Starting /dee2/code/volunteer_pipeline.sh SRR7804094 current disk space = 1523361185792 free memory = 1567960060 SRR7804094 SRAfilesize 8d0aa2a49382b3dfde72a005dad4c46b SRR7804094.sra SRR7804094.sra file validated SRR7804094 is paired end SRR7804094 is conventional basespace SRR7804094 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804094_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.129 37.0 37.0 37.0 37.0 37.0 2 36.0935 37.0 37.0 37.0 37.0 37.0 3 36.3955 37.0 37.0 37.0 37.0 37.0 4 36.4695 37.0 37.0 37.0 37.0 37.0 5 36.532 37.0 37.0 37.0 37.0 37.0 6 36.3915 37.0 37.0 37.0 37.0 37.0 7 36.3995 37.0 37.0 37.0 37.0 37.0 8 36.4755 37.0 37.0 37.0 37.0 37.0 9 36.4515 37.0 37.0 37.0 37.0 37.0 10-14 36.46470000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.454600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4628 37.0 37.0 37.0 37.0 37.0 25-29 36.3474 37.0 37.0 37.0 37.0 37.0 30-34 36.3538 37.0 37.0 37.0 37.0 37.0 35-39 36.3843 37.0 37.0 37.0 37.0 37.0 40-44 36.3596 37.0 37.0 37.0 37.0 37.0 45-49 36.3578 37.0 37.0 37.0 37.0 37.0 50-54 36.3418 37.0 37.0 37.0 37.0 37.0 55-59 36.2723 37.0 37.0 37.0 37.0 37.0 60-64 36.2753 37.0 37.0 37.0 37.0 37.0 65-69 36.2519 37.0 37.0 37.0 37.0 37.0 70-74 36.2358 37.0 37.0 37.0 37.0 37.0 75-79 36.1939 37.0 37.0 37.0 37.0 37.0 80-84 36.121700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.11200000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.1027 37.0 37.0 37.0 37.0 37.0 95-99 36.072 37.0 37.0 37.0 37.0 37.0 100-104 36.089999999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0087 37.0 37.0 37.0 37.0 37.0 110-114 35.956599999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.971399999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.879 37.0 37.0 37.0 37.0 37.0 125-129 35.873400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.842499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.777 37.0 37.0 37.0 37.0 37.0 140-144 35.71040000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.7512 37.0 37.0 37.0 37.0 37.0 150-151 35.241 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 5.0 26 5.0 27 11.0 28 11.0 29 26.0 30 35.0 31 49.0 32 71.0 33 89.0 34 139.0 35 320.0 36 2830.0 37 406.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.75 11.799999999999999 9.3 32.15 2 27.466199298948425 13.26990485728593 30.57085628442664 28.693039559339006 3 23.775 16.825000000000003 23.5 35.9 4 28.299999999999997 23.95 20.325 27.425 5 28.525 25.650000000000002 23.325000000000003 22.5 6 24.05 29.325000000000003 23.05 23.575 7 21.8 23.1 35.775 19.325 8 23.974999999999998 22.0 28.000000000000004 26.025 9 21.275 20.125 31.874999999999996 26.724999999999998 10-14 24.834999999999997 24.465 24.125 26.575 15-19 25.069999999999997 23.285 25.130000000000003 26.515 20-24 25.040000000000003 24.585 23.580000000000002 26.795 25-29 25.259999999999998 24.085 24.23 26.424999999999997 30-34 25.165 23.75 24.48 26.605 35-39 25.369999999999997 23.56 23.87 27.200000000000003 40-44 25.724999999999998 23.695 23.919999999999998 26.66 45-49 25.435000000000002 23.455000000000002 24.615000000000002 26.495 50-54 25.275 23.535 23.555 27.634999999999998 55-59 25.575 22.38 24.9 27.145000000000003 60-64 25.535000000000004 23.115 23.925 27.425 65-69 25.305 24.23 23.875 26.590000000000003 70-74 26.39 23.635 22.99 26.985 75-79 25.569999999999997 23.919999999999998 23.365 27.145000000000003 80-84 25.77 23.62 23.380000000000003 27.229999999999997 85-89 26.0 23.080000000000002 24.11 26.810000000000002 90-94 26.405 22.830000000000002 23.794999999999998 26.97 95-99 25.765 23.235 23.565 27.435 100-104 25.905 22.95 23.895 27.250000000000004 105-109 26.619999999999997 22.85 24.185000000000002 26.345000000000002 110-114 26.369999999999997 23.32 23.115 27.195000000000004 115-119 26.369999999999997 23.305 23.49 26.834999999999997 120-124 25.965 23.01 23.54 27.485 125-129 25.974999999999998 22.965 23.565 27.495000000000005 130-134 26.740000000000002 23.175 23.04 27.045 135-139 26.490000000000002 22.235 24.13 27.145000000000003 140-144 26.795 23.0 23.525 26.68 145-149 27.265 22.53 23.49 26.715 150-151 27.487499999999997 22.175 22.787499999999998 27.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.0 28 2.0 29 3.5 30 3.0 31 4.5 32 8.5 33 15.0 34 19.0 35 22.5 36 32.0 37 44.5 38 57.0 39 71.0 40 83.5 41 91.0 42 115.5 43 140.5 44 154.5 45 155.0 46 173.5 47 179.5 48 157.0 49 157.0 50 148.0 51 140.0 52 121.5 53 107.0 54 109.5 55 97.0 56 92.0 57 96.0 58 103.5 59 114.0 60 110.0 61 103.5 62 103.0 63 94.0 64 90.5 65 100.5 66 99.0 67 92.5 68 76.5 69 62.5 70 62.0 71 43.5 72 31.0 73 31.0 74 23.5 75 17.0 76 12.0 77 9.0 78 6.0 79 3.0 80 2.0 81 1.5 82 1.0 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 91.53468050245768 83.8 2 7.755324959038777 14.2 3 0.6553795740032768 1.7999999999999998 4 0.05461496450027307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.9874999999999999 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCCTC 10 0.006830828 145.0 9 GTTACAC 10 0.006830828 145.0 1 >>END_MODULE SRR7804094 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804094_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33 37.0 37.0 37.0 37.0 37.0 2 36.065 37.0 37.0 37.0 37.0 37.0 3 35.8865 37.0 37.0 37.0 37.0 37.0 4 36.212 37.0 37.0 37.0 37.0 37.0 5 35.996 37.0 37.0 37.0 37.0 37.0 6 36.216 37.0 37.0 37.0 37.0 37.0 7 36.02 37.0 37.0 37.0 37.0 37.0 8 36.2085 37.0 37.0 37.0 37.0 37.0 9 36.067 37.0 37.0 37.0 37.0 37.0 10-14 36.117599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.0022 37.0 37.0 37.0 37.0 37.0 20-24 36.1104 37.0 37.0 37.0 37.0 37.0 25-29 36.047 37.0 37.0 37.0 37.0 37.0 30-34 36.062200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.0092 37.0 37.0 37.0 37.0 37.0 40-44 35.988600000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.9222 37.0 37.0 37.0 37.0 37.0 50-54 35.8599 37.0 37.0 37.0 37.0 37.0 55-59 35.8013 37.0 37.0 37.0 37.0 37.0 60-64 35.8471 37.0 37.0 37.0 37.0 37.0 65-69 35.7778 37.0 37.0 37.0 37.0 37.0 70-74 35.81529999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.7899 37.0 37.0 37.0 37.0 37.0 80-84 35.7552 37.0 37.0 37.0 37.0 37.0 85-89 35.7368 37.0 37.0 37.0 37.0 37.0 90-94 35.6655 37.0 37.0 37.0 37.0 37.0 95-99 35.6481 37.0 37.0 37.0 37.0 37.0 100-104 35.6426 37.0 37.0 37.0 37.0 37.0 105-109 35.4981 37.0 37.0 37.0 37.0 37.0 110-114 35.392399999999995 37.0 37.0 37.0 34.6 37.0 115-119 35.466 37.0 37.0 37.0 37.0 37.0 120-124 35.429199999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.373000000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.3746 37.0 37.0 37.0 37.0 37.0 135-139 35.2891 37.0 37.0 37.0 32.2 37.0 140-144 35.227199999999996 37.0 37.0 37.0 27.4 37.0 145-149 35.05929999999999 37.0 37.0 37.0 25.0 37.0 150-151 34.53375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 1.0 16 5.0 17 0.0 18 2.0 19 0.0 20 3.0 21 7.0 22 5.0 23 5.0 24 9.0 25 6.0 26 9.0 27 23.0 28 14.0 29 26.0 30 28.0 31 62.0 32 84.0 33 98.0 34 224.0 35 610.0 36 2580.0 37 193.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.11955977988995 18.959479739869938 9.429714857428714 32.491245622811405 2 33.0 22.275 22.325 22.400000000000002 3 25.474999999999998 24.125 24.975 25.424999999999997 4 28.15 28.475 17.825 25.55 5 28.525 30.425 17.7 23.35 6 24.55 33.35 18.625 23.474999999999998 7 23.5 18.425 32.925 25.15 8 24.775 22.325 20.9 32.0 9 25.575 21.875 23.549999999999997 28.999999999999996 10-14 26.91 24.305 21.135 27.650000000000002 15-19 27.105 24.14 22.085 26.669999999999998 20-24 26.325 25.095 22.08 26.5 25-29 26.52 24.36 21.555 27.565 30-34 27.400000000000002 23.91 21.815 26.875 35-39 26.765 24.025 21.495 27.715 40-44 27.185 23.880000000000003 21.675 27.26 45-49 28.225 23.565 20.95 27.26 50-54 27.015 23.400000000000002 22.005 27.58 55-59 27.72 23.575 21.165 27.54 60-64 27.150000000000002 23.66 22.009999999999998 27.18 65-69 27.145000000000003 23.505000000000003 21.759999999999998 27.589999999999996 70-74 27.11 23.35 21.83 27.71 75-79 27.13 23.06 21.38 28.43 80-84 27.13 23.075000000000003 22.25 27.544999999999998 85-89 26.924999999999997 23.195 21.965 27.915 90-94 27.084999999999997 23.565 21.73 27.62 95-99 27.42 23.385 21.905 27.29 100-104 27.16 23.385 21.75 27.705000000000002 105-109 27.68 23.28 21.94 27.1 110-114 27.435 24.12 21.65 26.795 115-119 27.884999999999998 24.415 21.185000000000002 26.515 120-124 27.779999999999998 23.69 21.72 26.810000000000002 125-129 27.3 24.709999999999997 21.595 26.395000000000003 130-134 27.650000000000002 23.61 22.015 26.724999999999998 135-139 27.284999999999997 23.880000000000003 22.07 26.765 140-144 28.189999999999998 24.035 21.584999999999997 26.19 145-149 27.810000000000002 23.94 21.875 26.375 150-151 27.900000000000002 23.6875 22.1375 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 0.5 21 1.0 22 0.5 23 1.0 24 1.0 25 0.5 26 1.0 27 0.5 28 2.5 29 3.0 30 3.0 31 5.5 32 6.5 33 8.0 34 12.5 35 15.5 36 26.0 37 40.5 38 47.5 39 58.5 40 71.0 41 79.0 42 95.5 43 123.0 44 127.5 45 131.0 46 133.5 47 121.5 48 125.5 49 120.5 50 116.5 51 126.5 52 104.0 53 97.0 54 127.5 55 122.5 56 100.0 57 99.5 58 106.0 59 111.5 60 131.0 61 135.5 62 124.5 63 129.0 64 127.5 65 110.5 66 98.5 67 91.0 68 91.0 69 96.0 70 87.0 71 68.5 72 52.5 73 49.0 74 42.0 75 23.5 76 14.5 77 11.5 78 8.0 79 8.0 80 5.5 81 2.5 82 2.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.95 #Duplication Level Percentage of deduplicated Percentage of total 1 90.49471928849361 81.39999999999999 2 8.282379099499721 14.899999999999999 3 0.9171762090050029 2.475 4 0.19455252918287938 0.7000000000000001 5 0.08337965536409116 0.375 6 0.027793218454697052 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit CAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.9874999999999999 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCC 10 0.006830828 145.0 3 >>END_MODULE Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079947 spots for SRR7804094.sra Written 2079947 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra Read 2079942 spots for SRR7804094.sra Written 2079942 spots for SRR7804094.sra SRR ids: ['SRR7804094.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mjwcee6l SRR7804094.sra spots: 41598845 blocks: [[1, 2079942], [2079943, 4159884], [4159885, 6239826], [6239827, 8319768], [8319769, 10399710], [10399711, 12479652], [12479653, 14559594], [14559595, 16639536], [16639537, 18719478], [18719479, 20799420], [20799421, 22879362], [22879363, 24959304], [24959305, 27039246], [27039247, 29119188], [29119189, 31199130], [31199131, 33279072], [33279073, 35359014], [35359015, 37438956], [37438957, 39518898], [39518899, 41598845]] SRR7804094 file size 14074783 SRR7804094 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804094 SRR7804094_1.fastq SRR7804094_2.fastq Input file: SRR7804094_1.fastq Paired file: SRR7804094_2.fastq trimmed: SRR7804094-trimmed-pair1.fastq, SRR7804094-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:42:01 2024 >> started Tue Dec 10 01:42:50 2024 >> done (48.742s) 41598845 read pairs processed; of these: 156 ( 0.00%) short read pairs filtered out after trimming by size control 1134 ( 0.00%) empty read pairs filtered out after trimming by size control 41597555 (100.00%) read pairs available; of these: 1131357 ( 2.72%) trimmed read pairs available after processing 40466198 (97.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 16 0.00% 20 15 0.00% 21 24 0.00% 22 20 0.00% 23 26 0.00% 24 28 0.00% 25 22 0.00% 26 39 0.00% 27 29 0.00% 28 31 0.00% 29 33 0.00% 30 53 0.00% 31 31 0.00% 32 39 0.00% 33 35 0.00% 34 33 0.00% 35 40 0.00% 36 40 0.00% 37 55 0.00% 38 52 0.00% 39 51 0.00% 40 46 0.00% 41 60 0.00% 42 53 0.00% 43 63 0.00% 44 50 0.00% 45 66 0.00% 46 52 0.00% 47 54 0.00% 48 75 0.00% 49 65 0.00% 50 61 0.00% 51 54 0.00% 52 88 0.00% 53 78 0.00% 54 87 0.00% 55 78 0.00% 56 110 0.00% 57 75 0.00% 58 80 0.00% 59 99 0.00% 60 118 0.00% 61 107 0.00% 62 113 0.00% 63 138 0.00% 64 111 0.00% 65 140 0.00% 66 140 0.00% 67 171 0.00% 68 135 0.00% 69 166 0.00% 70 180 0.00% 71 238 0.00% 72 262 0.00% 73 279 0.00% 74 309 0.00% 75 328 0.00% 76 351 0.00% 77 429 0.00% 78 457 0.00% 79 549 0.00% 80 577 0.00% 81 618 0.00% 82 730 0.00% 83 773 0.00% 84 904 0.00% 85 1039 0.00% 86 1051 0.00% 87 1192 0.00% 88 1338 0.00% 89 1507 0.00% 90 1680 0.00% 91 1897 0.00% 92 2026 0.00% 93 2196 0.01% 94 2587 0.01% 95 2626 0.01% 96 2950 0.01% 97 3253 0.01% 98 3538 0.01% 99 3817 0.01% 100 4002 0.01% 101 4382 0.01% 102 4739 0.01% 103 5196 0.01% 104 5476 0.01% 105 5806 0.01% 106 6435 0.02% 107 6848 0.02% 108 7020 0.02% 109 7606 0.02% 110 7870 0.02% 111 8690 0.02% 112 9306 0.02% 113 9798 0.02% 114 10530 0.03% 115 11434 0.03% 116 11911 0.03% 117 12504 0.03% 118 12852 0.03% 119 13071 0.03% 120 13996 0.03% 121 14965 0.04% 122 15820 0.04% 123 16642 0.04% 124 17707 0.04% 125 18668 0.04% 126 19465 0.05% 127 20168 0.05% 128 20560 0.05% 129 22226 0.05% 130 22734 0.05% 131 23786 0.06% 132 25255 0.06% 133 26600 0.06% 134 27291 0.07% 135 28975 0.07% 136 29595 0.07% 137 30870 0.07% 138 31743 0.08% 139 33164 0.08% 140 34161 0.08% 141 35868 0.09% 142 37483 0.09% 143 38516 0.09% 144 40220 0.10% 145 42819 0.10% 146 43530 0.10% 147 45558 0.11% 148 46765 0.11% 149 47823 0.11% 150 49760 0.12% 151 40466198 97.28% 41597555 reads passed initial QC criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=26 prefix-density=1.18 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.22 sequence-density-rank=31 fanout-score=27.20 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=7.5 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=23 prefix-density=1.12 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=25.00 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=6.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804094 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:43:44 Started mapping on | Dec 10 01:43:45 Finished on | Dec 10 01:49:25 Mapping speed, Million of reads per hour | 440.44 Number of input reads | 41597555 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 38883259 Uniquely mapped reads % | 93.47% Average mapped length | 299.82 Number of splices: Total | 41647458 Number of splices: Annotated (sjdb) | 39570217 Number of splices: GT/AG | 41033437 Number of splices: GC/AG | 509863 Number of splices: AT/AC | 12121 Number of splices: Non-canonical | 92037 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483980 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 44172 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.51% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2230316 2230316 2230316 N_multimapping 483980 483980 483980 N_noFeature 950406 37742226 1157665 N_ambiguous 1144257 5321 214165 UnstrandedReadsAssigned:36788596 PositiveStrandReadsAssigned:1135712 NegativeStrandReadsAssigned:37511429 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804094 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804094-trimmed-pair1.fastq SRR7804094-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,597,555 reads, 37,595,892 reads pseudoaligned [quant] estimated average fragment length: 311.736 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR7804094.ke.tsv 35125 SRR7804094.se.tsv 88098 total ==> SRR7804094.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 626.029 0 0 PNS24247 1044 733.264 88.8825 3.95104 PNS24249 1928 1617.26 137.212 2.76545 PNS24246 1044 733.264 88.8825 3.95104 PNS24248 1044 733.264 88.8825 3.95104 PNS24244 1471 1160.26 97.1406 2.72897 PNS24243 293 74.2129 1 0.439214 KQK14069 1603 1292.26 1534.07 38.6946 KQK14071 474 197.435 10.2478 1.69186 ==> SRR7804094.se.tsv <== BRADI_1g14170v3 1607 BRADI_1g53295v3 883 BRADI_1g59795v3 780 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 488 BRADI_1g74790v3 168 BRADI_1g09890v3 0 BRADI_1g77505v3 497 BRADI_1g48960v3 0 SRR7804094 completed mapping pipeline successfully