0 70 65.5 71 62.5 72 55.0 73 45.0 74 34.0 75 22.0 76 12.5 77 13.5 78 13.5 79 8.0 80 3.0 81 0.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 1.0 93 1.5 94 0.5 95 0.0 96 0.0 97 0.0 98 1.0 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.26141646158052 84.35000000000001 2 6.836204539239814 12.5 3 0.628930817610063 1.725 4 0.10937927262783702 0.4 5 0.027344818156959255 0.125 6 0.027344818156959255 0.15 7 0.05468963631391851 0.35000000000000003 8 0.05468963631391851 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 8 0.2 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 8 0.2 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 6 0.15 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6499999999999999 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 0.9125 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 1.9125 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCTA 10 0.006830828 145.0 2 CTATATC 10 0.006830828 145.0 6 TATATCT 10 0.006830828 145.0 7 CCTCTAT 10 0.006830828 145.0 3 TATCTGG 10 0.006830828 145.0 9 GCCATTA 10 0.006830828 145.0 145 ATATCTG 10 0.006830828 145.0 8 >>END_MODULE Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843196 spots for SRR7804089.sra Written 1843196 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra Read 1843184 spots for SRR7804089.sra Written 1843184 spots for SRR7804089.sra SRR ids: ['SRR7804089.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k_z_tm3m SRR7804089.sra spots: 36863692 blocks: [[1, 1843184], [1843185, 3686368], [3686369, 5529552], [5529553, 7372736], [7372737, 9215920], [9215921, 11059104], [11059105, 12902288], [12902289, 14745472], [14745473, 16588656], [16588657, 18431840], [18431841, 20275024], [20275025, 22118208], [22118209, 23961392], [23961393, 25804576], [25804577, 27647760], [27647761, 29490944], [29490945, 31334128], [31334129, 33177312], [33177313, 35020496], [35020497, 36863692]] SRR7804089 file size 12470195 SRR7804089 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804089 SRR7804089_1.fastq SRR7804089_2.fastq Input file: SRR7804089_1.fastq Paired file: SRR7804089_2.fastq trimmed: SRR7804089-trimmed-pair1.fastq, SRR7804089-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:34:19 2024 >> started Tue Dec 10 01:35:08 2024 >> done (48.311s) 36863692 read pairs processed; of these: 133 ( 0.00%) short read pairs filtered out after trimming by size control 1425 ( 0.00%) empty read pairs filtered out after trimming by size control 36862134 (100.00%) read pairs available; of these: 1362607 ( 3.70%) trimmed read pairs available after processing 35499527 (96.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 19 0.00% 20 20 0.00% 21 23 0.00% 22 21 0.00% 23 25 0.00% 24 22 0.00% 25 31 0.00% 26 32 0.00% 27 37 0.00% 28 29 0.00% 29 29 0.00% 30 26 0.00% 31 42 0.00% 32 48 0.00% 33 36 0.00% 34 36 0.00% 35 41 0.00% 36 44 0.00% 37 42 0.00% 38 53 0.00% 39 42 0.00% 40 52 0.00% 41 55 0.00% 42 48 0.00% 43 67 0.00% 44 60 0.00% 45 56 0.00% 46 76 0.00% 47 60 0.00% 48 72 0.00% 49 73 0.00% 50 65 0.00% 51 70 0.00% 52 88 0.00% 53 81 0.00% 54 88 0.00% 55 81 0.00% 56 92 0.00% 57 98 0.00% 58 95 0.00% 59 98 0.00% 60 105 0.00% 61 121 0.00% 62 120 0.00% 63 142 0.00% 64 168 0.00% 65 159 0.00% 66 162 0.00% 67 182 0.00% 68 200 0.00% 69 196 0.00% 70 238 0.00% 71 240 0.00% 72 277 0.00% 73 337 0.00% 74 392 0.00% 75 403 0.00% 76 426 0.00% 77 504 0.00% 78 539 0.00% 79 650 0.00% 80 679 0.00% 81 769 0.00% 82 945 0.00% 83 988 0.00% 84 1178 0.00% 85 1246 0.00% 86 1454 0.00% 87 1556 0.00% 88 1719 0.00% 89 1881 0.01% 90 2040 0.01% 91 2276 0.01% 92 2546 0.01% 93 2871 0.01% 94 3225 0.01% 95 3522 0.01% 96 3888 0.01% 97 4125 0.01% 98 4441 0.01% 99 4751 0.01% 100 5238 0.01% 101 5709 0.02% 102 6032 0.02% 103 6715 0.02% 104 7018 0.02% 105 7571 0.02% 106 8139 0.02% 107 8528 0.02% 108 9138 0.02% 109 9755 0.03% 110 9889 0.03% 111 10656 0.03% 112 11498 0.03% 113 12114 0.03% 114 12970 0.04% 115 14061 0.04% 116 14588 0.04% 117 15213 0.04% 118 15892 0.04% 119 16613 0.05% 120 17319 0.05% 121 18451 0.05% 122 19516 0.05% 123 20198 0.05% 124 21789 0.06% 125 22366 0.06% 126 23585 0.06% 127 24744 0.07% 128 25327 0.07% 129 26799 0.07% 130 27802 0.08% 131 28653 0.08% 132 30126 0.08% 133 32009 0.09% 134 33268 0.09% 135 34505 0.09% 136 36101 0.10% 137 36953 0.10% 138 38022 0.10% 139 39789 0.11% 140 40600 0.11% 141 42183 0.11% 142 44318 0.12% 143 46016 0.12% 144 47695 0.13% 145 49969 0.14% 146 51257 0.14% 147 53364 0.14% 148 54664 0.15% 149 55974 0.15% 150 58059 0.16% 151 35499527 96.30% 36862134 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=21 prefix-density=1.00 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=19.76 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.4 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=14 prefix-density=0.70 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=212.99 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=12.1 sequence=AGAACAAGGAGTGCAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804089 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:35:52 Started mapping on | Dec 10 01:35:52 Finished on | Dec 10 01:41:06 Mapping speed, Million of reads per hour | 422.62 Number of input reads | 36862134 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 34163596 Uniquely mapped reads % | 92.68% Average mapped length | 299.43 Number of splices: Total | 35703697 Number of splices: Annotated (sjdb) | 33746486 Number of splices: GT/AG | 35185536 Number of splices: GC/AG | 435320 Number of splices: AT/AC | 11859 Number of splices: Non-canonical | 70982 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481037 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 27339 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.40% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2217501 2217501 2217501 N_multimapping 481037 481037 481037 N_noFeature 850946 33150338 1109397 N_ambiguous 905495 5064 151738 UnstrandedReadsAssigned:32407155 PositiveStrandReadsAssigned:1008194 NegativeStrandReadsAssigned:32902461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804089 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804089-trimmed-pair1.fastq SRR7804089-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,862,134 reads, 33,173,514 reads pseudoaligned [quant] estimated average fragment length: 289.064 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,239 rounds 52973 SRR7804089.ke.tsv 35125 SRR7804089.se.tsv 88098 total ==> SRR7804089.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 648.33 0 0 PNS24247 1044 755.936 133.5 6.84618 PNS24249 1928 1639.94 118.094 2.7916 PNS24246 1044 755.936 133.5 6.84618 PNS24248 1044 755.936 133.5 6.84618 PNS24244 1471 1182.94 152.408 4.99459 PNS24243 293 76.7394 0 0 KQK14069 1603 1314.94 2617.18 77.1583 KQK14071 474 207.751 113.992 21.2709 ==> SRR7804089.se.tsv <== BRADI_1g14170v3 3043 BRADI_1g53295v3 737 BRADI_1g59795v3 562 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 609 BRADI_1g74790v3 567 BRADI_1g09890v3 0 BRADI_1g77505v3 486 BRADI_1g48960v3 0 SRR7804089 completed mapping pipeline successfully