Starting /dee2/code/volunteer_pipeline.sh SRR7804095 current disk space = 1541705494528 free memory = 1415038308 SRR7804095 SRAfilesize 36cfc678f23662359b9aed40caa326fa SRR7804095.sra SRR7804095.sra file validated SRR7804095 is paired end SRR7804095 is conventional basespace SRR7804095 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804095_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.207 37.0 37.0 37.0 37.0 37.0 2 36.2075 37.0 37.0 37.0 37.0 37.0 3 36.341 37.0 37.0 37.0 37.0 37.0 4 36.394 37.0 37.0 37.0 37.0 37.0 5 36.5475 37.0 37.0 37.0 37.0 37.0 6 36.45 37.0 37.0 37.0 37.0 37.0 7 36.348 37.0 37.0 37.0 37.0 37.0 8 36.4675 37.0 37.0 37.0 37.0 37.0 9 36.484 37.0 37.0 37.0 37.0 37.0 10-14 36.46319999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.457100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4473 37.0 37.0 37.0 37.0 37.0 25-29 36.424400000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.3869 37.0 37.0 37.0 37.0 37.0 35-39 36.40840000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.375 37.0 37.0 37.0 37.0 37.0 45-49 36.3141 37.0 37.0 37.0 37.0 37.0 50-54 36.313 37.0 37.0 37.0 37.0 37.0 55-59 36.249900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.271 37.0 37.0 37.0 37.0 37.0 65-69 36.2336 37.0 37.0 37.0 37.0 37.0 70-74 36.1909 37.0 37.0 37.0 37.0 37.0 75-79 36.212900000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.13199999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.119899999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.1866 37.0 37.0 37.0 37.0 37.0 95-99 36.125699999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1353 37.0 37.0 37.0 37.0 37.0 105-109 36.0374 37.0 37.0 37.0 37.0 37.0 110-114 36.0078 37.0 37.0 37.0 37.0 37.0 115-119 36.061899999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.9478 37.0 37.0 37.0 37.0 37.0 125-129 35.87310000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.8407 37.0 37.0 37.0 37.0 37.0 135-139 35.850199999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.746 37.0 37.0 37.0 37.0 37.0 145-149 35.764500000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.207499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 4.0 26 6.0 27 7.0 28 14.0 29 24.0 30 36.0 31 45.0 32 51.0 33 101.0 34 144.0 35 339.0 36 2818.0 37 408.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.225 11.55 7.75 34.475 2 26.876876876876878 11.861861861861863 31.306306306306308 29.954954954954953 3 23.525 16.475 23.275000000000002 36.725 4 28.4 23.225 19.875 28.499999999999996 5 27.85 25.674999999999997 22.975 23.5 6 26.1 28.725 22.900000000000002 22.275 7 21.2 22.35 34.849999999999994 21.6 8 23.375 22.325 27.575 26.724999999999998 9 22.525000000000002 20.75 30.3 26.424999999999997 10-14 25.080000000000002 24.22 24.375 26.325 15-19 24.915000000000003 23.645 24.385 27.055 20-24 25.25 23.82 24.72 26.21 25-29 24.98 23.645 24.94 26.435 30-34 24.795 23.61 24.8 26.795 35-39 25.465 23.26 24.47 26.805 40-44 25.424999999999997 23.525 24.77 26.279999999999998 45-49 25.285000000000004 22.985 24.565 27.165 50-54 25.4 23.52 23.995 27.084999999999997 55-59 25.27 23.46 24.02 27.250000000000004 60-64 25.765 23.985 23.455000000000002 26.795 65-69 25.305 23.21 23.985 27.500000000000004 70-74 25.424999999999997 23.355 23.575 27.644999999999996 75-79 26.55 22.585 23.925 26.939999999999998 80-84 26.529999999999998 22.66 23.46 27.35 85-89 26.334999999999997 23.315 23.07 27.279999999999998 90-94 26.46 23.435 23.45 26.655 95-99 25.865 23.200000000000003 23.25 27.685 100-104 26.015 23.165 23.355 27.465 105-109 26.009999999999998 22.869999999999997 23.625 27.495000000000005 110-114 26.41 23.200000000000003 23.36 27.029999999999998 115-119 26.200000000000003 23.125 23.400000000000002 27.275 120-124 26.085 22.795 23.494999999999997 27.625 125-129 26.3 23.25 23.29 27.16 130-134 26.479999999999997 23.02 23.28 27.22 135-139 26.590000000000003 22.8 23.064999999999998 27.544999999999998 140-144 26.465 22.36 24.03 27.145000000000003 145-149 26.525 22.54 23.61 27.325 150-151 26.5125 22.375 23.3625 27.750000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 1.0 29 2.5 30 6.5 31 8.0 32 7.5 33 11.0 34 16.0 35 24.5 36 35.5 37 45.0 38 58.5 39 75.5 40 85.5 41 108.0 42 143.0 43 147.5 44 145.5 45 159.0 46 161.0 47 154.5 48 152.0 49 137.0 50 128.0 51 127.5 52 111.5 53 103.0 54 109.5 55 107.5 56 107.0 57 111.5 58 104.0 59 107.5 60 107.5 61 108.0 62 102.5 63 89.0 64 87.5 65 95.0 66 99.5 67 83.0 68 72.5 69 65.0 70 58.5 71 51.0 72 39.5 73 31.5 74 28.0 75 23.0 76 13.5 77 11.5 78 9.0 79 8.0 80 6.5 81 2.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 91.99564388783011 84.475 2 7.296487884563027 13.4 3 0.5445140212360468 1.5 4 0.1361285053090117 0.5 5 0.027225701061802342 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACTTCCTTAGGCCCTGGCTGATGTACTCTTGGGAGCTGAGGACGGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 0.9625 0.0 0.0 0.0 0.0 132-133 1.1375000000000002 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138-139 1.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCTC 30 0.0017973486 72.5 3 TCCAGCT 30 0.0017973486 72.5 2 CTCCAGC 35 0.0033124194 62.14286 1 >>END_MODULE SRR7804095 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804095_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.148 37.0 37.0 37.0 37.0 37.0 2 35.924 37.0 37.0 37.0 37.0 37.0 3 35.969 37.0 37.0 37.0 37.0 37.0 4 36.027 37.0 37.0 37.0 37.0 37.0 5 35.893 37.0 37.0 37.0 37.0 37.0 6 35.974 37.0 37.0 37.0 37.0 37.0 7 35.8255 37.0 37.0 37.0 37.0 37.0 8 36.094 37.0 37.0 37.0 37.0 37.0 9 35.8335 37.0 37.0 37.0 37.0 37.0 10-14 35.9889 37.0 37.0 37.0 37.0 37.0 15-19 35.86710000000001 37.0 37.0 37.0 37.0 37.0 20-24 35.875899999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.9167 37.0 37.0 37.0 37.0 37.0 30-34 35.8317 37.0 37.0 37.0 37.0 37.0 35-39 35.773700000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.761199999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.7431 37.0 37.0 37.0 37.0 37.0 50-54 35.6711 37.0 37.0 37.0 37.0 37.0 55-59 35.62330000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.706599999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.6253 37.0 37.0 37.0 37.0 37.0 70-74 35.6168 37.0 37.0 37.0 37.0 37.0 75-79 35.627399999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.5069 37.0 37.0 37.0 37.0 37.0 85-89 35.579899999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.5169 37.0 37.0 37.0 37.0 37.0 95-99 35.4971 37.0 37.0 37.0 37.0 37.0 100-104 35.4378 37.0 37.0 37.0 37.0 37.0 105-109 35.3634 37.0 37.0 37.0 37.0 37.0 110-114 35.288 37.0 37.0 37.0 34.6 37.0 115-119 35.3117 37.0 37.0 37.0 32.2 37.0 120-124 35.2439 37.0 37.0 37.0 32.2 37.0 125-129 35.1665 37.0 37.0 37.0 29.8 37.0 130-134 35.21740000000001 37.0 37.0 37.0 32.2 37.0 135-139 35.133799999999994 37.0 37.0 37.0 27.4 37.0 140-144 35.0974 37.0 37.0 37.0 27.4 37.0 145-149 34.987 37.0 37.0 37.0 25.0 37.0 150-151 34.359750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 9.0 15 7.0 16 3.0 17 0.0 18 1.0 19 4.0 20 4.0 21 5.0 22 11.0 23 7.0 24 13.0 25 6.0 26 17.0 27 9.0 28 19.0 29 37.0 30 34.0 31 42.0 32 83.0 33 114.0 34 231.0 35 673.0 36 2485.0 37 179.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.06953476738369 19.28464232116058 9.654827413706855 31.990995497748877 2 33.025 21.75 22.275 22.95 3 24.825 25.4 23.425 26.35 4 28.7 29.275000000000002 17.175 24.85 5 29.875 29.299999999999997 17.2 23.625 6 23.849999999999998 34.675 17.849999999999998 23.625 7 24.725 18.475 30.5 26.3 8 25.424999999999997 23.45 20.275000000000002 30.85 9 25.1 21.2 24.45 29.25 10-14 27.1 24.48 20.96 27.46 15-19 26.735 23.89 21.845 27.529999999999998 20-24 27.095000000000002 24.044999999999998 21.634999999999998 27.224999999999998 25-29 27.900000000000002 23.175 21.73 27.195000000000004 30-34 27.02 24.66 21.91 26.41 35-39 26.939999999999998 24.065 21.65 27.345000000000002 40-44 27.250000000000004 23.494999999999997 21.625 27.63 45-49 26.795 23.925 21.51 27.77 50-54 27.400000000000002 23.61 21.25 27.74 55-59 28.03 22.765 21.565 27.639999999999997 60-64 27.505000000000003 23.080000000000002 21.93 27.485 65-69 27.13 23.005 21.855 28.01 70-74 27.139999999999997 22.955000000000002 21.990000000000002 27.915 75-79 27.175 23.1 21.8 27.925 80-84 27.229999999999997 23.419999999999998 21.834999999999997 27.515 85-89 28.275 22.585 21.345 27.794999999999998 90-94 27.515 23.27 21.335 27.88 95-99 28.205000000000002 23.005 21.705 27.084999999999997 100-104 28.275 23.505000000000003 21.44 26.779999999999998 105-109 27.474999999999998 23.064999999999998 21.955 27.505000000000003 110-114 28.09 23.91 21.485000000000003 26.515 115-119 27.37 23.78 21.14 27.71 120-124 27.474999999999998 23.47 21.72 27.334999999999997 125-129 27.915 24.26 21.19 26.634999999999998 130-134 28.825 23.34 21.665 26.169999999999998 135-139 27.474999999999998 23.91 21.905 26.71 140-144 27.534999999999997 24.16 21.52 26.784999999999997 145-149 27.27 23.865 21.925 26.939999999999998 150-151 27.487499999999997 24.6 21.212500000000002 26.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 1.5 13 1.5 14 2.5 15 2.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 2.0 23 1.5 24 0.0 25 0.0 26 0.0 27 3.5 28 4.5 29 3.5 30 4.0 31 4.5 32 5.5 33 8.0 34 10.5 35 18.0 36 27.5 37 34.0 38 43.5 39 53.5 40 68.0 41 88.5 42 102.5 43 112.0 44 123.0 45 127.5 46 129.0 47 141.0 48 132.0 49 118.5 50 117.0 51 114.5 52 117.5 53 111.0 54 112.5 55 104.0 56 80.5 57 83.0 58 103.5 59 119.5 60 126.5 61 124.0 62 128.0 63 126.0 64 107.5 65 95.0 66 90.5 67 94.5 68 108.0 69 107.0 70 87.5 71 71.5 72 64.0 73 59.0 74 48.5 75 34.5 76 23.0 77 13.0 78 10.5 79 7.5 80 4.0 81 5.0 82 2.5 83 0.0 84 0.0 85 1.0 86 2.0 87 2.0 88 1.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 1.0 98 1.0 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.65059244971067 83.15 2 7.164508128961146 13.0 3 0.7991182143841279 2.175 4 0.2204464039680353 0.8 5 0.11022320198401765 0.5 6 0.027555800496004413 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027555800496004413 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit AGAAGAGCCAAGCAGCAATGGCCGCCCAGCTTTCCTCTGCCGCCGCCACC 5 0.125 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit TCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.38749999999999996 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.9875 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.2999999999999998 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138-139 1.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723264 spots for SRR7804095.sra Written 1723264 spots for SRR7804095.sra Read 1723274 spots for SRR7804095.sra Written 1723274 spots for SRR7804095.sra SRR ids: ['SRR7804095.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zo7_c3yu SRR7804095.sra spots: 34465290 blocks: [[1, 1723264], [1723265, 3446528], [3446529, 5169792], [5169793, 6893056], [6893057, 8616320], [8616321, 10339584], [10339585, 12062848], [12062849, 13786112], [13786113, 15509376], [15509377, 17232640], [17232641, 18955904], [18955905, 20679168], [20679169, 22402432], [22402433, 24125696], [24125697, 25848960], [25848961, 27572224], [27572225, 29295488], [29295489, 31018752], [31018753, 32742016], [32742017, 34465290]] SRR7804095 file size 11657455 SRR7804095 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804095 SRR7804095_1.fastq SRR7804095_2.fastq Input file: SRR7804095_1.fastq Paired file: SRR7804095_2.fastq trimmed: SRR7804095-trimmed-pair1.fastq, SRR7804095-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:46:36 2024 >> started Sat Dec 7 16:47:19 2024 >> done (43.317s) 34465290 read pairs processed; of these: 119 ( 0.00%) short read pairs filtered out after trimming by size control 1178 ( 0.00%) empty read pairs filtered out after trimming by size control 34463993 (100.00%) read pairs available; of these: 909885 ( 2.64%) trimmed read pairs available after processing 33554108 (97.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 17 0.00% 20 15 0.00% 21 18 0.00% 22 20 0.00% 23 18 0.00% 24 19 0.00% 25 15 0.00% 26 18 0.00% 27 22 0.00% 28 22 0.00% 29 23 0.00% 30 16 0.00% 31 24 0.00% 32 33 0.00% 33 26 0.00% 34 20 0.00% 35 41 0.00% 36 17 0.00% 37 29 0.00% 38 52 0.00% 39 39 0.00% 40 53 0.00% 41 40 0.00% 42 43 0.00% 43 36 0.00% 44 40 0.00% 45 46 0.00% 46 56 0.00% 47 46 0.00% 48 47 0.00% 49 57 0.00% 50 48 0.00% 51 44 0.00% 52 46 0.00% 53 68 0.00% 54 56 0.00% 55 54 0.00% 56 65 0.00% 57 67 0.00% 58 74 0.00% 59 75 0.00% 60 90 0.00% 61 92 0.00% 62 102 0.00% 63 123 0.00% 64 114 0.00% 65 112 0.00% 66 119 0.00% 67 123 0.00% 68 136 0.00% 69 165 0.00% 70 202 0.00% 71 186 0.00% 72 217 0.00% 73 283 0.00% 74 256 0.00% 75 297 0.00% 76 361 0.00% 77 387 0.00% 78 406 0.00% 79 509 0.00% 80 546 0.00% 81 596 0.00% 82 635 0.00% 83 718 0.00% 84 821 0.00% 85 954 0.00% 86 1094 0.00% 87 1104 0.00% 88 1269 0.00% 89 1258 0.00% 90 1515 0.00% 91 1694 0.00% 92 1808 0.01% 93 1949 0.01% 94 2269 0.01% 95 2404 0.01% 96 2640 0.01% 97 2718 0.01% 98 3002 0.01% 99 3274 0.01% 100 3519 0.01% 101 3780 0.01% 102 4080 0.01% 103 4561 0.01% 104 4858 0.01% 105 5189 0.02% 106 5510 0.02% 107 5807 0.02% 108 6154 0.02% 109 6426 0.02% 110 6681 0.02% 111 7052 0.02% 112 7692 0.02% 113 8234 0.02% 114 8695 0.03% 115 9399 0.03% 116 9721 0.03% 117 10183 0.03% 118 10659 0.03% 119 11025 0.03% 120 11521 0.03% 121 12171 0.04% 122 12631 0.04% 123 13500 0.04% 124 14161 0.04% 125 15161 0.04% 126 15538 0.05% 127 16186 0.05% 128 16710 0.05% 129 18144 0.05% 130 18373 0.05% 131 18897 0.05% 132 19951 0.06% 133 21163 0.06% 134 21973 0.06% 135 22972 0.07% 136 23776 0.07% 137 24467 0.07% 138 25019 0.07% 139 26324 0.08% 140 27262 0.08% 141 28043 0.08% 142 29190 0.08% 143 30844 0.09% 144 31949 0.09% 145 33416 0.10% 146 34043 0.10% 147 35557 0.10% 148 36562 0.11% 149 37818 0.11% 150 39217 0.11% 151 33554108 97.36% 34463993 reads passed initial QC criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=25 prefix-density=1.32 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.30 sequence-density-rank=28 fanout-score=14.07 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=4.0 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=24 prefix-density=1.13 prefix-fanout=2.1 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=86.46 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=2.2 sequence=GCAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804095 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:49:41 Started mapping on | Dec 07 16:49:41 Finished on | Dec 07 16:54:09 Mapping speed, Million of reads per hour | 462.95 Number of input reads | 34463993 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 32367536 Uniquely mapped reads % | 93.92% Average mapped length | 299.78 Number of splices: Total | 34071776 Number of splices: Annotated (sjdb) | 32394576 Number of splices: GT/AG | 33583876 Number of splices: GC/AG | 406111 Number of splices: AT/AC | 9602 Number of splices: Non-canonical | 72187 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362565 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 26191 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.40% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1733892 1733892 1733892 N_multimapping 362565 362565 362565 N_noFeature 758057 31449169 935178 N_ambiguous 943136 4239 204989 UnstrandedReadsAssigned:30666343 PositiveStrandReadsAssigned:914128 NegativeStrandReadsAssigned:31227369 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804095 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804095-trimmed-pair1.fastq SRR7804095-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,463,993 reads, 31,379,473 reads pseudoaligned [quant] estimated average fragment length: 309.51 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR7804095.ke.tsv 35125 SRR7804095.se.tsv 88098 total ==> SRR7804095.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 628.138 0 0 PNS24247 1044 735.49 62.8324 3.33279 PNS24249 1928 1619.49 164.832 3.97067 PNS24246 1044 735.49 62.8324 3.33279 PNS24248 1044 735.49 62.8324 3.33279 PNS24244 1471 1162.49 44.6711 1.49913 PNS24243 293 72.7287 0 0 KQK14069 1603 1294.49 720.62 21.7174 KQK14071 474 195.995 8.88762 1.76906 ==> SRR7804095.se.tsv <== BRADI_1g14170v3 769 BRADI_1g53295v3 737 BRADI_1g59795v3 629 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 337 BRADI_1g74790v3 154 BRADI_1g09890v3 0 BRADI_1g77505v3 371 BRADI_1g48960v3 0 SRR7804095 completed mapping pipeline successfully