Starting /dee2/code/volunteer_pipeline.sh SRR7804093 current disk space = 1541710712832 free memory = 1601038260 SRR7804093 SRAfilesize a5f3f7c3169b673e3a6c2add4cd5144d SRR7804093.sra SRR7804093.sra file validated SRR7804093 is paired end SRR7804093 is conventional basespace SRR7804093 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804093_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2165 37.0 37.0 37.0 37.0 37.0 2 36.3325 37.0 37.0 37.0 37.0 37.0 3 36.435 37.0 37.0 37.0 37.0 37.0 4 36.4835 37.0 37.0 37.0 37.0 37.0 5 36.4845 37.0 37.0 37.0 37.0 37.0 6 36.467 37.0 37.0 37.0 37.0 37.0 7 36.482 37.0 37.0 37.0 37.0 37.0 8 36.498 37.0 37.0 37.0 37.0 37.0 9 36.561 37.0 37.0 37.0 37.0 37.0 10-14 36.4971 37.0 37.0 37.0 37.0 37.0 15-19 36.490399999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4755 37.0 37.0 37.0 37.0 37.0 25-29 36.4316 37.0 37.0 37.0 37.0 37.0 30-34 36.3672 37.0 37.0 37.0 37.0 37.0 35-39 36.3999 37.0 37.0 37.0 37.0 37.0 40-44 36.4302 37.0 37.0 37.0 37.0 37.0 45-49 36.3535 37.0 37.0 37.0 37.0 37.0 50-54 36.3229 37.0 37.0 37.0 37.0 37.0 55-59 36.3104 37.0 37.0 37.0 37.0 37.0 60-64 36.259 37.0 37.0 37.0 37.0 37.0 65-69 36.2392 37.0 37.0 37.0 37.0 37.0 70-74 36.229200000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.2342 37.0 37.0 37.0 37.0 37.0 80-84 36.10530000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1499 37.0 37.0 37.0 37.0 37.0 90-94 36.0889 37.0 37.0 37.0 37.0 37.0 95-99 36.104699999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1476 37.0 37.0 37.0 37.0 37.0 105-109 36.0358 37.0 37.0 37.0 37.0 37.0 110-114 36.0197 37.0 37.0 37.0 37.0 37.0 115-119 36.038599999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.948800000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.8861 37.0 37.0 37.0 37.0 37.0 130-134 35.827600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.765699999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.749 37.0 37.0 37.0 37.0 37.0 145-149 35.7325 37.0 37.0 37.0 37.0 37.0 150-151 35.25575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 0.0 24 1.0 25 4.0 26 6.0 27 8.0 28 9.0 29 23.0 30 39.0 31 49.0 32 50.0 33 86.0 34 140.0 35 328.0 36 2882.0 37 373.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.175000000000004 11.450000000000001 8.3 38.074999999999996 2 25.850850850850847 14.314314314314313 28.803803803803802 31.03103103103103 3 21.425 17.575 25.025 35.975 4 26.325 24.025 20.175 29.475 5 26.375 27.325 22.525000000000002 23.775 6 24.125 30.2 22.625 23.05 7 19.325 23.75 38.6 18.325 8 21.4 22.45 28.825 27.325 9 20.925 21.425 31.574999999999996 26.075 10-14 23.97 25.635 25.035 25.36 15-19 23.66 24.935 25.324999999999996 26.08 20-24 23.49 25.09 25.124999999999996 26.295 25-29 23.425 25.31 24.975 26.290000000000003 30-34 23.974999999999998 24.955 25.105 25.965 35-39 24.12 25.074999999999996 24.505 26.3 40-44 23.965 24.765 25.205 26.064999999999998 45-49 23.885 25.135 24.745 26.235000000000003 50-54 24.46 24.560000000000002 24.985 25.995 55-59 23.425 24.955 24.515 27.105 60-64 23.74 25.369999999999997 24.635 26.255 65-69 23.875 25.230000000000004 24.62 26.275 70-74 23.885 24.165 25.25 26.700000000000003 75-79 24.104999999999997 23.745 24.905 27.245 80-84 24.13 24.615000000000002 24.65 26.605 85-89 24.515 24.705 24.69 26.090000000000003 90-94 24.805 24.07 24.355 26.77 95-99 24.43 24.615000000000002 24.7 26.255 100-104 24.965 23.755000000000003 25.09 26.19 105-109 24.93 24.044999999999998 24.310000000000002 26.715 110-114 24.345 24.654999999999998 24.265 26.735 115-119 25.345000000000002 24.18 24.310000000000002 26.165 120-124 25.035 24.065 23.76 27.139999999999997 125-129 24.8 23.765 24.5 26.935 130-134 25.445 24.07 23.98 26.505000000000003 135-139 25.240000000000002 23.945 24.445 26.369999999999997 140-144 25.415 23.375 24.81 26.400000000000002 145-149 25.324999999999996 23.625 24.884999999999998 26.165 150-151 25.0625 23.5125 24.2625 27.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.0 28 2.5 29 2.5 30 3.5 31 7.0 32 14.0 33 17.5 34 20.5 35 30.0 36 39.0 37 53.5 38 69.5 39 97.5 40 118.5 41 140.0 42 166.0 43 182.0 44 184.5 45 175.0 46 184.0 47 183.0 48 163.0 49 164.0 50 155.0 51 130.5 52 135.0 53 137.5 54 112.0 55 83.0 56 82.0 57 87.5 58 78.0 59 83.5 60 92.0 61 90.0 62 79.0 63 76.0 64 75.5 65 60.5 66 58.5 67 63.5 68 59.0 69 51.5 70 47.5 71 34.0 72 24.5 73 19.5 74 14.5 75 14.5 76 10.0 77 7.0 78 7.0 79 4.5 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.9 #Duplication Level Percentage of deduplicated Percentage of total 1 93.29924650161465 86.675 2 5.81270182992465 10.8 3 0.8342303552206674 2.325 4 0.05382131324004305 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.3875000000000002 0.0 0.0 0.0 0.0 134-135 1.4874999999999998 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138-139 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTTC 10 0.006830828 145.0 5 AATTTCC 10 0.006830828 145.0 6 GGCAAAT 10 0.006830828 145.0 2 TAGAGAA 10 0.006830828 145.0 145 CAAATTT 10 0.006830828 145.0 4 TTTCCAG 20 3.5877043E-4 108.75 8 >>END_MODULE SRR7804093 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804093_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32275 37.0 37.0 37.0 37.0 37.0 2 36.1635 37.0 37.0 37.0 37.0 37.0 3 36.1775 37.0 37.0 37.0 37.0 37.0 4 36.2935 37.0 37.0 37.0 37.0 37.0 5 36.2225 37.0 37.0 37.0 37.0 37.0 6 36.213 37.0 37.0 37.0 37.0 37.0 7 36.1195 37.0 37.0 37.0 37.0 37.0 8 36.352 37.0 37.0 37.0 37.0 37.0 9 36.1345 37.0 37.0 37.0 37.0 37.0 10-14 36.260000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.142700000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.1852 37.0 37.0 37.0 37.0 37.0 25-29 36.153099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.08910000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.1118 37.0 37.0 37.0 37.0 37.0 40-44 36.057599999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9809 37.0 37.0 37.0 37.0 37.0 50-54 35.962900000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.908300000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.912600000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.886799999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.8898 37.0 37.0 37.0 37.0 37.0 75-79 35.910399999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.857800000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.897200000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.851 37.0 37.0 37.0 37.0 37.0 95-99 35.7848 37.0 37.0 37.0 37.0 37.0 100-104 35.797900000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.7449 37.0 37.0 37.0 37.0 37.0 110-114 35.6224 37.0 37.0 37.0 37.0 37.0 115-119 35.6333 37.0 37.0 37.0 37.0 37.0 120-124 35.570299999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5366 37.0 37.0 37.0 37.0 37.0 130-134 35.586200000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.4595 37.0 37.0 37.0 37.0 37.0 140-144 35.38869999999999 37.0 37.0 37.0 34.6 37.0 145-149 35.184000000000005 37.0 37.0 37.0 27.4 37.0 150-151 34.7425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 9.0 14 1.0 15 3.0 16 1.0 17 1.0 18 1.0 19 0.0 20 4.0 21 5.0 22 9.0 23 4.0 24 8.0 25 5.0 26 2.0 27 11.0 28 15.0 29 18.0 30 36.0 31 38.0 32 65.0 33 86.0 34 184.0 35 569.0 36 2675.0 37 248.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.15211408556417 19.439579684763572 11.758819114335752 32.6494871153365 2 30.099999999999998 23.325000000000003 24.075 22.5 3 23.075000000000003 25.174999999999997 26.775 24.975 4 27.474999999999998 29.099999999999998 19.2 24.224999999999998 5 29.275000000000002 29.175 18.775 22.775000000000002 6 24.25 34.375 19.175 22.2 7 23.175 19.275000000000002 33.050000000000004 24.5 8 25.6 20.674999999999997 22.3 31.424999999999997 9 23.849999999999998 21.85 27.625 26.674999999999997 10-14 26.724999999999998 24.709999999999997 22.145 26.419999999999998 15-19 25.915 25.040000000000003 23.375 25.669999999999998 20-24 26.86 24.560000000000002 23.035 25.545 25-29 25.935000000000002 25.230000000000004 22.985 25.85 30-34 26.19 24.86 23.169999999999998 25.779999999999998 35-39 26.085 25.195 23.055 25.665 40-44 27.139999999999997 24.055 22.814999999999998 25.990000000000002 45-49 26.96 24.69 22.634999999999998 25.715 50-54 26.375 24.7 23.075000000000003 25.85 55-59 27.105 23.835 22.830000000000002 26.229999999999997 60-64 26.77 24.709999999999997 22.685 25.835 65-69 26.515 23.965 23.105 26.415 70-74 27.595 23.95 22.919999999999998 25.535000000000004 75-79 26.75 24.23 23.205000000000002 25.814999999999998 80-84 27.169999999999998 24.425 22.994999999999997 25.41 85-89 27.195000000000004 24.485 22.74 25.580000000000002 90-94 26.82 24.66 23.05 25.47 95-99 26.935 24.349999999999998 23.044999999999998 25.669999999999998 100-104 26.724999999999998 24.58 22.555 26.14 105-109 27.005000000000003 24.104999999999997 23.035 25.855 110-114 26.77 24.959999999999997 22.735 25.535000000000004 115-119 27.284999999999997 24.65 22.625 25.44 120-124 26.974999999999998 24.42 23.56 25.045 125-129 26.884999999999998 25.15 23.105 24.86 130-134 26.855 25.455 22.830000000000002 24.86 135-139 27.065 24.89 23.255 24.79 140-144 26.66 24.645 23.82 24.875 145-149 27.860000000000003 24.82 22.89 24.43 150-151 26.4625 24.55 23.3 25.687500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.5 28 2.0 29 1.5 30 3.5 31 6.0 32 8.5 33 12.5 34 16.0 35 23.5 36 31.0 37 36.5 38 54.5 39 78.5 40 101.5 41 122.0 42 126.0 43 135.5 44 159.5 45 171.5 46 167.5 47 162.0 48 151.0 49 150.5 50 151.5 51 133.0 52 123.5 53 115.0 54 111.5 55 112.0 56 94.5 57 88.5 58 98.0 59 92.5 60 91.0 61 89.5 62 86.0 63 99.5 64 94.0 65 89.5 66 86.0 67 70.0 68 75.0 69 70.5 70 55.5 71 50.0 72 44.5 73 40.0 74 33.5 75 25.0 76 15.0 77 9.0 78 7.0 79 4.5 80 3.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.14624932541824 86.3 2 5.963302752293578 11.05 3 0.7285483000539665 2.025 4 0.13491635186184567 0.5 5 0.026983270372369132 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.3875000000000002 0.0 0.0 0.0 0.0 134-135 1.4874999999999998 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCAG 10 0.006830828 145.0 5 TCCAGGG 10 0.006830828 145.0 7 CAGGGAC 10 0.006830828 145.0 9 TCTTCCC 10 0.006830828 145.0 145 CCCCCCC 20 0.00593511 29.0 80-84 >>END_MODULE Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra Read 1963262 spots for SRR7804093.sra Written 1963262 spots for SRR7804093.sra Read 1963244 spots for SRR7804093.sra Written 1963244 spots for SRR7804093.sra SRR ids: ['SRR7804093.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iyohesug SRR7804093.sra spots: 39264898 blocks: [[1, 1963244], [1963245, 3926488], [3926489, 5889732], [5889733, 7852976], [7852977, 9816220], [9816221, 11779464], [11779465, 13742708], [13742709, 15705952], [15705953, 17669196], [17669197, 19632440], [19632441, 21595684], [21595685, 23558928], [23558929, 25522172], [25522173, 27485416], [27485417, 29448660], [29448661, 31411904], [31411905, 33375148], [33375149, 35338392], [35338393, 37301636], [37301637, 39264898]] SRR7804093 file size 13283885 SRR7804093 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804093 SRR7804093_1.fastq SRR7804093_2.fastq Input file: SRR7804093_1.fastq Paired file: SRR7804093_2.fastq trimmed: SRR7804093-trimmed-pair1.fastq, SRR7804093-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:46:20 2024 >> started Sat Dec 7 16:47:01 2024 >> done (41.709s) 39264898 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 3143 ( 0.01%) empty read pairs filtered out after trimming by size control 39261651 (99.99%) read pairs available; of these: 1172961 ( 2.99%) trimmed read pairs available after processing 38088690 (97.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 13 0.00% 20 12 0.00% 21 16 0.00% 22 15 0.00% 23 25 0.00% 24 12 0.00% 25 25 0.00% 26 17 0.00% 27 24 0.00% 28 26 0.00% 29 17 0.00% 30 26 0.00% 31 26 0.00% 32 30 0.00% 33 30 0.00% 34 29 0.00% 35 40 0.00% 36 30 0.00% 37 35 0.00% 38 51 0.00% 39 30 0.00% 40 43 0.00% 41 40 0.00% 42 52 0.00% 43 37 0.00% 44 38 0.00% 45 35 0.00% 46 41 0.00% 47 47 0.00% 48 54 0.00% 49 54 0.00% 50 53 0.00% 51 38 0.00% 52 64 0.00% 53 60 0.00% 54 55 0.00% 55 50 0.00% 56 59 0.00% 57 78 0.00% 58 57 0.00% 59 65 0.00% 60 94 0.00% 61 79 0.00% 62 82 0.00% 63 108 0.00% 64 99 0.00% 65 103 0.00% 66 115 0.00% 67 105 0.00% 68 101 0.00% 69 143 0.00% 70 123 0.00% 71 174 0.00% 72 198 0.00% 73 214 0.00% 74 227 0.00% 75 248 0.00% 76 266 0.00% 77 327 0.00% 78 338 0.00% 79 375 0.00% 80 450 0.00% 81 493 0.00% 82 555 0.00% 83 697 0.00% 84 739 0.00% 85 843 0.00% 86 885 0.00% 87 1023 0.00% 88 1076 0.00% 89 1211 0.00% 90 1392 0.00% 91 1561 0.00% 92 1688 0.00% 93 1944 0.00% 94 2208 0.01% 95 2378 0.01% 96 2660 0.01% 97 2934 0.01% 98 3060 0.01% 99 3432 0.01% 100 3609 0.01% 101 4068 0.01% 102 4450 0.01% 103 4903 0.01% 104 5277 0.01% 105 5569 0.01% 106 6155 0.02% 107 6432 0.02% 108 6833 0.02% 109 7387 0.02% 110 7943 0.02% 111 8503 0.02% 112 9123 0.02% 113 9818 0.03% 114 10230 0.03% 115 11327 0.03% 116 11958 0.03% 117 12599 0.03% 118 13063 0.03% 119 13946 0.04% 120 14543 0.04% 121 15295 0.04% 122 16081 0.04% 123 17193 0.04% 124 18345 0.05% 125 19122 0.05% 126 20290 0.05% 127 21152 0.05% 128 21740 0.06% 129 23076 0.06% 130 23817 0.06% 131 25040 0.06% 132 26015 0.07% 133 27673 0.07% 134 28981 0.07% 135 30170 0.08% 136 31584 0.08% 137 32686 0.08% 138 34071 0.09% 139 35250 0.09% 140 36274 0.09% 141 37275 0.09% 142 39866 0.10% 143 41428 0.11% 144 42908 0.11% 145 45483 0.12% 146 46471 0.12% 147 48368 0.12% 148 49818 0.13% 149 50793 0.13% 150 52653 0.13% 151 38088690 97.01% 39261651 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=27 prefix-density=0.81 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=30.36 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.2 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=112.45 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.2 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804093 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:48:14 Started mapping on | Dec 07 16:48:14 Finished on | Dec 07 16:54:12 Mapping speed, Million of reads per hour | 394.81 Number of input reads | 39261651 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 36474102 Uniquely mapped reads % | 92.90% Average mapped length | 299.79 Number of splices: Total | 38897342 Number of splices: Annotated (sjdb) | 36744795 Number of splices: GT/AG | 38322551 Number of splices: GC/AG | 472302 Number of splices: AT/AC | 18320 Number of splices: Non-canonical | 84169 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 560184 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 40804 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.81% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2227365 2227365 2227365 N_multimapping 560184 560184 560184 N_noFeature 1131710 35427042 1380169 N_ambiguous 971654 5835 173409 UnstrandedReadsAssigned:34370738 PositiveStrandReadsAssigned:1041225 NegativeStrandReadsAssigned:34920524 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804093 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804093-trimmed-pair1.fastq SRR7804093-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,261,651 reads, 35,173,183 reads pseudoaligned [quant] estimated average fragment length: 298.313 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR7804093.ke.tsv 35125 SRR7804093.se.tsv 88098 total ==> SRR7804093.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 639.228 0 0 PNS24247 1044 746.687 170.741 8.3589 PNS24249 1928 1630.69 138.854 3.1127 PNS24246 1044 746.687 170.741 8.3589 PNS24248 1044 746.687 170.741 8.3589 PNS24244 1471 1173.69 257.924 8.03322 PNS24243 293 74.4192 0 0 KQK14069 1603 1305.69 882.209 24.6992 KQK14071 474 204.619 13.7903 2.46363 ==> SRR7804093.se.tsv <== BRADI_1g14170v3 926 BRADI_1g53295v3 1988 BRADI_1g59795v3 1138 BRADI_1g07683v3 2 BRADI_1g00485v3 41 BRADI_1g20270v3 2902 BRADI_1g74790v3 1304 BRADI_1g09890v3 10 BRADI_1g77505v3 731 BRADI_1g48960v3 1 SRR7804093 completed mapping pipeline successfully