Starting /dee2/code/volunteer_pipeline.sh SRR7804098 current disk space = 1541705494528 free memory = 1414996152 SRR7804098 SRAfilesize 0382aaef9ed40d0627072c386a05e3fd SRR7804098.sra SRR7804098.sra file validated SRR7804098 is paired end SRR7804098 is conventional basespace SRR7804098 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804098_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.251 37.0 37.0 37.0 37.0 37.0 2 36.273 37.0 37.0 37.0 37.0 37.0 3 36.3705 37.0 37.0 37.0 37.0 37.0 4 36.375 37.0 37.0 37.0 37.0 37.0 5 36.508 37.0 37.0 37.0 37.0 37.0 6 36.517 37.0 37.0 37.0 37.0 37.0 7 36.3875 37.0 37.0 37.0 37.0 37.0 8 36.512 37.0 37.0 37.0 37.0 37.0 9 36.3795 37.0 37.0 37.0 37.0 37.0 10-14 36.4552 37.0 37.0 37.0 37.0 37.0 15-19 36.4341 37.0 37.0 37.0 37.0 37.0 20-24 36.4243 37.0 37.0 37.0 37.0 37.0 25-29 36.3978 37.0 37.0 37.0 37.0 37.0 30-34 36.339800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3425 37.0 37.0 37.0 37.0 37.0 40-44 36.3574 37.0 37.0 37.0 37.0 37.0 45-49 36.3372 37.0 37.0 37.0 37.0 37.0 50-54 36.330600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.297 37.0 37.0 37.0 37.0 37.0 60-64 36.2924 37.0 37.0 37.0 37.0 37.0 65-69 36.253 37.0 37.0 37.0 37.0 37.0 70-74 36.22709999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1976 37.0 37.0 37.0 37.0 37.0 80-84 36.166399999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.17289999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2049 37.0 37.0 37.0 37.0 37.0 95-99 36.0955 37.0 37.0 37.0 37.0 37.0 100-104 36.08669999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.0241 37.0 37.0 37.0 37.0 37.0 110-114 35.980900000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.01370000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.944500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.847500000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.862700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.791 37.0 37.0 37.0 37.0 37.0 140-144 35.75019999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7301 37.0 37.0 37.0 37.0 37.0 150-151 35.24825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 2.0 25 3.0 26 2.0 27 10.0 28 14.0 29 22.0 30 32.0 31 49.0 32 57.0 33 94.0 34 151.0 35 355.0 36 2813.0 37 394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.85 11.450000000000001 8.725 33.975 2 26.900000000000002 11.5 30.975 30.625000000000004 3 24.474999999999998 15.4 22.775000000000002 37.35 4 29.725 20.849999999999998 21.725 27.700000000000003 5 29.25 25.2 22.2 23.35 6 24.025 30.625000000000004 22.35 23.0 7 20.25 22.225 34.075 23.45 8 23.200000000000003 23.3 27.200000000000003 26.3 9 22.475 19.75 32.2 25.575 10-14 25.2 24.15 24.169999999999998 26.479999999999997 15-19 25.869999999999997 23.135 24.03 26.965 20-24 25.585 23.455000000000002 24.560000000000002 26.400000000000002 25-29 24.775 23.95 23.605 27.67 30-34 25.180000000000003 23.82 23.84 27.16 35-39 25.545 23.474999999999998 23.805 27.175 40-44 25.259999999999998 22.915 24.285 27.54 45-49 25.52 23.235 24.255 26.99 50-54 26.224999999999998 23.235 23.535 27.005000000000003 55-59 25.09 23.635 23.505000000000003 27.77 60-64 25.669999999999998 23.36 23.595 27.375 65-69 26.195 22.85 23.73 27.224999999999998 70-74 26.52 22.925 23.285 27.27 75-79 26.340000000000003 23.24 23.34 27.08 80-84 25.77 22.825 23.745 27.66 85-89 25.53 22.62 24.065 27.785 90-94 26.52 23.400000000000002 23.005 27.075 95-99 26.195 23.66 22.53 27.615000000000002 100-104 26.290000000000003 23.22 22.99 27.500000000000004 105-109 26.840000000000003 22.615 23.455000000000002 27.089999999999996 110-114 26.13 23.025000000000002 22.955000000000002 27.889999999999997 115-119 27.16 22.58 22.985 27.275 120-124 26.695 22.314999999999998 22.85 28.139999999999997 125-129 26.14 22.15 23.23 28.48 130-134 27.22 22.189999999999998 23.235 27.355 135-139 26.695 22.755 23.34 27.21 140-144 26.88 22.425 23.080000000000002 27.615000000000002 145-149 27.37 22.345000000000002 22.905 27.38 150-151 27.275 21.637500000000003 23.200000000000003 27.8875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 2.0 29 3.0 30 2.5 31 6.0 32 12.5 33 15.0 34 17.0 35 24.0 36 34.0 37 44.0 38 47.5 39 59.5 40 86.0 41 104.0 42 112.0 43 126.5 44 144.0 45 150.5 46 152.5 47 146.5 48 135.0 49 138.5 50 145.5 51 137.5 52 119.0 53 107.5 54 104.0 55 103.5 56 98.5 57 109.0 58 117.0 59 112.0 60 113.0 61 119.5 62 132.0 63 109.0 64 89.5 65 93.5 66 96.0 67 90.0 68 80.0 69 71.5 70 59.5 71 52.5 72 43.0 73 32.5 74 30.5 75 23.5 76 13.5 77 10.0 78 5.5 79 4.0 80 2.0 81 2.5 82 2.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.96685529506871 86.25 2 6.359471840474265 11.799999999999999 3 0.5928321207221773 1.6500000000000001 4 0.08084074373484236 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.1375000000000002 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.4500000000000002 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.725 0.0 0.0 0.0 0.0 138-139 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTTCA 10 0.006830828 145.0 3 GATTCAC 10 0.006830828 145.0 1 >>END_MODULE SRR7804098 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804098_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32675 37.0 37.0 37.0 37.0 37.0 2 36.0495 37.0 37.0 37.0 37.0 37.0 3 36.2085 37.0 37.0 37.0 37.0 37.0 4 36.1995 37.0 37.0 37.0 37.0 37.0 5 36.046 37.0 37.0 37.0 37.0 37.0 6 36.2 37.0 37.0 37.0 37.0 37.0 7 36.041 37.0 37.0 37.0 37.0 37.0 8 36.354 37.0 37.0 37.0 37.0 37.0 9 36.1175 37.0 37.0 37.0 37.0 37.0 10-14 36.14020000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.032000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.0662 37.0 37.0 37.0 37.0 37.0 25-29 36.0468 37.0 37.0 37.0 37.0 37.0 30-34 36.0159 37.0 37.0 37.0 37.0 37.0 35-39 35.9616 37.0 37.0 37.0 37.0 37.0 40-44 35.9346 37.0 37.0 37.0 37.0 37.0 45-49 35.899899999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.879599999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.849900000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.8591 37.0 37.0 37.0 37.0 37.0 65-69 35.79729999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.806000000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.7193 37.0 37.0 37.0 37.0 37.0 80-84 35.7208 37.0 37.0 37.0 37.0 37.0 85-89 35.7794 37.0 37.0 37.0 37.0 37.0 90-94 35.6947 37.0 37.0 37.0 37.0 37.0 95-99 35.56270000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.609 37.0 37.0 37.0 37.0 37.0 105-109 35.556799999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.448899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.4052 37.0 37.0 37.0 37.0 37.0 120-124 35.4868 37.0 37.0 37.0 37.0 37.0 125-129 35.2899 37.0 37.0 37.0 34.6 37.0 130-134 35.421400000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.2343 37.0 37.0 37.0 37.0 37.0 140-144 35.2997 37.0 37.0 37.0 34.6 37.0 145-149 35.108399999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.585 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 8.0 15 7.0 16 5.0 17 2.0 18 2.0 19 5.0 20 4.0 21 6.0 22 3.0 23 3.0 24 10.0 25 13.0 26 8.0 27 12.0 28 12.0 29 24.0 30 29.0 31 47.0 32 66.0 33 110.0 34 198.0 35 522.0 36 2668.0 37 230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.359589897474365 17.504376094023506 11.002750687671918 33.13328332083021 2 32.35 21.099999999999998 22.975 23.575 3 25.174999999999997 24.349999999999998 23.9 26.575 4 28.425 27.750000000000004 17.150000000000002 26.674999999999997 5 27.900000000000002 32.0 17.224999999999998 22.875 6 24.925 33.225 18.05 23.799999999999997 7 24.875 19.975 29.875 25.275 8 25.474999999999998 21.875 20.325 32.324999999999996 9 23.5 22.5 25.6 28.4 10-14 27.555000000000003 23.625 20.919999999999998 27.900000000000002 15-19 27.310000000000002 23.35 21.255 28.084999999999997 20-24 27.43 23.75 21.69 27.13 25-29 27.389999999999997 24.12 20.865000000000002 27.625 30-34 27.334999999999997 23.77 21.905 26.99 35-39 27.32 23.82 21.529999999999998 27.33 40-44 27.425 23.055 21.62 27.900000000000002 45-49 27.435 24.345 21.240000000000002 26.979999999999997 50-54 27.765 23.880000000000003 20.830000000000002 27.525 55-59 28.585 22.095000000000002 21.295 28.025 60-64 27.339999999999996 23.13 21.805 27.725 65-69 27.105 23.080000000000002 21.46 28.355000000000004 70-74 27.650000000000002 22.615 21.785 27.950000000000003 75-79 27.37 22.54 21.759999999999998 28.33 80-84 27.455000000000002 22.875 21.529999999999998 28.139999999999997 85-89 27.189999999999998 23.22 20.845 28.744999999999997 90-94 27.189999999999998 22.759999999999998 21.51 28.54 95-99 28.02 23.32 21.085 27.575 100-104 28.060000000000002 23.505000000000003 20.65 27.785 105-109 28.28 22.405 21.98 27.334999999999997 110-114 28.165000000000003 23.185 20.955 27.694999999999997 115-119 27.400000000000002 22.7 21.97 27.93 120-124 28.470000000000002 22.985 21.310000000000002 27.235 125-129 28.435 23.125 21.135 27.305 130-134 28.46 23.195 21.535 26.810000000000002 135-139 28.01 23.745 21.575 26.669999999999998 140-144 28.249999999999996 23.455000000000002 21.675 26.619999999999997 145-149 27.74 23.885 21.575 26.8 150-151 27.6625 24.575 21.05 26.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.5 6 0.5 7 1.0 8 2.5 9 1.5 10 0.0 11 0.0 12 0.5 13 2.0 14 1.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 1.0 27 1.0 28 0.5 29 1.5 30 3.5 31 4.0 32 5.0 33 6.0 34 10.5 35 16.0 36 19.5 37 30.5 38 38.5 39 46.5 40 66.5 41 94.5 42 104.0 43 95.0 44 107.0 45 127.0 46 127.0 47 122.5 48 121.0 49 124.0 50 125.0 51 123.0 52 119.0 53 107.5 54 108.0 55 113.0 56 100.0 57 99.0 58 108.5 59 113.5 60 129.5 61 134.5 62 137.0 63 130.0 64 124.0 65 115.0 66 100.0 67 98.5 68 100.0 69 98.5 70 71.0 71 71.0 72 73.0 73 49.5 74 40.5 75 36.0 76 25.0 77 13.0 78 9.0 79 4.5 80 5.0 81 5.0 82 2.0 83 0.5 84 1.0 85 1.0 86 1.0 87 1.5 88 1.5 89 1.0 90 0.5 91 0.5 92 1.0 93 1.0 94 0.5 95 1.0 96 0.5 97 0.5 98 1.0 99 0.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.77338423779656 85.05 2 6.217616580310881 11.4 3 0.763566948459231 2.1 4 0.08181074447777476 0.3 5 0.02727024815925825 0.125 6 0.02727024815925825 0.15 7 0.08181074447777476 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.02727024815925825 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 7 0.17500000000000002 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit CCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAA 7 0.17500000000000002 No Hit AAACGATCTAGTGCAGCAGCAGCTTGCTCTCTCCTCCATCTAGTAGAAGA 6 0.15 No Hit GCTCATCATCTTGTTCAATCCCAAAGCTCTTCTTCTTCTCCTCCTTGATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.7875000000000001 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.2000000000000002 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.5750000000000002 0.0 0.0 0.0 0.0 136-137 1.6749999999999998 0.0 0.0 0.0 0.0 138-139 1.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGGA 10 0.006830828 145.0 145 AGCAACA 10 0.006830828 145.0 3 >>END_MODULE Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra Read 1673788 spots for SRR7804098.sra Written 1673788 spots for SRR7804098.sra Read 1673773 spots for SRR7804098.sra Written 1673773 spots for SRR7804098.sra SRR ids: ['SRR7804098.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9den3szt SRR7804098.sra spots: 33475475 blocks: [[1, 1673773], [1673774, 3347546], [3347547, 5021319], [5021320, 6695092], [6695093, 8368865], [8368866, 10042638], [10042639, 11716411], [11716412, 13390184], [13390185, 15063957], [15063958, 16737730], [16737731, 18411503], [18411504, 20085276], [20085277, 21759049], [21759050, 23432822], [23432823, 25106595], [25106596, 26780368], [26780369, 28454141], [28454142, 30127914], [30127915, 31801687], [31801688, 33475475]] SRR7804098 file size 11322039 SRR7804098 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804098 SRR7804098_1.fastq SRR7804098_2.fastq Input file: SRR7804098_1.fastq Paired file: SRR7804098_2.fastq trimmed: SRR7804098-trimmed-pair1.fastq, SRR7804098-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:47:02 2024 >> started Sat Dec 7 16:47:51 2024 >> done (48.708s) 33475475 read pairs processed; of these: 97 ( 0.00%) short read pairs filtered out after trimming by size control 1731 ( 0.01%) empty read pairs filtered out after trimming by size control 33473647 (99.99%) read pairs available; of these: 869847 ( 2.60%) trimmed read pairs available after processing 32603800 (97.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 15 0.00% 20 9 0.00% 21 9 0.00% 22 19 0.00% 23 20 0.00% 24 11 0.00% 25 13 0.00% 26 18 0.00% 27 18 0.00% 28 17 0.00% 29 24 0.00% 30 25 0.00% 31 12 0.00% 32 38 0.00% 33 34 0.00% 34 19 0.00% 35 28 0.00% 36 21 0.00% 37 27 0.00% 38 28 0.00% 39 27 0.00% 40 34 0.00% 41 34 0.00% 42 25 0.00% 43 32 0.00% 44 36 0.00% 45 29 0.00% 46 39 0.00% 47 35 0.00% 48 52 0.00% 49 53 0.00% 50 38 0.00% 51 47 0.00% 52 51 0.00% 53 47 0.00% 54 47 0.00% 55 57 0.00% 56 45 0.00% 57 46 0.00% 58 69 0.00% 59 67 0.00% 60 71 0.00% 61 79 0.00% 62 67 0.00% 63 91 0.00% 64 88 0.00% 65 103 0.00% 66 117 0.00% 67 151 0.00% 68 137 0.00% 69 135 0.00% 70 188 0.00% 71 187 0.00% 72 204 0.00% 73 253 0.00% 74 261 0.00% 75 287 0.00% 76 312 0.00% 77 387 0.00% 78 416 0.00% 79 492 0.00% 80 491 0.00% 81 549 0.00% 82 683 0.00% 83 755 0.00% 84 849 0.00% 85 877 0.00% 86 1057 0.00% 87 1142 0.00% 88 1254 0.00% 89 1310 0.00% 90 1519 0.00% 91 1593 0.00% 92 1863 0.01% 93 2024 0.01% 94 2211 0.01% 95 2484 0.01% 96 2578 0.01% 97 2675 0.01% 98 3002 0.01% 99 3251 0.01% 100 3433 0.01% 101 3694 0.01% 102 3948 0.01% 103 4255 0.01% 104 4688 0.01% 105 4997 0.01% 106 5210 0.02% 107 5469 0.02% 108 5818 0.02% 109 6148 0.02% 110 6500 0.02% 111 6903 0.02% 112 7420 0.02% 113 7945 0.02% 114 8434 0.03% 115 8874 0.03% 116 9386 0.03% 117 9873 0.03% 118 10172 0.03% 119 10458 0.03% 120 11271 0.03% 121 11332 0.03% 122 12085 0.04% 123 12810 0.04% 124 13685 0.04% 125 14430 0.04% 126 14744 0.04% 127 15764 0.05% 128 16115 0.05% 129 17029 0.05% 130 17560 0.05% 131 18189 0.05% 132 19329 0.06% 133 20313 0.06% 134 20902 0.06% 135 21563 0.06% 136 22836 0.07% 137 23593 0.07% 138 24028 0.07% 139 25269 0.08% 140 25891 0.08% 141 26981 0.08% 142 27925 0.08% 143 29145 0.09% 144 30523 0.09% 145 31489 0.09% 146 32589 0.10% 147 33917 0.10% 148 34559 0.10% 149 35989 0.11% 150 36849 0.11% 151 32603800 97.40% 33473647 reads passed initial QC criterion=sequence-density sequence-density=1.37 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=25 prefix-density=1.45 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=39.50 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.4 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=1.23 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=26 prefix-density=1.27 prefix-fanout=2.1 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=78.74 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=2.2 sequence=GCAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804098 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:50:04 Started mapping on | Dec 07 16:50:04 Finished on | Dec 07 16:55:51 Mapping speed, Million of reads per hour | 347.28 Number of input reads | 33473647 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 31110392 Uniquely mapped reads % | 92.94% Average mapped length | 299.89 Number of splices: Total | 32791571 Number of splices: Annotated (sjdb) | 31188444 Number of splices: GT/AG | 32322412 Number of splices: GC/AG | 392687 Number of splices: AT/AC | 8999 Number of splices: Non-canonical | 67473 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351072 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 26582 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.38% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2012183 2012183 2012183 N_multimapping 351072 351072 351072 N_noFeature 683098 30219369 847955 N_ambiguous 906828 3999 183157 UnstrandedReadsAssigned:29520466 PositiveStrandReadsAssigned:887024 NegativeStrandReadsAssigned:30079280 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804098 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804098-trimmed-pair1.fastq SRR7804098-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,473,647 reads, 30,227,072 reads pseudoaligned [quant] estimated average fragment length: 312.121 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 SRR7804098.ke.tsv 35125 SRR7804098.se.tsv 88098 total ==> SRR7804098.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 625.49 0 0 PNS24247 1044 732.879 67.5081 3.67212 PNS24249 1928 1616.88 109.713 2.70505 PNS24246 1044 732.879 67.5081 3.67212 PNS24248 1044 732.879 67.5081 3.67212 PNS24244 1471 1159.88 78.7625 2.70707 PNS24243 293 73.1382 0 0 KQK14069 1603 1291.88 512.421 15.8124 KQK14071 474 194.54 15.2009 3.11497 ==> SRR7804098.se.tsv <== BRADI_1g14170v3 558 BRADI_1g53295v3 610 BRADI_1g59795v3 551 BRADI_1g07683v3 1 BRADI_1g00485v3 5 BRADI_1g20270v3 363 BRADI_1g74790v3 144 BRADI_1g09890v3 0 BRADI_1g77505v3 376 BRADI_1g48960v3 0 SRR7804098 completed mapping pipeline successfully