Starting /dee2/code/volunteer_pipeline.sh SRR7804092 current disk space = 1523296333824 free memory = 1601487648 SRR7804092 SRAfilesize 41eaad9bab7a64ff313dc9cc60574a45 SRR7804092.sra SRR7804092.sra file validated SRR7804092 is paired end SRR7804092 is conventional basespace SRR7804092 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804092_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1675 37.0 37.0 37.0 37.0 37.0 2 36.29675 37.0 37.0 37.0 37.0 37.0 3 36.4905 37.0 37.0 37.0 37.0 37.0 4 36.482 37.0 37.0 37.0 37.0 37.0 5 36.57 37.0 37.0 37.0 37.0 37.0 6 36.541 37.0 37.0 37.0 37.0 37.0 7 36.4735 37.0 37.0 37.0 37.0 37.0 8 36.4935 37.0 37.0 37.0 37.0 37.0 9 36.534 37.0 37.0 37.0 37.0 37.0 10-14 36.537699999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5574 37.0 37.0 37.0 37.0 37.0 20-24 36.504 37.0 37.0 37.0 37.0 37.0 25-29 36.4481 37.0 37.0 37.0 37.0 37.0 30-34 36.4548 37.0 37.0 37.0 37.0 37.0 35-39 36.422700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4459 37.0 37.0 37.0 37.0 37.0 45-49 36.4207 37.0 37.0 37.0 37.0 37.0 50-54 36.3798 37.0 37.0 37.0 37.0 37.0 55-59 36.4269 37.0 37.0 37.0 37.0 37.0 60-64 36.37779999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.32379999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2522 37.0 37.0 37.0 37.0 37.0 75-79 36.301500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.231700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1845 37.0 37.0 37.0 37.0 37.0 90-94 36.2193 37.0 37.0 37.0 37.0 37.0 95-99 36.0861 37.0 37.0 37.0 37.0 37.0 100-104 36.1861 37.0 37.0 37.0 37.0 37.0 105-109 36.073 37.0 37.0 37.0 37.0 37.0 110-114 36.051100000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.0066 37.0 37.0 37.0 37.0 37.0 120-124 36.0101 37.0 37.0 37.0 37.0 37.0 125-129 35.9212 37.0 37.0 37.0 37.0 37.0 130-134 35.862700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.854200000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.77850000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.7707 37.0 37.0 37.0 37.0 37.0 150-151 35.304249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 5.0 27 3.0 28 7.0 29 27.0 30 33.0 31 43.0 32 49.0 33 75.0 34 126.0 35 363.0 36 2868.0 37 398.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.075 11.875 9.85 35.199999999999996 2 25.519139354515886 12.95971978984238 31.17338003502627 30.34776082061546 3 21.9 17.075000000000003 24.55 36.475 4 27.200000000000003 22.95 21.0 28.849999999999998 5 26.55 27.975 23.1 22.375 6 24.5 29.175 22.7 23.625 7 19.275000000000002 24.275 37.35 19.1 8 21.525 23.1 28.050000000000004 27.325 9 19.1 21.65 33.125 26.125 10-14 23.195 25.765 25.46 25.580000000000002 15-19 23.47 25.16 24.995 26.375 20-24 23.330000000000002 25.435000000000002 25.009999999999998 26.224999999999998 25-29 24.16 24.555 25.324999999999996 25.96 30-34 23.355 24.395 25.52 26.729999999999997 35-39 23.455000000000002 25.505 24.935 26.105 40-44 23.669999999999998 24.95 25.230000000000004 26.150000000000002 45-49 24.135 24.785 25.215 25.865 50-54 23.64 24.485 24.5 27.375 55-59 23.52 25.195 24.64 26.645000000000003 60-64 24.11 24.94 24.37 26.58 65-69 23.98 24.685000000000002 25.14 26.195 70-74 23.544999999999998 25.445 24.445 26.565 75-79 24.13 24.115000000000002 24.97 26.784999999999997 80-84 23.655 25.130000000000003 24.26 26.955000000000002 85-89 24.21 24.815 24.82 26.155 90-94 24.25 25.06 24.97 25.72 95-99 24.515 24.725 24.59 26.169999999999998 100-104 24.490000000000002 24.41 24.815 26.284999999999997 105-109 24.275 25.0 24.5 26.224999999999998 110-114 24.345 24.39 25.069999999999997 26.195 115-119 24.415 24.779999999999998 24.64 26.165 120-124 24.165 24.14 24.740000000000002 26.955000000000002 125-129 23.830000000000002 24.884999999999998 24.645 26.640000000000004 130-134 24.945 24.905 24.404999999999998 25.745 135-139 24.525 24.834999999999997 24.205 26.435 140-144 24.54 24.654999999999998 24.595 26.21 145-149 25.080000000000002 24.705 24.075 26.14 150-151 25.0375 23.8875 24.525 26.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 1.0 28 4.5 29 7.0 30 6.5 31 6.0 32 10.0 33 15.0 34 20.5 35 29.0 36 45.0 37 65.5 38 75.5 39 87.0 40 109.0 41 132.0 42 144.5 43 157.5 44 187.5 45 214.5 46 209.5 47 200.0 48 189.5 49 171.5 50 155.5 51 135.0 52 128.0 53 134.0 54 129.0 55 107.0 56 104.5 57 94.0 58 73.5 59 65.5 60 60.5 61 63.5 62 64.5 63 56.5 64 52.0 65 53.5 66 50.5 67 53.0 68 52.5 69 50.0 70 47.0 71 37.5 72 32.5 73 26.0 74 17.5 75 15.0 76 13.5 77 11.5 78 9.5 79 6.0 80 4.0 81 2.5 82 0.5 83 2.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.80000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.80711206896551 86.125 2 6.68103448275862 12.4 3 0.4579741379310344 1.275 4 0.05387931034482758 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.5750000000000002 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCAC 10 0.006830828 145.0 5 ATCCACC 10 0.006830828 145.0 6 CCAAATT 10 0.006830828 145.0 2 GTACATG 10 0.006830828 145.0 6 CACCTCA 10 0.006830828 145.0 9 TACCGCT 10 0.006830828 145.0 145 >>END_MODULE SRR7804092 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804092_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32925 37.0 37.0 37.0 37.0 37.0 2 36.148 37.0 37.0 37.0 37.0 37.0 3 36.03 37.0 37.0 37.0 37.0 37.0 4 36.2355 37.0 37.0 37.0 37.0 37.0 5 36.1095 37.0 37.0 37.0 37.0 37.0 6 36.23 37.0 37.0 37.0 37.0 37.0 7 36.1435 37.0 37.0 37.0 37.0 37.0 8 36.236 37.0 37.0 37.0 37.0 37.0 9 36.033 37.0 37.0 37.0 37.0 37.0 10-14 36.1691 37.0 37.0 37.0 37.0 37.0 15-19 36.1023 37.0 37.0 37.0 37.0 37.0 20-24 36.1331 37.0 37.0 37.0 37.0 37.0 25-29 36.0609 37.0 37.0 37.0 37.0 37.0 30-34 36.0058 37.0 37.0 37.0 37.0 37.0 35-39 36.038599999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.9414 37.0 37.0 37.0 37.0 37.0 45-49 35.88029999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.7856 37.0 37.0 37.0 37.0 37.0 55-59 35.7705 37.0 37.0 37.0 37.0 37.0 60-64 35.7943 37.0 37.0 37.0 37.0 37.0 65-69 35.7504 37.0 37.0 37.0 37.0 37.0 70-74 35.731500000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.714999999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.622 37.0 37.0 37.0 37.0 37.0 85-89 35.6925 37.0 37.0 37.0 37.0 37.0 90-94 35.7109 37.0 37.0 37.0 37.0 37.0 95-99 35.604 37.0 37.0 37.0 37.0 37.0 100-104 35.622299999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.610899999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.3921 37.0 37.0 37.0 32.2 37.0 115-119 35.470600000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.4105 37.0 37.0 37.0 37.0 37.0 125-129 35.3324 37.0 37.0 37.0 37.0 37.0 130-134 35.436699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.211099999999995 37.0 37.0 37.0 29.8 37.0 140-144 35.207 37.0 37.0 37.0 27.4 37.0 145-149 35.0516 37.0 37.0 37.0 25.0 37.0 150-151 34.674 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 8.0 15 1.0 16 2.0 17 3.0 18 2.0 19 3.0 20 5.0 21 2.0 22 7.0 23 4.0 24 6.0 25 12.0 26 12.0 27 13.0 28 17.0 29 21.0 30 27.0 31 47.0 32 72.0 33 109.0 34 223.0 35 640.0 36 2591.0 37 171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.478108581436075 17.838378784088064 12.084063047285463 32.59944958719039 2 31.45 23.425 23.7 21.425 3 24.224999999999998 25.900000000000002 26.1 23.775 4 27.224999999999998 28.825 20.3 23.65 5 29.025000000000002 30.599999999999998 18.55 21.825 6 25.074999999999996 35.625 18.025 21.275 7 22.625 19.575 34.575 23.225 8 24.45 22.900000000000002 22.85 29.799999999999997 9 25.825 21.975 25.95 26.25 10-14 26.889999999999997 24.75 22.52 25.840000000000003 15-19 26.615 24.445 23.375 25.564999999999998 20-24 26.825 24.474999999999998 23.51 25.19 25-29 26.71 24.82 23.315 25.155 30-34 26.505000000000003 25.064999999999998 23.830000000000002 24.6 35-39 26.540000000000003 24.865000000000002 23.494999999999997 25.1 40-44 26.669999999999998 25.290000000000003 22.88 25.16 45-49 26.5 25.39 23.155 24.955 50-54 26.640000000000004 25.03 23.665 24.665 55-59 27.435 24.36 23.47 24.735 60-64 26.779999999999998 25.835 23.35 24.035 65-69 27.16 24.93 23.265 24.645 70-74 26.555 24.785 23.835 24.825 75-79 26.064999999999998 25.240000000000002 23.73 24.965 80-84 27.195000000000004 24.73 23.51 24.565 85-89 27.12 24.3 23.715 24.865000000000002 90-94 26.605 24.89 23.615 24.89 95-99 26.77 24.545 23.535 25.15 100-104 26.455000000000002 24.865000000000002 23.625 25.055 105-109 27.195000000000004 24.695 23.369999999999997 24.740000000000002 110-114 27.42 24.63 23.43 24.52 115-119 27.405 24.415 23.425 24.755 120-124 26.58 25.155 23.655 24.610000000000003 125-129 27.175 25.069999999999997 23.61 24.145 130-134 26.974999999999998 24.755 23.52 24.75 135-139 27.07 24.925 23.94 24.065 140-144 26.96 24.51 23.335 25.195 145-149 27.13 25.069999999999997 23.605 24.195 150-151 27.200000000000003 25.087500000000002 23.7875 23.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 1.5 26 1.0 27 1.5 28 2.5 29 5.0 30 6.5 31 6.5 32 7.0 33 11.5 34 20.0 35 23.5 36 36.0 37 49.5 38 63.0 39 84.5 40 107.0 41 134.5 42 145.0 43 145.0 44 167.0 45 170.5 46 168.0 47 172.0 48 165.0 49 162.0 50 142.5 51 135.0 52 132.0 53 128.5 54 117.5 55 114.5 56 108.5 57 89.5 58 83.5 59 84.0 60 82.0 61 77.5 62 78.5 63 75.0 64 70.0 65 66.0 66 66.0 67 64.0 68 70.0 69 67.5 70 52.0 71 45.5 72 41.5 73 33.5 74 28.5 75 20.0 76 12.0 77 9.5 78 7.0 79 4.0 80 6.0 81 5.5 82 1.5 83 1.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.5 97 1.5 98 1.5 99 0.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.87833827893175 86.075 2 6.609117885082277 12.25 3 0.4855678446182897 1.35 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02697599136768276 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.5875 0.0 0.0 0.0 0.0 122-123 0.7125 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.175 0.0 0.0 0.0 0.0 132-133 1.2625 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.5750000000000002 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACTA 10 0.006830828 145.0 4 ACACTAG 10 0.006830828 145.0 5 TTTCACA 10 0.006830828 145.0 1 ACGAGAT 10 0.006830828 145.0 2 CACTAGA 10 0.006830828 145.0 6 ACTAGAG 10 0.006830828 145.0 7 >>END_MODULE Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866644 spots for SRR7804092.sra Written 1866644 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra Read 1866639 spots for SRR7804092.sra Written 1866639 spots for SRR7804092.sra SRR ids: ['SRR7804092.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j0l1f6gp SRR7804092.sra spots: 37332785 blocks: [[1, 1866639], [1866640, 3733278], [3733279, 5599917], [5599918, 7466556], [7466557, 9333195], [9333196, 11199834], [11199835, 13066473], [13066474, 14933112], [14933113, 16799751], [16799752, 18666390], [18666391, 20533029], [20533030, 22399668], [22399669, 24266307], [24266308, 26132946], [26132947, 27999585], [27999586, 29866224], [29866225, 31732863], [31732864, 33599502], [33599503, 35466141], [35466142, 37332785]] SRR7804092 file size 12629155 SRR7804092 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804092 SRR7804092_1.fastq SRR7804092_2.fastq Input file: SRR7804092_1.fastq Paired file: SRR7804092_2.fastq trimmed: SRR7804092-trimmed-pair1.fastq, SRR7804092-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:36:59 2024 >> started Tue Dec 10 01:37:44 2024 >> done (44.167s) 37332785 read pairs processed; of these: 113 ( 0.00%) short read pairs filtered out after trimming by size control 3764 ( 0.01%) empty read pairs filtered out after trimming by size control 37328908 (99.99%) read pairs available; of these: 927487 ( 2.48%) trimmed read pairs available after processing 36401421 (97.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 14 0.00% 20 15 0.00% 21 19 0.00% 22 33 0.00% 23 31 0.00% 24 25 0.00% 25 28 0.00% 26 21 0.00% 27 26 0.00% 28 40 0.00% 29 39 0.00% 30 27 0.00% 31 46 0.00% 32 52 0.00% 33 43 0.00% 34 45 0.00% 35 49 0.00% 36 39 0.00% 37 59 0.00% 38 54 0.00% 39 61 0.00% 40 52 0.00% 41 41 0.00% 42 63 0.00% 43 65 0.00% 44 47 0.00% 45 78 0.00% 46 66 0.00% 47 60 0.00% 48 63 0.00% 49 66 0.00% 50 62 0.00% 51 74 0.00% 52 87 0.00% 53 87 0.00% 54 65 0.00% 55 93 0.00% 56 81 0.00% 57 83 0.00% 58 94 0.00% 59 91 0.00% 60 113 0.00% 61 101 0.00% 62 113 0.00% 63 120 0.00% 64 120 0.00% 65 98 0.00% 66 159 0.00% 67 128 0.00% 68 153 0.00% 69 160 0.00% 70 165 0.00% 71 183 0.00% 72 221 0.00% 73 249 0.00% 74 255 0.00% 75 244 0.00% 76 312 0.00% 77 334 0.00% 78 381 0.00% 79 403 0.00% 80 504 0.00% 81 498 0.00% 82 585 0.00% 83 662 0.00% 84 745 0.00% 85 838 0.00% 86 834 0.00% 87 904 0.00% 88 1047 0.00% 89 1162 0.00% 90 1309 0.00% 91 1473 0.00% 92 1537 0.00% 93 1814 0.00% 94 1949 0.01% 95 2191 0.01% 96 2371 0.01% 97 2601 0.01% 98 2700 0.01% 99 2926 0.01% 100 3221 0.01% 101 3312 0.01% 102 3792 0.01% 103 4171 0.01% 104 4568 0.01% 105 4758 0.01% 106 5019 0.01% 107 5418 0.01% 108 5916 0.02% 109 6135 0.02% 110 6601 0.02% 111 7078 0.02% 112 7592 0.02% 113 8112 0.02% 114 8547 0.02% 115 9104 0.02% 116 9660 0.03% 117 9923 0.03% 118 10574 0.03% 119 11221 0.03% 120 11338 0.03% 121 12369 0.03% 122 12551 0.03% 123 13675 0.04% 124 14580 0.04% 125 15325 0.04% 126 16052 0.04% 127 16810 0.05% 128 17184 0.05% 129 18039 0.05% 130 18704 0.05% 131 19521 0.05% 132 20490 0.05% 133 21475 0.06% 134 22508 0.06% 135 23947 0.06% 136 24789 0.07% 137 25812 0.07% 138 26469 0.07% 139 27147 0.07% 140 28551 0.08% 141 29332 0.08% 142 30731 0.08% 143 31806 0.09% 144 33010 0.09% 145 35226 0.09% 146 35956 0.10% 147 36895 0.10% 148 38416 0.10% 149 38727 0.10% 150 40469 0.11% 151 36401421 97.52% 37328908 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=26 prefix-density=0.23 prefix-fanout=3.0 sequence=CCAGTCTCCCTGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=79.74 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=19.1 sequence=TTCTCCTCCTTG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=21 prefix-density=0.42 prefix-fanout=3.2 sequence=AAGATGTACCCAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=13 fanout-score=158.75 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=23.4 sequence=CGCCGCCGCCGTCG SRR7804092 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:38:45 Started mapping on | Dec 10 01:38:46 Finished on | Dec 10 01:44:13 Mapping speed, Million of reads per hour | 410.96 Number of input reads | 37328908 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 34607305 Uniquely mapped reads % | 92.71% Average mapped length | 299.87 Number of splices: Total | 37075844 Number of splices: Annotated (sjdb) | 34968731 Number of splices: GT/AG | 36566679 Number of splices: GC/AG | 411520 Number of splices: AT/AC | 17348 Number of splices: Non-canonical | 80297 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 491005 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 28705 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.31% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2230598 2230598 2230598 N_multimapping 491005 491005 491005 N_noFeature 1160893 33667725 1440792 N_ambiguous 791691 5312 134319 UnstrandedReadsAssigned:32654721 PositiveStrandReadsAssigned:934268 NegativeStrandReadsAssigned:33032194 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804092 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804092-trimmed-pair1.fastq SRR7804092-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,328,908 reads, 33,357,038 reads pseudoaligned [quant] estimated average fragment length: 308.786 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,256 rounds 52973 SRR7804092.ke.tsv 35125 SRR7804092.se.tsv 88098 total ==> SRR7804092.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 628.863 0 0 PNS24247 1044 736.214 112.404 6.37408 PNS24249 1928 1620.21 337.571 8.69823 PNS24246 1044 736.214 112.404 6.37408 PNS24248 1044 736.214 112.404 6.37408 PNS24244 1471 1163.21 167.217 6.00148 PNS24243 293 71.5515 0 0 KQK14069 1603 1295.21 309.125 9.96393 KQK14071 474 196.391 1.32878 0.282468 ==> SRR7804092.se.tsv <== BRADI_1g14170v3 328 BRADI_1g53295v3 2028 BRADI_1g59795v3 471 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 4261 BRADI_1g74790v3 4282 BRADI_1g09890v3 0 BRADI_1g77505v3 353 BRADI_1g48960v3 0 SRR7804092 completed mapping pipeline successfully