Starting /dee2/code/volunteer_pipeline.sh SRR7804090 current disk space = 1523380568064 free memory = 1568071696 SRR7804090 SRAfilesize 4905732c42e68b4e3a99c61de1a724b3 SRR7804090.sra SRR7804090.sra file validated SRR7804090 is paired end SRR7804090 is conventional basespace SRR7804090 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804090_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2175 37.0 37.0 37.0 37.0 37.0 2 36.21 37.0 37.0 37.0 37.0 37.0 3 36.29 37.0 37.0 37.0 37.0 37.0 4 36.4905 37.0 37.0 37.0 37.0 37.0 5 36.559 37.0 37.0 37.0 37.0 37.0 6 36.4245 37.0 37.0 37.0 37.0 37.0 7 36.3895 37.0 37.0 37.0 37.0 37.0 8 36.474 37.0 37.0 37.0 37.0 37.0 9 36.464 37.0 37.0 37.0 37.0 37.0 10-14 36.4929 37.0 37.0 37.0 37.0 37.0 15-19 36.4731 37.0 37.0 37.0 37.0 37.0 20-24 36.4407 37.0 37.0 37.0 37.0 37.0 25-29 36.477999999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4244 37.0 37.0 37.0 37.0 37.0 35-39 36.432399999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4091 37.0 37.0 37.0 37.0 37.0 45-49 36.368700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3603 37.0 37.0 37.0 37.0 37.0 55-59 36.303700000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.279900000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2433 37.0 37.0 37.0 37.0 37.0 70-74 36.233700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.26090000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1734 37.0 37.0 37.0 37.0 37.0 85-89 36.186 37.0 37.0 37.0 37.0 37.0 90-94 36.1048 37.0 37.0 37.0 37.0 37.0 95-99 36.140100000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1432 37.0 37.0 37.0 37.0 37.0 105-109 36.052200000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.0379 37.0 37.0 37.0 37.0 37.0 115-119 35.990899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.9921 37.0 37.0 37.0 37.0 37.0 125-129 35.8839 37.0 37.0 37.0 37.0 37.0 130-134 35.8463 37.0 37.0 37.0 37.0 37.0 135-139 35.8217 37.0 37.0 37.0 37.0 37.0 140-144 35.7211 37.0 37.0 37.0 37.0 37.0 145-149 35.7039 37.0 37.0 37.0 37.0 37.0 150-151 35.323 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 3.0 25 4.0 26 4.0 27 5.0 28 12.0 29 17.0 30 28.0 31 40.0 32 60.0 33 91.0 34 160.0 35 342.0 36 2873.0 37 359.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.050000000000004 12.575 7.625 34.75 2 29.02902902902903 14.314314314314313 28.653653653653656 28.003003003003002 3 22.45 18.975 24.675 33.900000000000006 4 27.450000000000003 23.95 21.65 26.950000000000003 5 26.6 27.200000000000003 21.825 24.375 6 24.075 30.775000000000002 21.95 23.200000000000003 7 19.2 22.825 37.2 20.775 8 21.725 23.325000000000003 27.950000000000003 27.0 9 22.45 21.575 31.1 24.875 10-14 24.005000000000003 24.92 24.515 26.56 15-19 23.830000000000002 24.91 25.215 26.045 20-24 23.875 25.05 25.41 25.665 25-29 24.035 24.705 24.97 26.290000000000003 30-34 23.865 24.41 25.03 26.695 35-39 23.785 24.11 25.564999999999998 26.540000000000003 40-44 24.5 23.9 24.92 26.68 45-49 24.63 24.755 23.974999999999998 26.640000000000004 50-54 24.285 24.55 24.515 26.650000000000002 55-59 23.86 24.505 25.019999999999996 26.615 60-64 24.435000000000002 24.055 24.57 26.939999999999998 65-69 24.055 24.625 25.025 26.295 70-74 24.865000000000002 24.365000000000002 24.295 26.474999999999998 75-79 24.279999999999998 23.96 25.055 26.705000000000002 80-84 24.705 23.965 24.805 26.525 85-89 24.315 24.565 25.06 26.06 90-94 24.505 24.425 24.51 26.56 95-99 24.265 24.22 24.65 26.865 100-104 24.740000000000002 23.724999999999998 24.16 27.375 105-109 25.064999999999998 24.27 23.94 26.724999999999998 110-114 25.345000000000002 24.154999999999998 24.060000000000002 26.44 115-119 24.795 23.875 24.72 26.61 120-124 25.180000000000003 24.18 23.97 26.669999999999998 125-129 24.865000000000002 24.275 23.64 27.22 130-134 25.095 24.485 23.36 27.060000000000002 135-139 25.314999999999998 23.735 24.04 26.91 140-144 25.169999999999998 23.51 24.27 27.05 145-149 25.650000000000002 23.345 24.55 26.455000000000002 150-151 25.4625 23.65 23.45 27.437499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 1.0 6 1.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 2.0 28 3.0 29 3.5 30 6.5 31 8.0 32 8.0 33 14.5 34 26.0 35 36.0 36 40.0 37 48.0 38 60.5 39 74.0 40 105.5 41 124.0 42 128.5 43 154.0 44 173.0 45 195.5 46 204.0 47 186.0 48 186.0 49 165.5 50 153.0 51 151.5 52 137.0 53 134.0 54 118.5 55 97.5 56 92.0 57 83.0 58 78.5 59 85.0 60 79.0 61 74.0 62 82.5 63 79.5 64 71.0 65 72.5 66 67.0 67 64.0 68 61.5 69 53.5 70 43.5 71 33.0 72 28.0 73 29.5 74 25.0 75 15.0 76 11.0 77 8.5 78 5.0 79 3.0 80 1.5 81 1.5 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.175 #Duplication Level Percentage of deduplicated Percentage of total 1 94.08016989646933 88.6 2 5.654366870188479 10.65 3 0.2654632333421821 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.5875 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.8125 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138-139 1.1375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTTTC 10 0.006830828 145.0 6 GTTTTCC 10 0.006830828 145.0 7 AGCAGGT 10 0.006830828 145.0 2 AGGTTTT 10 0.006830828 145.0 5 CAGGTTT 10 0.006830828 145.0 4 >>END_MODULE SRR7804090 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804090_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3025 37.0 37.0 37.0 37.0 37.0 2 35.981 37.0 37.0 37.0 37.0 37.0 3 35.908 37.0 37.0 37.0 37.0 37.0 4 36.2135 37.0 37.0 37.0 37.0 37.0 5 36.0435 37.0 37.0 37.0 37.0 37.0 6 36.063 37.0 37.0 37.0 37.0 37.0 7 36.017 37.0 37.0 37.0 37.0 37.0 8 36.1975 37.0 37.0 37.0 37.0 37.0 9 35.952 37.0 37.0 37.0 37.0 37.0 10-14 36.072300000000006 37.0 37.0 37.0 37.0 37.0 15-19 35.982899999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.012299999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.9812 37.0 37.0 37.0 37.0 37.0 30-34 35.8976 37.0 37.0 37.0 37.0 37.0 35-39 35.8806 37.0 37.0 37.0 37.0 37.0 40-44 35.8505 37.0 37.0 37.0 37.0 37.0 45-49 35.7642 37.0 37.0 37.0 37.0 37.0 50-54 35.749100000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.719800000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.786699999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.67739999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.7722 37.0 37.0 37.0 37.0 37.0 75-79 35.604200000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.6868 37.0 37.0 37.0 37.0 37.0 85-89 35.69070000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.615899999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.5815 37.0 37.0 37.0 37.0 37.0 100-104 35.5392 37.0 37.0 37.0 37.0 37.0 105-109 35.478899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.37330000000001 37.0 37.0 37.0 34.6 37.0 115-119 35.41930000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.3299 37.0 37.0 37.0 34.6 37.0 125-129 35.2556 37.0 37.0 37.0 34.6 37.0 130-134 35.3491 37.0 37.0 37.0 37.0 37.0 135-139 35.22279999999999 37.0 37.0 37.0 29.8 37.0 140-144 35.199400000000004 37.0 37.0 37.0 27.4 37.0 145-149 35.05309999999999 37.0 37.0 37.0 25.0 37.0 150-151 34.59375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 11.0 14 4.0 15 5.0 16 1.0 17 7.0 18 2.0 19 5.0 20 1.0 21 9.0 22 8.0 23 7.0 24 6.0 25 12.0 26 10.0 27 8.0 28 13.0 29 26.0 30 42.0 31 47.0 32 68.0 33 124.0 34 211.0 35 548.0 36 2612.0 37 213.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.12006003001501 19.35967983991996 10.98049024512256 29.539769884942473 2 31.374999999999996 23.200000000000003 23.75 21.675 3 24.85 25.224999999999998 25.074999999999996 24.85 4 26.775 30.049999999999997 19.55 23.625 5 29.299999999999997 29.575000000000003 18.825 22.3 6 26.55 33.45 17.599999999999998 22.400000000000002 7 23.125 19.675 31.874999999999996 25.324999999999996 8 25.35 22.2 21.125 31.324999999999996 9 25.674999999999997 21.9 24.525 27.900000000000002 10-14 26.875 24.38 21.584999999999997 27.16 15-19 26.784999999999997 24.205 22.485 26.525 20-24 27.08 24.255 22.470000000000002 26.195 25-29 27.200000000000003 23.79 22.755 26.255 30-34 26.96 24.315 22.900000000000002 25.825 35-39 26.865 24.740000000000002 22.475 25.919999999999998 40-44 27.41 24.2 22.400000000000002 25.990000000000002 45-49 27.465 24.224999999999998 22.564999999999998 25.745 50-54 28.060000000000002 24.395 22.35 25.195 55-59 28.03 23.905 22.2 25.865 60-64 26.955000000000002 23.65 23.294999999999998 26.1 65-69 26.88 24.560000000000002 22.35 26.21 70-74 26.365 24.23 22.705000000000002 26.700000000000003 75-79 26.919999999999998 24.47 22.525000000000002 26.085 80-84 27.32 23.98 22.705000000000002 25.995 85-89 27.375 24.21 22.2 26.215 90-94 27.245 24.529999999999998 22.55 25.674999999999997 95-99 27.355 24.635 22.465 25.545 100-104 27.334999999999997 24.215 22.715 25.735000000000003 105-109 26.865 24.425 22.400000000000002 26.31 110-114 27.77 23.74 22.814999999999998 25.674999999999997 115-119 27.045 24.565 22.725 25.665 120-124 27.01 24.08 23.45 25.46 125-129 27.72 24.725 22.275 25.28 130-134 27.584999999999997 24.695 22.855 24.865000000000002 135-139 26.729999999999997 24.565 23.22 25.485000000000003 140-144 27.634999999999998 24.875 22.37 25.119999999999997 145-149 27.200000000000003 24.6 23.135 25.064999999999998 150-151 27.650000000000002 23.7625 23.0125 25.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.5 16 1.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 0.0 26 2.0 27 4.0 28 2.5 29 3.5 30 3.5 31 3.5 32 7.0 33 10.5 34 13.5 35 17.5 36 23.0 37 33.5 38 50.0 39 70.5 40 86.0 41 103.0 42 129.0 43 138.0 44 147.5 45 166.5 46 176.0 47 172.0 48 155.5 49 145.0 50 133.5 51 118.5 52 116.0 53 115.5 54 106.5 55 94.0 56 79.5 57 86.5 58 105.5 59 99.5 60 92.0 61 95.5 62 107.5 63 103.5 64 84.5 65 88.0 66 87.0 67 85.0 68 86.0 69 75.5 70 67.0 71 63.0 72 55.0 73 47.0 74 37.0 75 22.0 76 16.0 77 13.0 78 11.0 79 6.5 80 4.0 81 4.0 82 2.0 83 1.5 84 1.5 85 2.5 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 1.0 96 1.0 97 0.0 98 0.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.05 #Duplication Level Percentage of deduplicated Percentage of total 1 94.31153641679958 88.7 2 5.236576289207869 9.85 3 0.3987240829346092 1.125 4 0.0 0.0 5 0.026581605528973953 0.125 6 0.0 0.0 7 0.0 0.0 8 0.026581605528973953 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.42500000000000004 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.8375 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTGGC 10 0.006830828 145.0 3 CCCTGCA 10 0.006830828 145.0 9 GTGGCCC 10 0.006830828 145.0 5 ATCGTGG 10 0.006830828 145.0 2 TGGCCCT 10 0.006830828 145.0 6 TTGCTAC 10 0.006830828 145.0 145 GCCCTGC 10 0.006830828 145.0 8 >>END_MODULE Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572892 spots for SRR7804090.sra Written 1572892 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra Read 1572884 spots for SRR7804090.sra Written 1572884 spots for SRR7804090.sra SRR ids: ['SRR7804090.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mrh51qd3 SRR7804090.sra spots: 31457688 blocks: [[1, 1572884], [1572885, 3145768], [3145769, 4718652], [4718653, 6291536], [6291537, 7864420], [7864421, 9437304], [9437305, 11010188], [11010189, 12583072], [12583073, 14155956], [14155957, 15728840], [15728841, 17301724], [17301725, 18874608], [18874609, 20447492], [20447493, 22020376], [22020377, 23593260], [23593261, 25166144], [25166145, 26739028], [26739029, 28311912], [28311913, 29884796], [29884797, 31457688]] SRR7804090 file size 10638277 SRR7804090 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804090 SRR7804090_1.fastq SRR7804090_2.fastq Input file: SRR7804090_1.fastq Paired file: SRR7804090_2.fastq trimmed: SRR7804090-trimmed-pair1.fastq, SRR7804090-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:35:56 2024 >> started Tue Dec 10 01:36:35 2024 >> done (38.660s) 31457688 read pairs processed; of these: 92 ( 0.00%) short read pairs filtered out after trimming by size control 9237 ( 0.03%) empty read pairs filtered out after trimming by size control 31448359 (99.97%) read pairs available; of these: 685979 ( 2.18%) trimmed read pairs available after processing 30762380 (97.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 18 0.00% 20 13 0.00% 21 15 0.00% 22 20 0.00% 23 14 0.00% 24 15 0.00% 25 20 0.00% 26 24 0.00% 27 16 0.00% 28 18 0.00% 29 20 0.00% 30 31 0.00% 31 30 0.00% 32 27 0.00% 33 25 0.00% 34 23 0.00% 35 44 0.00% 36 40 0.00% 37 33 0.00% 38 47 0.00% 39 38 0.00% 40 39 0.00% 41 36 0.00% 42 32 0.00% 43 44 0.00% 44 34 0.00% 45 42 0.00% 46 46 0.00% 47 53 0.00% 48 37 0.00% 49 50 0.00% 50 39 0.00% 51 61 0.00% 52 58 0.00% 53 54 0.00% 54 59 0.00% 55 58 0.00% 56 58 0.00% 57 68 0.00% 58 71 0.00% 59 70 0.00% 60 74 0.00% 61 63 0.00% 62 70 0.00% 63 78 0.00% 64 75 0.00% 65 72 0.00% 66 90 0.00% 67 91 0.00% 68 91 0.00% 69 130 0.00% 70 87 0.00% 71 116 0.00% 72 117 0.00% 73 147 0.00% 74 106 0.00% 75 182 0.00% 76 171 0.00% 77 173 0.00% 78 223 0.00% 79 225 0.00% 80 244 0.00% 81 282 0.00% 82 355 0.00% 83 364 0.00% 84 421 0.00% 85 464 0.00% 86 552 0.00% 87 593 0.00% 88 641 0.00% 89 673 0.00% 90 681 0.00% 91 856 0.00% 92 913 0.00% 93 1080 0.00% 94 1173 0.00% 95 1324 0.00% 96 1417 0.00% 97 1557 0.00% 98 1700 0.01% 99 1744 0.01% 100 1887 0.01% 101 2076 0.01% 102 2400 0.01% 103 2672 0.01% 104 2889 0.01% 105 3059 0.01% 106 3405 0.01% 107 3430 0.01% 108 3777 0.01% 109 3850 0.01% 110 4231 0.01% 111 4671 0.01% 112 4989 0.02% 113 5459 0.02% 114 5820 0.02% 115 6224 0.02% 116 6637 0.02% 117 7091 0.02% 118 7347 0.02% 119 7737 0.02% 120 8054 0.03% 121 8724 0.03% 122 9083 0.03% 123 9787 0.03% 124 10484 0.03% 125 11150 0.04% 126 11917 0.04% 127 12152 0.04% 128 12528 0.04% 129 13088 0.04% 130 13549 0.04% 131 14132 0.04% 132 14892 0.05% 133 16226 0.05% 134 17105 0.05% 135 17595 0.06% 136 18497 0.06% 137 19484 0.06% 138 19949 0.06% 139 20711 0.07% 140 21500 0.07% 141 22313 0.07% 142 23399 0.07% 143 24464 0.08% 144 26207 0.08% 145 27270 0.09% 146 28436 0.09% 147 29103 0.09% 148 30632 0.10% 149 30686 0.10% 150 32244 0.10% 151 30762380 97.82% 31448359 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=30 prefix-density=0.78 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=32.79 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=12 prefix-density=0.58 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGACGGCAGGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=112.15 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=9.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804090 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:37:26 Started mapping on | Dec 10 01:37:26 Finished on | Dec 10 01:41:37 Mapping speed, Million of reads per hour | 451.05 Number of input reads | 31448359 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 28929105 Uniquely mapped reads % | 91.99% Average mapped length | 299.97 Number of splices: Total | 30721011 Number of splices: Annotated (sjdb) | 28954951 Number of splices: GT/AG | 30270355 Number of splices: GC/AG | 367514 Number of splices: AT/AC | 16019 Number of splices: Non-canonical | 67123 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 3.11 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413891 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 33168 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.83% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2105363 2105363 2105363 N_multimapping 413891 413891 413891 N_noFeature 884277 28097347 1097949 N_ambiguous 761074 5093 144177 UnstrandedReadsAssigned:27283754 PositiveStrandReadsAssigned:826665 NegativeStrandReadsAssigned:27686979 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804090 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804090-trimmed-pair1.fastq SRR7804090-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,448,359 reads, 28,019,011 reads pseudoaligned [quant] estimated average fragment length: 315.354 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR7804090.ke.tsv 35125 SRR7804090.se.tsv 88098 total ==> SRR7804090.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 622.348 0 0 PNS24247 1044 729.646 120.34 7.59096 PNS24249 1928 1613.65 237.015 6.7603 PNS24246 1044 729.646 120.34 7.59096 PNS24248 1044 729.646 120.34 7.59096 PNS24244 1471 1156.65 155.964 6.20616 PNS24243 293 71.4311 1 0.644334 KQK14069 1603 1288.65 864.771 30.8863 KQK14071 474 193.836 13.1354 3.11894 ==> SRR7804090.se.tsv <== BRADI_1g14170v3 908 BRADI_1g53295v3 2113 BRADI_1g59795v3 760 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 2727 BRADI_1g74790v3 893 BRADI_1g09890v3 4 BRADI_1g77505v3 539 BRADI_1g48960v3 0 SRR7804090 completed mapping pipeline successfully