Starting /dee2/code/volunteer_pipeline.sh SRR7804096 current disk space = 1523353214976 free memory = 1484894212 SRR7804096 SRAfilesize 58fc947422ff26057bd50bc5496983e6 SRR7804096.sra SRR7804096.sra file validated SRR7804096 is paired end SRR7804096 is conventional basespace SRR7804096 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804096_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.228 37.0 37.0 37.0 37.0 37.0 2 36.2665 37.0 37.0 37.0 37.0 37.0 3 36.3585 37.0 37.0 37.0 37.0 37.0 4 36.4685 37.0 37.0 37.0 37.0 37.0 5 36.4275 37.0 37.0 37.0 37.0 37.0 6 36.418 37.0 37.0 37.0 37.0 37.0 7 36.3915 37.0 37.0 37.0 37.0 37.0 8 36.4985 37.0 37.0 37.0 37.0 37.0 9 36.4475 37.0 37.0 37.0 37.0 37.0 10-14 36.43599999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.49079999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4639 37.0 37.0 37.0 37.0 37.0 25-29 36.4197 37.0 37.0 37.0 37.0 37.0 30-34 36.388 37.0 37.0 37.0 37.0 37.0 35-39 36.4011 37.0 37.0 37.0 37.0 37.0 40-44 36.4123 37.0 37.0 37.0 37.0 37.0 45-49 36.3537 37.0 37.0 37.0 37.0 37.0 50-54 36.347899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3493 37.0 37.0 37.0 37.0 37.0 60-64 36.340199999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2524 37.0 37.0 37.0 37.0 37.0 70-74 36.230799999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.246500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.1453 37.0 37.0 37.0 37.0 37.0 85-89 36.1822 37.0 37.0 37.0 37.0 37.0 90-94 36.1229 37.0 37.0 37.0 37.0 37.0 95-99 36.0986 37.0 37.0 37.0 37.0 37.0 100-104 36.063700000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9794 37.0 37.0 37.0 37.0 37.0 110-114 36.032599999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.9738 37.0 37.0 37.0 37.0 37.0 120-124 35.9319 37.0 37.0 37.0 37.0 37.0 125-129 35.8597 37.0 37.0 37.0 37.0 37.0 130-134 35.7729 37.0 37.0 37.0 37.0 37.0 135-139 35.839999999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.7467 37.0 37.0 37.0 37.0 37.0 145-149 35.7656 37.0 37.0 37.0 37.0 37.0 150-151 35.2495 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 0.0 24 1.0 25 7.0 26 3.0 27 15.0 28 17.0 29 15.0 30 32.0 31 44.0 32 55.0 33 88.0 34 150.0 35 307.0 36 2845.0 37 418.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.225 13.075000000000001 6.925000000000001 32.775 2 25.737868934467233 13.606803401700851 31.840920460230116 28.8144072036018 3 22.125 18.725 25.15 34.0 4 27.3 23.825 21.575 27.3 5 27.400000000000002 27.6 22.775000000000002 22.225 6 25.1 29.299999999999997 22.25 23.35 7 18.575 23.549999999999997 37.325 20.549999999999997 8 22.025 21.3 27.650000000000002 29.025000000000002 9 22.650000000000002 19.625 30.099999999999998 27.625 10-14 24.224999999999998 24.725 24.055 26.995 15-19 24.19 23.32 24.855 27.634999999999998 20-24 25.25 23.775 24.16 26.815 25-29 24.57 24.285 24.515 26.63 30-34 24.759999999999998 23.455000000000002 24.560000000000002 27.224999999999998 35-39 24.955 23.080000000000002 24.395 27.57 40-44 24.785 23.655 24.095 27.465 45-49 24.66 23.880000000000003 24.154999999999998 27.305 50-54 24.59 23.425 24.279999999999998 27.705000000000002 55-59 25.275 23.044999999999998 23.755000000000003 27.925 60-64 25.21 23.59 23.715 27.485 65-69 24.705 23.335 24.18 27.779999999999998 70-74 25.31 23.145 23.775 27.77 75-79 25.230000000000004 23.674999999999997 23.98 27.115000000000002 80-84 25.569999999999997 23.630000000000003 23.625 27.175 85-89 25.335 23.015 23.79 27.860000000000003 90-94 25.369999999999997 22.52 24.195 27.915 95-99 25.490000000000002 22.935 23.86 27.715 100-104 25.905 23.555 23.27 27.27 105-109 25.805 23.195 24.08 26.919999999999998 110-114 25.624999999999996 22.79 23.87 27.715 115-119 26.205000000000002 22.685 23.41 27.700000000000003 120-124 26.240000000000002 22.74 23.669999999999998 27.35 125-129 26.015 22.64 23.89 27.455000000000002 130-134 26.865 22.695 23.62 26.82 135-139 26.435 22.325 23.345 27.894999999999996 140-144 26.96 22.045 23.380000000000003 27.615000000000002 145-149 26.14 22.64 23.515 27.705000000000002 150-151 26.087500000000002 22.1 23.8625 27.950000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 2.0 28 5.0 29 5.5 30 4.5 31 6.0 32 8.5 33 14.0 34 19.5 35 26.5 36 37.5 37 51.0 38 65.0 39 82.0 40 90.0 41 97.0 42 108.5 43 125.5 44 131.5 45 132.0 46 144.5 47 155.0 48 150.0 49 137.0 50 132.0 51 130.5 52 123.0 53 132.5 54 153.5 55 161.0 56 153.5 57 136.0 58 120.0 59 96.5 60 93.0 61 102.5 62 87.0 63 79.0 64 84.5 65 72.0 66 71.5 67 74.5 68 63.5 69 53.0 70 53.5 71 54.5 72 45.0 73 31.0 74 27.0 75 22.5 76 15.0 77 11.5 78 6.0 79 4.5 80 4.0 81 3.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.35 #Duplication Level Percentage of deduplicated Percentage of total 1 90.67515218594355 81.925 2 8.079690094078583 14.6 3 1.162147205312673 3.15 4 0.05534034311012728 0.2 5 0.02767017155506364 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.1125 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.2999999999999998 0.0 0.0 0.0 0.0 134-135 1.3875000000000002 0.0 0.0 0.0 0.0 136-137 1.6124999999999998 0.0 0.0 0.0 0.0 138-139 1.7000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804096 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804096_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.04425 37.0 37.0 37.0 37.0 37.0 2 35.8265 37.0 37.0 37.0 37.0 37.0 3 35.679 37.0 37.0 37.0 37.0 37.0 4 36.041 37.0 37.0 37.0 37.0 37.0 5 35.877 37.0 37.0 37.0 37.0 37.0 6 35.9415 37.0 37.0 37.0 37.0 37.0 7 35.7555 37.0 37.0 37.0 37.0 37.0 8 35.952 37.0 37.0 37.0 37.0 37.0 9 35.6455 37.0 37.0 37.0 37.0 37.0 10-14 35.8762 37.0 37.0 37.0 37.0 37.0 15-19 35.73649999999999 37.0 37.0 37.0 37.0 37.0 20-24 35.739700000000006 37.0 37.0 37.0 37.0 37.0 25-29 35.723 37.0 37.0 37.0 37.0 37.0 30-34 35.7078 37.0 37.0 37.0 37.0 37.0 35-39 35.642900000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.592 37.0 37.0 37.0 37.0 37.0 45-49 35.5007 37.0 37.0 37.0 37.0 37.0 50-54 35.521499999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.4512 37.0 37.0 37.0 37.0 37.0 60-64 35.4313 37.0 37.0 37.0 37.0 37.0 65-69 35.4549 37.0 37.0 37.0 37.0 37.0 70-74 35.4291 37.0 37.0 37.0 37.0 37.0 75-79 35.4094 37.0 37.0 37.0 37.0 37.0 80-84 35.3514 37.0 37.0 37.0 37.0 37.0 85-89 35.3384 37.0 37.0 37.0 37.0 37.0 90-94 35.305800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.2178 37.0 37.0 37.0 34.6 37.0 100-104 35.242000000000004 37.0 37.0 37.0 34.6 37.0 105-109 35.1992 37.0 37.0 37.0 32.2 37.0 110-114 35.029999999999994 37.0 37.0 37.0 27.4 37.0 115-119 35.088300000000004 37.0 37.0 37.0 29.8 37.0 120-124 35.0707 37.0 37.0 37.0 25.0 37.0 125-129 34.9623 37.0 37.0 37.0 25.0 37.0 130-134 34.9525 37.0 37.0 37.0 25.0 37.0 135-139 34.8936 37.0 37.0 37.0 25.0 37.0 140-144 34.869299999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.6381 37.0 37.0 37.0 25.0 37.0 150-151 34.23925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 9.0 14 10.0 15 10.0 16 7.0 17 1.0 18 9.0 19 4.0 20 6.0 21 14.0 22 19.0 23 10.0 24 5.0 25 11.0 26 17.0 27 14.0 28 15.0 29 21.0 30 41.0 31 47.0 32 80.0 33 134.0 34 227.0 35 692.0 36 2441.0 37 153.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.33608402100525 18.454613653413354 8.152038009502375 29.057264316079017 2 32.324999999999996 22.375 23.825 21.475 3 25.874999999999996 24.474999999999998 25.525 24.125 4 28.325 30.225 17.150000000000002 24.3 5 29.7 32.175 17.775 20.349999999999998 6 25.775 33.650000000000006 16.575 24.0 7 24.075 19.1 30.55 26.275 8 27.450000000000003 21.825 20.875 29.849999999999998 9 26.150000000000002 21.45 23.799999999999997 28.599999999999998 10-14 28.685 23.655 20.805 26.855 15-19 27.994999999999997 24.275 20.94 26.790000000000003 20-24 27.675 24.615000000000002 21.485000000000003 26.224999999999998 25-29 28.29 23.169999999999998 21.345 27.195000000000004 30-34 27.83 23.745 21.94 26.484999999999996 35-39 28.505000000000003 23.815 21.46 26.22 40-44 28.62 23.25 21.535 26.595000000000002 45-49 28.355000000000004 23.645 21.73 26.27 50-54 28.235 23.225 21.525 27.015 55-59 27.639999999999997 24.435000000000002 21.115000000000002 26.810000000000002 60-64 27.595 23.205000000000002 21.685 27.515 65-69 27.839999999999996 23.799999999999997 21.335 27.025 70-74 27.955000000000002 23.555 21.36 27.13 75-79 27.935 23.44 21.615000000000002 27.01 80-84 27.6 23.815 21.73 26.855 85-89 27.85 23.665 21.39 27.095000000000002 90-94 28.125 23.21 22.14 26.525 95-99 28.04 23.875 21.490000000000002 26.595000000000002 100-104 28.38 23.674999999999997 21.595 26.35 105-109 27.675 23.96 22.02 26.345000000000002 110-114 28.37 24.044999999999998 21.215 26.369999999999997 115-119 28.715000000000003 23.755000000000003 21.36 26.169999999999998 120-124 27.83 23.93 21.855 26.384999999999998 125-129 28.605000000000004 24.265 20.915 26.215 130-134 28.835 23.974999999999998 21.265 25.924999999999997 135-139 27.98 24.490000000000002 21.995 25.535000000000004 140-144 28.37 24.01 22.065 25.555 145-149 29.17 24.0 21.475 25.355 150-151 27.962500000000002 25.25 21.525 25.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.0 24 0.5 25 1.0 26 1.5 27 1.5 28 1.0 29 2.5 30 5.0 31 5.0 32 6.5 33 8.5 34 9.5 35 16.5 36 21.5 37 26.0 38 44.0 39 59.0 40 71.5 41 89.5 42 96.0 43 109.5 44 113.0 45 118.5 46 130.5 47 124.0 48 115.0 49 123.5 50 119.5 51 112.5 52 119.0 53 126.5 54 143.0 55 145.5 56 128.0 57 119.5 58 136.5 59 148.0 60 127.0 61 100.5 62 101.0 63 107.0 64 102.5 65 86.5 66 93.5 67 108.0 68 97.0 69 81.5 70 74.5 71 65.0 72 49.0 73 43.5 74 32.5 75 20.0 76 17.0 77 14.5 78 12.5 79 6.0 80 4.0 81 6.0 82 6.0 83 3.0 84 0.5 85 1.5 86 1.5 87 0.5 88 1.0 89 1.0 90 1.0 91 1.0 92 1.5 93 1.0 94 1.0 95 2.0 96 1.5 97 0.5 98 1.0 99 2.0 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.54929577464789 82.875 2 7.31842032587683 13.25 3 0.8285004142502072 2.25 4 0.16570008285004142 0.6 5 0.055233360950013806 0.25 6 0.055233360950013806 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027616680475006903 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit AAACGATCTAGTGCAGCAGCAGCTTGCTCTCTCCTCCATCTAGTAGAAGA 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.1375 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.2999999999999998 0.0 0.0 0.0 0.0 134-135 1.3875000000000002 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.6749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTCTC 10 0.006830828 145.0 5 CAGACAT 25 8.7132835E-4 87.0 7 TTCTCCT 30 0.0017973486 72.5 7 >>END_MODULE Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325019 spots for SRR7804096.sra Written 1325019 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra Read 1325014 spots for SRR7804096.sra Written 1325014 spots for SRR7804096.sra SRR ids: ['SRR7804096.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gj7_7gh_ SRR7804096.sra spots: 26500285 blocks: [[1, 1325014], [1325015, 2650028], [2650029, 3975042], [3975043, 5300056], [5300057, 6625070], [6625071, 7950084], [7950085, 9275098], [9275099, 10600112], [10600113, 11925126], [11925127, 13250140], [13250141, 14575154], [14575155, 15900168], [15900169, 17225182], [17225183, 18550196], [18550197, 19875210], [19875211, 21200224], [21200225, 22525238], [22525239, 23850252], [23850253, 25175266], [25175267, 26500285]] SRR7804096 file size 8958376 SRR7804096 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804096 SRR7804096_1.fastq SRR7804096_2.fastq Input file: SRR7804096_1.fastq Paired file: SRR7804096_2.fastq trimmed: SRR7804096-trimmed-pair1.fastq, SRR7804096-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:38:34 2024 >> started Tue Dec 10 01:39:11 2024 >> done (36.965s) 26500285 read pairs processed; of these: 59 ( 0.00%) short read pairs filtered out after trimming by size control 979 ( 0.00%) empty read pairs filtered out after trimming by size control 26499247 (100.00%) read pairs available; of these: 743003 ( 2.80%) trimmed read pairs available after processing 25756244 (97.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 9 0.00% 21 14 0.00% 22 19 0.00% 23 19 0.00% 24 14 0.00% 25 11 0.00% 26 18 0.00% 27 15 0.00% 28 17 0.00% 29 16 0.00% 30 21 0.00% 31 13 0.00% 32 32 0.00% 33 23 0.00% 34 13 0.00% 35 26 0.00% 36 28 0.00% 37 21 0.00% 38 21 0.00% 39 25 0.00% 40 26 0.00% 41 32 0.00% 42 40 0.00% 43 45 0.00% 44 41 0.00% 45 37 0.00% 46 35 0.00% 47 40 0.00% 48 44 0.00% 49 44 0.00% 50 52 0.00% 51 32 0.00% 52 39 0.00% 53 52 0.00% 54 40 0.00% 55 39 0.00% 56 59 0.00% 57 62 0.00% 58 50 0.00% 59 51 0.00% 60 55 0.00% 61 63 0.00% 62 71 0.00% 63 74 0.00% 64 96 0.00% 65 77 0.00% 66 80 0.00% 67 87 0.00% 68 119 0.00% 69 91 0.00% 70 128 0.00% 71 114 0.00% 72 137 0.00% 73 165 0.00% 74 183 0.00% 75 197 0.00% 76 199 0.00% 77 221 0.00% 78 230 0.00% 79 263 0.00% 80 321 0.00% 81 362 0.00% 82 383 0.00% 83 466 0.00% 84 461 0.00% 85 537 0.00% 86 612 0.00% 87 713 0.00% 88 702 0.00% 89 832 0.00% 90 925 0.00% 91 1063 0.00% 92 1187 0.00% 93 1366 0.01% 94 1454 0.01% 95 1617 0.01% 96 1704 0.01% 97 1915 0.01% 98 1961 0.01% 99 2167 0.01% 100 2358 0.01% 101 2620 0.01% 102 2874 0.01% 103 3135 0.01% 104 3388 0.01% 105 3557 0.01% 106 4048 0.02% 107 4151 0.02% 108 4277 0.02% 109 4661 0.02% 110 4856 0.02% 111 5263 0.02% 112 5713 0.02% 113 6207 0.02% 114 6752 0.03% 115 7260 0.03% 116 7571 0.03% 117 7664 0.03% 118 8097 0.03% 119 8472 0.03% 120 9026 0.03% 121 9502 0.04% 122 9974 0.04% 123 11015 0.04% 124 11697 0.04% 125 12060 0.05% 126 12872 0.05% 127 13357 0.05% 128 13968 0.05% 129 14236 0.05% 130 14706 0.06% 131 15605 0.06% 132 16491 0.06% 133 17264 0.07% 134 18639 0.07% 135 19157 0.07% 136 20154 0.08% 137 20685 0.08% 138 21316 0.08% 139 22136 0.08% 140 22756 0.09% 141 23431 0.09% 142 25186 0.10% 143 25460 0.10% 144 27273 0.10% 145 28626 0.11% 146 30121 0.11% 147 31194 0.12% 148 31632 0.12% 149 32289 0.12% 150 33604 0.13% 151 25756244 97.20% 26499247 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=19 prefix-density=0.94 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=54.41 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=3.5 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=19 prefix-density=0.92 prefix-fanout=2.5 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=24.57 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.1 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804096 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:40:20 Started mapping on | Dec 10 01:40:20 Finished on | Dec 10 01:45:05 Mapping speed, Million of reads per hour | 334.73 Number of input reads | 26499247 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 21666544 Uniquely mapped reads % | 81.76% Average mapped length | 299.72 Number of splices: Total | 19948208 Number of splices: Annotated (sjdb) | 18922558 Number of splices: GT/AG | 19652629 Number of splices: GC/AG | 238773 Number of splices: AT/AC | 7390 Number of splices: Non-canonical | 49416 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1302111 % of reads mapped to multiple loci | 4.91% Number of reads mapped to too many loci | 175387 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.37% % of reads unmapped: other | 5.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3530592 3530592 3530592 N_multimapping 1302111 1302111 1302111 N_noFeature 1863850 21022268 2000438 N_ambiguous 619872 3729 112548 UnstrandedReadsAssigned:19182822 PositiveStrandReadsAssigned:640547 NegativeStrandReadsAssigned:19553558 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804096 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804096-trimmed-pair1.fastq SRR7804096-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,499,247 reads, 20,303,474 reads pseudoaligned [quant] estimated average fragment length: 302.191 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52973 SRR7804096.ke.tsv 35125 SRR7804096.se.tsv 88098 total ==> SRR7804096.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 635.365 0 0 PNS24247 1044 742.809 76.3273 5.53858 PNS24249 1928 1626.81 122.739 4.06669 PNS24246 1044 742.809 76.3273 5.53858 PNS24248 1044 742.809 76.3273 5.53858 PNS24244 1471 1169.81 65.2789 3.00783 PNS24243 293 74.1971 0 0 KQK14069 1603 1301.81 4437.31 183.725 KQK14071 474 201.885 40.7112 10.8694 ==> SRR7804096.se.tsv <== BRADI_1g14170v3 4462 BRADI_1g53295v3 578 BRADI_1g59795v3 296 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 180 BRADI_1g74790v3 448 BRADI_1g09890v3 0 BRADI_1g77505v3 399 BRADI_1g48960v3 1 SRR7804096 completed mapping pipeline successfully