Starting /dee2/code/volunteer_pipeline.sh SRR7804097 current disk space = 1523318595584 free memory = 1602394432 SRR7804097 SRAfilesize a2448f25e521f39ddec2122e9acbf3d5 SRR7804097.sra SRR7804097.sra file validated SRR7804097 is paired end SRR7804097 is conventional basespace SRR7804097 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804097_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2455 37.0 37.0 37.0 37.0 37.0 2 36.26375 37.0 37.0 37.0 37.0 37.0 3 36.344 37.0 37.0 37.0 37.0 37.0 4 36.429 37.0 37.0 37.0 37.0 37.0 5 36.55 37.0 37.0 37.0 37.0 37.0 6 36.481 37.0 37.0 37.0 37.0 37.0 7 36.5 37.0 37.0 37.0 37.0 37.0 8 36.4235 37.0 37.0 37.0 37.0 37.0 9 36.548 37.0 37.0 37.0 37.0 37.0 10-14 36.4978 37.0 37.0 37.0 37.0 37.0 15-19 36.4773 37.0 37.0 37.0 37.0 37.0 20-24 36.461299999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.3995 37.0 37.0 37.0 37.0 37.0 30-34 36.465700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.3674 37.0 37.0 37.0 37.0 37.0 40-44 36.390499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.385 37.0 37.0 37.0 37.0 37.0 50-54 36.3109 37.0 37.0 37.0 37.0 37.0 55-59 36.335 37.0 37.0 37.0 37.0 37.0 60-64 36.3178 37.0 37.0 37.0 37.0 37.0 65-69 36.2823 37.0 37.0 37.0 37.0 37.0 70-74 36.2962 37.0 37.0 37.0 37.0 37.0 75-79 36.2522 37.0 37.0 37.0 37.0 37.0 80-84 36.178000000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1748 37.0 37.0 37.0 37.0 37.0 90-94 36.1163 37.0 37.0 37.0 37.0 37.0 95-99 36.0891 37.0 37.0 37.0 37.0 37.0 100-104 36.0795 37.0 37.0 37.0 37.0 37.0 105-109 35.970800000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.023 37.0 37.0 37.0 37.0 37.0 115-119 35.9781 37.0 37.0 37.0 37.0 37.0 120-124 35.937400000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.8122 37.0 37.0 37.0 37.0 37.0 130-134 35.776700000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.8618 37.0 37.0 37.0 37.0 37.0 140-144 35.7043 37.0 37.0 37.0 37.0 37.0 145-149 35.707 37.0 37.0 37.0 37.0 37.0 150-151 35.10625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 6.0 26 5.0 27 6.0 28 13.0 29 14.0 30 42.0 31 35.0 32 50.0 33 92.0 34 159.0 35 361.0 36 2828.0 37 385.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.45 13.55 10.775 32.225 2 27.709637046307883 14.217772215269086 29.93742177722153 28.1351689612015 3 23.474999999999998 19.400000000000002 24.775 32.35 4 27.800000000000004 25.3 21.625 25.275 5 28.65 26.35 22.3 22.7 6 25.424999999999997 30.375000000000004 21.25 22.95 7 20.724999999999998 21.425 36.525 21.325 8 22.625 23.775 25.974999999999998 27.625 9 21.275 21.8 30.0 26.924999999999997 10-14 25.1 24.32 24.635 25.945 15-19 24.735 23.64 24.98 26.645000000000003 20-24 25.155 23.72 24.575 26.55 25-29 25.53 23.575 23.9 26.995 30-34 24.915000000000003 24.075 24.175 26.834999999999997 35-39 25.025 24.015 23.845 27.115000000000002 40-44 25.035 23.685000000000002 24.325 26.955000000000002 45-49 25.025 24.279999999999998 23.655 27.04 50-54 25.564999999999998 23.655 24.08 26.700000000000003 55-59 25.590000000000003 23.745 23.79 26.875 60-64 25.515 23.62 23.955000000000002 26.91 65-69 25.775 22.575 24.41 27.24 70-74 25.380000000000003 23.41 23.935000000000002 27.275 75-79 25.53 23.990000000000002 23.585 26.895000000000003 80-84 26.179999999999996 23.735 23.235 26.85 85-89 25.86 23.18 23.555 27.405 90-94 25.724999999999998 23.48 23.575 27.22 95-99 25.905 22.689999999999998 24.04 27.365000000000002 100-104 26.205000000000002 23.225 23.635 26.935 105-109 26.450000000000003 23.105 23.505000000000003 26.939999999999998 110-114 25.8 22.64 23.24 28.32 115-119 26.32 23.055 23.555 27.07 120-124 26.22 22.46 23.919999999999998 27.400000000000002 125-129 26.38 23.03 23.535 27.055 130-134 26.045 22.775000000000002 23.68 27.500000000000004 135-139 26.855 23.395 22.865 26.884999999999998 140-144 26.32 23.13 23.175 27.375 145-149 26.105 22.945 23.24 27.71 150-151 26.487500000000004 22.15 23.925 27.437499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 2.0 28 1.5 29 3.5 30 7.5 31 8.0 32 9.0 33 19.5 34 28.5 35 31.0 36 43.0 37 51.0 38 63.0 39 71.5 40 83.5 41 110.5 42 122.0 43 137.5 44 152.0 45 161.5 46 177.5 47 169.0 48 148.5 49 148.5 50 131.0 51 113.0 52 121.5 53 129.5 54 118.0 55 103.5 56 95.0 57 85.5 58 83.0 59 104.5 60 114.0 61 91.5 62 86.0 63 87.0 64 84.5 65 81.0 66 73.0 67 78.0 68 78.5 69 63.5 70 62.5 71 55.5 72 44.5 73 40.0 74 30.5 75 25.5 76 20.0 77 14.0 78 10.5 79 7.5 80 5.0 81 3.0 82 2.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.21668909825034 86.575 2 6.056527590847914 11.25 3 0.5921938088829072 1.6500000000000001 4 0.10767160161507401 0.4 5 0.026917900403768503 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACCGATACGGTCTTCGCGGGTGGGGGCCCAGTAGAACTTCTCCATACGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.3625 0.0 0.0 0.0 0.0 130-131 1.5750000000000002 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGACGA 10 0.006830828 145.0 145 CTTCCTT 10 0.006830828 145.0 7 GGGGGGG 30 0.0014437955 24.166668 95-99 >>END_MODULE SRR7804097 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804097_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36275 37.0 37.0 37.0 37.0 37.0 2 36.137 37.0 37.0 37.0 37.0 37.0 3 36.075 37.0 37.0 37.0 37.0 37.0 4 36.263 37.0 37.0 37.0 37.0 37.0 5 36.13 37.0 37.0 37.0 37.0 37.0 6 36.184 37.0 37.0 37.0 37.0 37.0 7 36.2385 37.0 37.0 37.0 37.0 37.0 8 36.1925 37.0 37.0 37.0 37.0 37.0 9 36.082 37.0 37.0 37.0 37.0 37.0 10-14 36.1346 37.0 37.0 37.0 37.0 37.0 15-19 36.013200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.0653 37.0 37.0 37.0 37.0 37.0 25-29 35.9819 37.0 37.0 37.0 37.0 37.0 30-34 35.9729 37.0 37.0 37.0 37.0 37.0 35-39 35.96 37.0 37.0 37.0 37.0 37.0 40-44 35.9144 37.0 37.0 37.0 37.0 37.0 45-49 35.890499999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.8196 37.0 37.0 37.0 37.0 37.0 55-59 35.8185 37.0 37.0 37.0 37.0 37.0 60-64 35.73460000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.730900000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.7993 37.0 37.0 37.0 37.0 37.0 75-79 35.718399999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.722500000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.704100000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.673500000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.6332 37.0 37.0 37.0 37.0 37.0 100-104 35.581300000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.4784 37.0 37.0 37.0 37.0 37.0 110-114 35.421099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.422700000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.4465 37.0 37.0 37.0 37.0 37.0 125-129 35.3322 37.0 37.0 37.0 37.0 37.0 130-134 35.38420000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.2363 37.0 37.0 37.0 37.0 37.0 140-144 35.225699999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.0831 37.0 37.0 37.0 27.4 37.0 150-151 34.6215 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 11.0 15 8.0 16 6.0 17 3.0 18 5.0 19 3.0 20 5.0 21 8.0 22 12.0 23 7.0 24 10.0 25 15.0 26 13.0 27 13.0 28 18.0 29 16.0 30 28.0 31 27.0 32 58.0 33 88.0 34 179.0 35 454.0 36 2706.0 37 299.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.61040260065016 17.60440110027507 10.952738184546137 29.83245811452863 2 32.15 22.125 22.075 23.65 3 27.150000000000002 24.825 23.925 24.099999999999998 4 27.224999999999998 30.075000000000003 19.1 23.599999999999998 5 31.374999999999996 29.5 17.474999999999998 21.65 6 26.674999999999997 32.2 17.125 24.0 7 23.799999999999997 20.1 30.75 25.35 8 26.700000000000003 21.175 19.625 32.5 9 24.325 23.825 23.75 28.1 10-14 27.884999999999998 24.52 20.455000000000002 27.139999999999997 15-19 27.834999999999997 23.5 21.93 26.735 20-24 27.445000000000004 24.3 21.455 26.8 25-29 27.145000000000003 24.15 21.735 26.97 30-34 27.46 24.41 21.54 26.590000000000003 35-39 27.74 23.535 21.435000000000002 27.29 40-44 27.16 23.32 21.78 27.74 45-49 27.474999999999998 23.715 21.654999999999998 27.155 50-54 27.87 24.135 21.46 26.534999999999997 55-59 28.144999999999996 23.535 21.63 26.69 60-64 27.334999999999997 23.685000000000002 22.14 26.840000000000003 65-69 27.955000000000002 23.865 21.145 27.034999999999997 70-74 26.99 24.2 21.275 27.534999999999997 75-79 27.415 24.03 21.634999999999998 26.919999999999998 80-84 27.47 23.31 21.715 27.505000000000003 85-89 27.265 23.849999999999998 22.07 26.815 90-94 27.189999999999998 24.27 21.435000000000002 27.105 95-99 27.025 24.095 21.765 27.115000000000002 100-104 27.99 24.07 21.235 26.705000000000002 105-109 27.33 23.895 22.509999999999998 26.265 110-114 27.465 24.695 21.075 26.765 115-119 27.505000000000003 24.52 21.355 26.619999999999997 120-124 27.689999999999998 24.32 21.36 26.63 125-129 28.025 23.445 22.255 26.275 130-134 27.67 23.71 21.97 26.650000000000002 135-139 27.860000000000003 24.33 21.965 25.845000000000002 140-144 27.595 24.095 22.335 25.974999999999998 145-149 27.74 24.77 21.81 25.679999999999996 150-151 27.85 24.3875 21.4125 26.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 1.0 9 2.0 10 1.5 11 1.0 12 1.5 13 1.5 14 1.0 15 0.5 16 1.0 17 1.0 18 1.0 19 2.5 20 2.5 21 1.0 22 1.5 23 2.5 24 2.5 25 2.0 26 1.5 27 2.0 28 3.0 29 3.0 30 3.5 31 4.0 32 8.0 33 10.0 34 12.0 35 19.0 36 19.5 37 27.0 38 44.5 39 65.5 40 76.0 41 92.0 42 95.0 43 102.0 44 132.5 45 143.5 46 143.5 47 140.5 48 144.0 49 136.5 50 120.0 51 118.0 52 123.0 53 112.0 54 106.5 55 110.0 56 98.5 57 102.5 58 109.0 59 101.5 60 100.5 61 94.5 62 100.5 63 112.5 64 94.5 65 83.0 66 92.5 67 87.5 68 97.5 69 100.0 70 81.0 71 77.5 72 70.5 73 55.0 74 44.0 75 39.5 76 30.0 77 19.5 78 15.0 79 9.5 80 4.5 81 3.0 82 1.0 83 2.5 84 3.5 85 1.0 86 0.5 87 1.5 88 1.0 89 0.0 90 0.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.5 96 1.5 97 2.5 98 1.5 99 0.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.125 #Duplication Level Percentage of deduplicated Percentage of total 1 92.83582089552239 85.52499999999999 2 6.241519674355495 11.5 3 0.8141112618724559 2.25 4 0.08141112618724558 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027137042062415198 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.6000000000000001 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.5750000000000002 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 1.9749999999999999 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326551 spots for SRR7804097.sra Written 1326551 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra Read 1326532 spots for SRR7804097.sra Written 1326532 spots for SRR7804097.sra SRR ids: ['SRR7804097.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8pw9pjtn SRR7804097.sra spots: 26530659 blocks: [[1, 1326532], [1326533, 2653064], [2653065, 3979596], [3979597, 5306128], [5306129, 6632660], [6632661, 7959192], [7959193, 9285724], [9285725, 10612256], [10612257, 11938788], [11938789, 13265320], [13265321, 14591852], [14591853, 15918384], [15918385, 17244916], [17244917, 18571448], [18571449, 19897980], [19897981, 21224512], [21224513, 22551044], [22551045, 23877576], [23877577, 25204108], [25204109, 26530659]] SRR7804097 file size 8968669 SRR7804097 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804097 SRR7804097_1.fastq SRR7804097_2.fastq Input file: SRR7804097_1.fastq Paired file: SRR7804097_2.fastq trimmed: SRR7804097-trimmed-pair1.fastq, SRR7804097-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:38:02 2024 >> started Tue Dec 10 01:38:32 2024 >> done (30.872s) 26530659 read pairs processed; of these: 142 ( 0.00%) short read pairs filtered out after trimming by size control 791 ( 0.00%) empty read pairs filtered out after trimming by size control 26529726 (100.00%) read pairs available; of these: 912025 ( 3.44%) trimmed read pairs available after processing 25617701 (96.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 10 0.00% 20 12 0.00% 21 14 0.00% 22 15 0.00% 23 11 0.00% 24 15 0.00% 25 22 0.00% 26 21 0.00% 27 27 0.00% 28 25 0.00% 29 27 0.00% 30 15 0.00% 31 19 0.00% 32 25 0.00% 33 23 0.00% 34 22 0.00% 35 17 0.00% 36 24 0.00% 37 28 0.00% 38 20 0.00% 39 23 0.00% 40 19 0.00% 41 34 0.00% 42 36 0.00% 43 37 0.00% 44 42 0.00% 45 16 0.00% 46 36 0.00% 47 33 0.00% 48 38 0.00% 49 49 0.00% 50 28 0.00% 51 46 0.00% 52 46 0.00% 53 47 0.00% 54 46 0.00% 55 46 0.00% 56 51 0.00% 57 54 0.00% 58 40 0.00% 59 46 0.00% 60 71 0.00% 61 72 0.00% 62 57 0.00% 63 87 0.00% 64 68 0.00% 65 76 0.00% 66 73 0.00% 67 84 0.00% 68 126 0.00% 69 120 0.00% 70 114 0.00% 71 169 0.00% 72 172 0.00% 73 191 0.00% 74 205 0.00% 75 202 0.00% 76 264 0.00% 77 274 0.00% 78 318 0.00% 79 366 0.00% 80 398 0.00% 81 487 0.00% 82 541 0.00% 83 597 0.00% 84 715 0.00% 85 823 0.00% 86 849 0.00% 87 949 0.00% 88 1033 0.00% 89 1235 0.00% 90 1212 0.00% 91 1481 0.01% 92 1647 0.01% 93 1822 0.01% 94 2031 0.01% 95 2216 0.01% 96 2387 0.01% 97 2522 0.01% 98 2823 0.01% 99 3035 0.01% 100 3174 0.01% 101 3628 0.01% 102 3931 0.01% 103 4436 0.02% 104 4745 0.02% 105 5092 0.02% 106 5304 0.02% 107 5530 0.02% 108 5980 0.02% 109 6229 0.02% 110 6713 0.03% 111 7226 0.03% 112 7944 0.03% 113 8373 0.03% 114 9218 0.03% 115 9629 0.04% 116 9898 0.04% 117 10332 0.04% 118 10675 0.04% 119 11323 0.04% 120 11533 0.04% 121 12204 0.05% 122 12976 0.05% 123 14053 0.05% 124 14975 0.06% 125 15741 0.06% 126 16615 0.06% 127 16886 0.06% 128 17604 0.07% 129 18295 0.07% 130 18415 0.07% 131 19156 0.07% 132 20112 0.08% 133 21439 0.08% 134 22856 0.09% 135 23820 0.09% 136 24538 0.09% 137 25306 0.10% 138 25335 0.10% 139 26717 0.10% 140 26961 0.10% 141 27834 0.10% 142 29372 0.11% 143 30551 0.12% 144 32448 0.12% 145 33404 0.13% 146 34190 0.13% 147 35549 0.13% 148 36117 0.14% 149 36948 0.14% 150 37569 0.14% 151 25617701 96.56% 26529726 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=4.48 fanout-score-rank=12 prefix-density=0.96 prefix-fanout=3.5 sequence=AGGTTCTCGAGGG criterion=fanout-score sequence-density=0.23 sequence-density-rank=31 fanout-score=24.65 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=7.0 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=21 prefix-density=0.98 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=109.46 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=3.7 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7804097 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:39:23 Started mapping on | Dec 10 01:39:23 Finished on | Dec 10 01:43:54 Mapping speed, Million of reads per hour | 352.42 Number of input reads | 26529726 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 23821440 Uniquely mapped reads % | 89.79% Average mapped length | 299.48 Number of splices: Total | 25015389 Number of splices: Annotated (sjdb) | 23742610 Number of splices: GT/AG | 24651060 Number of splices: GC/AG | 303622 Number of splices: AT/AC | 7584 Number of splices: Non-canonical | 53123 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373751 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 37320 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.54% % of reads unmapped: other | 1.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2334535 2334535 2334535 N_multimapping 373751 373751 373751 N_noFeature 707771 23160840 855968 N_ambiguous 672499 4046 161199 UnstrandedReadsAssigned:22441170 PositiveStrandReadsAssigned:656554 NegativeStrandReadsAssigned:22804273 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804097 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804097-trimmed-pair1.fastq SRR7804097-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,529,726 reads, 23,106,015 reads pseudoaligned [quant] estimated average fragment length: 305.866 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52973 SRR7804097.ke.tsv 35125 SRR7804097.se.tsv 88098 total ==> SRR7804097.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 631.571 0 0 PNS24247 1044 739.134 56.426 3.98837 PNS24249 1928 1623.13 106.616 3.43169 PNS24246 1044 739.134 56.426 3.98837 PNS24248 1044 739.134 56.426 3.98837 PNS24244 1471 1166.13 45.1059 2.02081 PNS24243 293 76.9106 0 0 KQK14069 1603 1298.13 1125.6 45.3005 KQK14071 474 199.446 10.4443 2.73586 ==> SRR7804097.se.tsv <== BRADI_1g14170v3 1174 BRADI_1g53295v3 540 BRADI_1g59795v3 472 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 225 BRADI_1g74790v3 175 BRADI_1g09890v3 0 BRADI_1g77505v3 380 BRADI_1g48960v3 0 SRR7804097 completed mapping pipeline successfully