Starting /dee2/code/volunteer_pipeline.sh SRR7804091 current disk space = 1523316731904 free memory = 1482895196 SRR7804091 SRAfilesize c4a207adafedce03df93691f731adc89 SRR7804091.sra SRR7804091.sra file validated SRR7804091 is paired end SRR7804091 is conventional basespace SRR7804091 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804091_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2905 37.0 37.0 37.0 37.0 37.0 2 36.21625 37.0 37.0 37.0 37.0 37.0 3 36.3995 37.0 37.0 37.0 37.0 37.0 4 36.3975 37.0 37.0 37.0 37.0 37.0 5 36.5075 37.0 37.0 37.0 37.0 37.0 6 36.4225 37.0 37.0 37.0 37.0 37.0 7 36.471 37.0 37.0 37.0 37.0 37.0 8 36.495 37.0 37.0 37.0 37.0 37.0 9 36.438 37.0 37.0 37.0 37.0 37.0 10-14 36.445100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.4467 37.0 37.0 37.0 37.0 37.0 20-24 36.466300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3778 37.0 37.0 37.0 37.0 37.0 30-34 36.3887 37.0 37.0 37.0 37.0 37.0 35-39 36.320100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4012 37.0 37.0 37.0 37.0 37.0 45-49 36.3154 37.0 37.0 37.0 37.0 37.0 50-54 36.2799 37.0 37.0 37.0 37.0 37.0 55-59 36.300799999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.305400000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.2606 37.0 37.0 37.0 37.0 37.0 70-74 36.2154 37.0 37.0 37.0 37.0 37.0 75-79 36.1536 37.0 37.0 37.0 37.0 37.0 80-84 36.1721 37.0 37.0 37.0 37.0 37.0 85-89 36.096799999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.1024 37.0 37.0 37.0 37.0 37.0 95-99 36.103899999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.101800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9713 37.0 37.0 37.0 37.0 37.0 110-114 35.9668 37.0 37.0 37.0 37.0 37.0 115-119 35.9269 37.0 37.0 37.0 37.0 37.0 120-124 35.984500000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.7377 37.0 37.0 37.0 37.0 37.0 130-134 35.781600000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.7661 37.0 37.0 37.0 37.0 37.0 140-144 35.6467 37.0 37.0 37.0 37.0 37.0 145-149 35.6481 37.0 37.0 37.0 37.0 37.0 150-151 35.17 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 2.0 25 4.0 26 6.0 27 10.0 28 13.0 29 24.0 30 40.0 31 42.0 32 61.0 33 88.0 34 132.0 35 360.0 36 2818.0 37 395.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.8 12.5 9.075 34.625 2 26.319739804853644 14.035526644983737 31.823867900925695 27.820865649236925 3 22.95 18.375 26.174999999999997 32.5 4 27.35 23.200000000000003 22.475 26.974999999999998 5 26.525 28.549999999999997 22.825 22.1 6 24.55 32.175 21.825 21.45 7 18.9 22.45 38.3 20.349999999999998 8 21.65 24.3 26.150000000000002 27.900000000000002 9 21.4 22.15 30.425 26.025 10-14 23.025000000000002 25.495 25.05 26.43 15-19 23.965 24.38 25.085 26.57 20-24 23.985 25.305 24.65 26.06 25-29 24.03 25.215 24.265 26.490000000000002 30-34 23.43 24.875 25.165 26.529999999999998 35-39 24.36 24.82 24.65 26.169999999999998 40-44 23.810000000000002 24.465 25.069999999999997 26.655 45-49 24.08 24.92 24.67 26.33 50-54 24.51 24.64 24.52 26.33 55-59 24.075 24.435000000000002 25.03 26.46 60-64 24.515 24.47 24.64 26.375 65-69 23.855 24.47 24.87 26.805 70-74 24.415 24.23 24.725 26.63 75-79 25.03 24.21 23.995 26.765 80-84 24.895 24.39 24.36 26.355 85-89 24.759999999999998 24.01 24.515 26.715 90-94 24.63 23.995 24.485 26.889999999999997 95-99 24.66 24.015 24.385 26.939999999999998 100-104 24.595 24.47 24.45 26.484999999999996 105-109 24.8 23.855 24.375 26.97 110-114 24.415 24.925 23.865 26.795 115-119 24.759999999999998 24.14 23.965 27.134999999999998 120-124 24.695 23.974999999999998 24.16 27.169999999999998 125-129 25.05 23.945 24.055 26.950000000000003 130-134 25.36 23.87 24.104999999999997 26.665 135-139 25.025 24.19 23.78 27.005000000000003 140-144 24.98 23.815 24.295 26.91 145-149 25.374999999999996 23.765 23.97 26.889999999999997 150-151 24.025 23.625 24.837500000000002 27.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 1.5 27 1.0 28 0.5 29 0.5 30 6.5 31 11.5 32 11.0 33 17.0 34 24.5 35 32.5 36 43.0 37 56.5 38 68.5 39 75.0 40 104.5 41 116.5 42 119.5 43 155.0 44 186.5 45 195.5 46 189.5 47 195.0 48 185.0 49 165.0 50 167.5 51 154.0 52 138.0 53 126.0 54 115.5 55 119.0 56 104.0 57 79.0 58 76.0 59 83.5 60 81.0 61 77.0 62 66.0 63 63.0 64 65.5 65 72.5 66 66.5 67 54.0 68 62.5 69 58.0 70 50.5 71 40.0 72 23.0 73 19.5 74 20.5 75 15.0 76 12.0 77 10.5 78 5.0 79 4.0 80 3.5 81 1.0 82 1.5 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.575 #Duplication Level Percentage of deduplicated Percentage of total 1 92.73561976775588 85.85000000000001 2 6.589251957871996 12.2 3 0.6211180124223602 1.725 4 0.027005130974885227 0.1 5 0.027005130974885227 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTTATGATAACTGACTGAAACGACACACTAGTTGGTACTACTAGTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6625 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.9875 0.0 0.0 0.0 0.0 128-129 1.1625 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.4874999999999998 0.0 0.0 0.0 0.0 136-137 1.65 0.0 0.0 0.0 0.0 138-139 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804091 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804091_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3005 37.0 37.0 37.0 37.0 37.0 2 36.0125 37.0 37.0 37.0 37.0 37.0 3 36.078 37.0 37.0 37.0 37.0 37.0 4 36.179 37.0 37.0 37.0 37.0 37.0 5 36.177 37.0 37.0 37.0 37.0 37.0 6 36.13 37.0 37.0 37.0 37.0 37.0 7 36.091 37.0 37.0 37.0 37.0 37.0 8 36.2255 37.0 37.0 37.0 37.0 37.0 9 36.1465 37.0 37.0 37.0 37.0 37.0 10-14 36.156600000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.0749 37.0 37.0 37.0 37.0 37.0 20-24 36.0823 37.0 37.0 37.0 37.0 37.0 25-29 36.0283 37.0 37.0 37.0 37.0 37.0 30-34 36.0416 37.0 37.0 37.0 37.0 37.0 35-39 35.9729 37.0 37.0 37.0 37.0 37.0 40-44 35.9468 37.0 37.0 37.0 37.0 37.0 45-49 35.8755 37.0 37.0 37.0 37.0 37.0 50-54 35.87760000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.8001 37.0 37.0 37.0 37.0 37.0 60-64 35.826100000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.7274 37.0 37.0 37.0 37.0 37.0 70-74 35.8155 37.0 37.0 37.0 37.0 37.0 75-79 35.725100000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.6619 37.0 37.0 37.0 37.0 37.0 85-89 35.7017 37.0 37.0 37.0 37.0 37.0 90-94 35.7096 37.0 37.0 37.0 37.0 37.0 95-99 35.6008 37.0 37.0 37.0 37.0 37.0 100-104 35.6725 37.0 37.0 37.0 37.0 37.0 105-109 35.5892 37.0 37.0 37.0 37.0 37.0 110-114 35.4704 37.0 37.0 37.0 37.0 37.0 115-119 35.432 37.0 37.0 37.0 37.0 37.0 120-124 35.4661 37.0 37.0 37.0 37.0 37.0 125-129 35.4254 37.0 37.0 37.0 37.0 37.0 130-134 35.4058 37.0 37.0 37.0 37.0 37.0 135-139 35.28699999999999 37.0 37.0 37.0 34.6 37.0 140-144 35.3013 37.0 37.0 37.0 32.2 37.0 145-149 35.045300000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.628 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 4.0 15 7.0 16 1.0 17 2.0 18 0.0 19 2.0 20 3.0 21 2.0 22 5.0 23 7.0 24 10.0 25 10.0 26 8.0 27 13.0 28 19.0 29 29.0 30 43.0 31 48.0 32 50.0 33 98.0 34 209.0 35 597.0 36 2632.0 37 194.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.86993496748374 17.90895447723862 11.5807903951976 30.64032016008004 2 31.3 21.8 24.8 22.1 3 25.974999999999998 23.974999999999998 26.575 23.474999999999998 4 26.174999999999997 29.2 20.4 24.224999999999998 5 27.35 30.95 19.2 22.5 6 26.125 31.55 17.7 24.625 7 23.75 19.425 31.624999999999996 25.2 8 24.7 23.125 22.675 29.5 9 23.849999999999998 21.6 25.424999999999997 29.125 10-14 26.450000000000003 25.09 22.0 26.46 15-19 26.66 24.099999999999998 22.95 26.290000000000003 20-24 27.1 24.675 22.439999999999998 25.785000000000004 25-29 26.86 24.125 23.39 25.624999999999996 30-34 26.745 24.535 22.975 25.745 35-39 27.1 24.525 22.775000000000002 25.6 40-44 26.805 24.63 22.485 26.08 45-49 26.325 24.795 22.715 26.165 50-54 27.07 24.805 22.53 25.595000000000002 55-59 26.715 24.08 23.02 26.185000000000002 60-64 26.16 24.485 22.795 26.56 65-69 26.784999999999997 25.025 22.675 25.515 70-74 27.145000000000003 24.45 22.895 25.509999999999998 75-79 26.6 23.735 23.580000000000002 26.085 80-84 27.18 24.6 22.59 25.629999999999995 85-89 27.16 24.26 22.82 25.759999999999998 90-94 26.58 24.705 23.25 25.465 95-99 27.235 24.19 22.785 25.790000000000003 100-104 26.97 24.29 23.075000000000003 25.665 105-109 26.5 24.48 23.345 25.674999999999997 110-114 26.77 24.115000000000002 23.585 25.53 115-119 27.33 24.365000000000002 22.75 25.555 120-124 27.42 24.345 22.905 25.330000000000002 125-129 28.025 24.515 22.63 24.83 130-134 27.544999999999998 24.3 23.23 24.925 135-139 26.795 24.6 22.99 25.615 140-144 27.389999999999997 24.465 23.375 24.77 145-149 27.51 24.275 23.119999999999997 25.095 150-151 26.8375 24.962500000000002 23.8625 24.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 2.0 25 0.5 26 0.0 27 0.5 28 2.0 29 4.0 30 4.0 31 6.5 32 8.0 33 8.5 34 12.0 35 16.5 36 29.0 37 49.0 38 56.5 39 65.5 40 89.5 41 104.5 42 121.0 43 146.5 44 156.5 45 162.5 46 170.5 47 160.5 48 155.5 49 157.5 50 147.5 51 135.0 52 125.0 53 113.5 54 106.0 55 105.0 56 106.0 57 107.5 58 91.5 59 83.5 60 99.5 61 100.0 62 98.5 63 95.0 64 82.0 65 80.5 66 89.0 67 83.5 68 74.0 69 74.0 70 59.0 71 54.0 72 52.0 73 34.5 74 32.0 75 23.5 76 10.5 77 11.0 78 9.0 79 7.0 80 4.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.55 #Duplication Level Percentage of deduplicated Percentage of total 1 92.73365748244193 85.82499999999999 2 6.509994597514856 12.049999999999999 3 0.7293354943273906 2.025 4 0.02701242571582928 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6625 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9624999999999999 0.0 0.0 0.0 0.0 128-129 1.1375 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.3125 0.0 0.0 0.0 0.0 134-135 1.475 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848544 spots for SRR7804091.sra Written 1848544 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra Read 1848534 spots for SRR7804091.sra Written 1848534 spots for SRR7804091.sra SRR ids: ['SRR7804091.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wcdpzj42 SRR7804091.sra spots: 36970690 blocks: [[1, 1848534], [1848535, 3697068], [3697069, 5545602], [5545603, 7394136], [7394137, 9242670], [9242671, 11091204], [11091205, 12939738], [12939739, 14788272], [14788273, 16636806], [16636807, 18485340], [18485341, 20333874], [20333875, 22182408], [22182409, 24030942], [24030943, 25879476], [25879477, 27728010], [27728011, 29576544], [29576545, 31425078], [31425079, 33273612], [33273613, 35122146], [35122147, 36970690]] SRR7804091 file size 12506453 SRR7804091 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804091 SRR7804091_1.fastq SRR7804091_2.fastq Input file: SRR7804091_1.fastq Paired file: SRR7804091_2.fastq trimmed: SRR7804091-trimmed-pair1.fastq, SRR7804091-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:39:54 2024 >> started Tue Dec 10 01:40:39 2024 >> done (44.998s) 36970690 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 594 ( 0.00%) empty read pairs filtered out after trimming by size control 36969992 (100.00%) read pairs available; of these: 1113651 ( 3.01%) trimmed read pairs available after processing 35856341 (96.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 17 0.00% 20 7 0.00% 21 16 0.00% 22 23 0.00% 23 19 0.00% 24 14 0.00% 25 18 0.00% 26 25 0.00% 27 19 0.00% 28 18 0.00% 29 28 0.00% 30 33 0.00% 31 35 0.00% 32 37 0.00% 33 28 0.00% 34 32 0.00% 35 31 0.00% 36 38 0.00% 37 34 0.00% 38 49 0.00% 39 28 0.00% 40 49 0.00% 41 42 0.00% 42 45 0.00% 43 42 0.00% 44 41 0.00% 45 60 0.00% 46 54 0.00% 47 52 0.00% 48 62 0.00% 49 57 0.00% 50 67 0.00% 51 45 0.00% 52 72 0.00% 53 75 0.00% 54 64 0.00% 55 86 0.00% 56 57 0.00% 57 77 0.00% 58 67 0.00% 59 75 0.00% 60 89 0.00% 61 86 0.00% 62 92 0.00% 63 106 0.00% 64 118 0.00% 65 125 0.00% 66 137 0.00% 67 138 0.00% 68 129 0.00% 69 158 0.00% 70 165 0.00% 71 204 0.00% 72 241 0.00% 73 251 0.00% 74 251 0.00% 75 292 0.00% 76 298 0.00% 77 376 0.00% 78 417 0.00% 79 468 0.00% 80 484 0.00% 81 554 0.00% 82 649 0.00% 83 780 0.00% 84 860 0.00% 85 852 0.00% 86 1014 0.00% 87 1123 0.00% 88 1206 0.00% 89 1321 0.00% 90 1553 0.00% 91 1702 0.00% 92 1932 0.01% 93 2108 0.01% 94 2323 0.01% 95 2527 0.01% 96 2717 0.01% 97 3147 0.01% 98 3184 0.01% 99 3527 0.01% 100 3804 0.01% 101 4167 0.01% 102 4634 0.01% 103 4994 0.01% 104 5546 0.02% 105 5800 0.02% 106 6252 0.02% 107 6524 0.02% 108 6973 0.02% 109 7521 0.02% 110 7820 0.02% 111 8338 0.02% 112 9287 0.03% 113 9918 0.03% 114 10500 0.03% 115 11176 0.03% 116 11850 0.03% 117 12249 0.03% 118 12753 0.03% 119 13392 0.04% 120 14012 0.04% 121 14505 0.04% 122 15497 0.04% 123 16846 0.05% 124 17490 0.05% 125 18396 0.05% 126 19532 0.05% 127 20170 0.05% 128 20751 0.06% 129 21672 0.06% 130 22292 0.06% 131 23569 0.06% 132 24880 0.07% 133 25708 0.07% 134 27404 0.07% 135 28569 0.08% 136 29864 0.08% 137 30966 0.08% 138 31468 0.09% 139 33138 0.09% 140 33449 0.09% 141 34975 0.09% 142 36704 0.10% 143 37794 0.10% 144 39960 0.11% 145 41819 0.11% 146 43572 0.12% 147 44612 0.12% 148 46354 0.13% 149 46882 0.13% 150 47850 0.13% 151 35856341 96.99% 36969992 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=20 prefix-density=0.73 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=25.03 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=25 prefix-density=0.60 prefix-fanout=2.3 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=125.70 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804091 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:41:49 Started mapping on | Dec 10 01:41:49 Finished on | Dec 10 01:47:26 Mapping speed, Million of reads per hour | 394.93 Number of input reads | 36969992 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 34117018 Uniquely mapped reads % | 92.28% Average mapped length | 299.65 Number of splices: Total | 35872160 Number of splices: Annotated (sjdb) | 33803592 Number of splices: GT/AG | 35344047 Number of splices: GC/AG | 431640 Number of splices: AT/AC | 18552 Number of splices: Non-canonical | 77921 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501761 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 36785 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.51% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2351213 2351213 2351213 N_multimapping 501761 501761 501761 N_noFeature 1001343 33137369 1239585 N_ambiguous 904065 6064 162861 UnstrandedReadsAssigned:32211610 PositiveStrandReadsAssigned:973585 NegativeStrandReadsAssigned:32714572 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804091 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804091-trimmed-pair1.fastq SRR7804091-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,969,992 reads, 33,054,942 reads pseudoaligned [quant] estimated average fragment length: 301.064 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR7804091.ke.tsv 35125 SRR7804091.se.tsv 88098 total ==> SRR7804091.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 636.492 0 0 PNS24247 1044 743.936 122.059 6.45708 PNS24249 1928 1627.94 249.497 6.03156 PNS24246 1044 743.936 122.059 6.45708 PNS24248 1044 743.936 122.059 6.45708 PNS24244 1471 1170.94 136.326 4.58192 PNS24243 293 74.4176 1 0.528842 KQK14069 1603 1302.94 719.47 21.7316 KQK14071 474 201.585 0 0 ==> SRR7804091.se.tsv <== BRADI_1g14170v3 741 BRADI_1g53295v3 1597 BRADI_1g59795v3 689 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 3010 BRADI_1g74790v3 838 BRADI_1g09890v3 14 BRADI_1g77505v3 673 BRADI_1g48960v3 0 SRR7804091 completed mapping pipeline successfully