Starting /dee2/code/volunteer_pipeline.sh SRR7804099 current disk space = 1523294842880 free memory = 1562073756 SRR7804099 SRAfilesize ce3ef1d9d0af6ee001e66e3db7a05eb0 SRR7804099.sra SRR7804099.sra file validated SRR7804099 is paired end SRR7804099 is conventional basespace SRR7804099 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804099_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1225 37.0 37.0 37.0 37.0 37.0 2 36.2395 37.0 37.0 37.0 37.0 37.0 3 36.341 37.0 37.0 37.0 37.0 37.0 4 36.3975 37.0 37.0 37.0 37.0 37.0 5 36.5255 37.0 37.0 37.0 37.0 37.0 6 36.4275 37.0 37.0 37.0 37.0 37.0 7 36.4145 37.0 37.0 37.0 37.0 37.0 8 36.5275 37.0 37.0 37.0 37.0 37.0 9 36.4915 37.0 37.0 37.0 37.0 37.0 10-14 36.512 37.0 37.0 37.0 37.0 37.0 15-19 36.47089999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4274 37.0 37.0 37.0 37.0 37.0 25-29 36.4177 37.0 37.0 37.0 37.0 37.0 30-34 36.3971 37.0 37.0 37.0 37.0 37.0 35-39 36.4168 37.0 37.0 37.0 37.0 37.0 40-44 36.4047 37.0 37.0 37.0 37.0 37.0 45-49 36.38960000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.3894 37.0 37.0 37.0 37.0 37.0 55-59 36.3363 37.0 37.0 37.0 37.0 37.0 60-64 36.35770000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2967 37.0 37.0 37.0 37.0 37.0 70-74 36.301 37.0 37.0 37.0 37.0 37.0 75-79 36.25359999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.2433 37.0 37.0 37.0 37.0 37.0 85-89 36.237899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.168899999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.174800000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.13440000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.07340000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.0767 37.0 37.0 37.0 37.0 37.0 115-119 36.0745 37.0 37.0 37.0 37.0 37.0 120-124 36.037 37.0 37.0 37.0 37.0 37.0 125-129 35.932100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.905499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.8982 37.0 37.0 37.0 37.0 37.0 140-144 35.8692 37.0 37.0 37.0 37.0 37.0 145-149 35.8185 37.0 37.0 37.0 37.0 37.0 150-151 35.41 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 2.0 26 5.0 27 12.0 28 12.0 29 18.0 30 27.0 31 40.0 32 64.0 33 88.0 34 151.0 35 283.0 36 2891.0 37 405.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.025 11.175 8.525 34.275 2 27.613806903451728 12.356178089044523 31.36568284142071 28.66433216608304 3 22.650000000000002 17.724999999999998 24.375 35.25 4 27.275 22.275 21.0 29.45 5 27.474999999999998 26.950000000000003 21.65 23.925 6 24.25 30.8 22.55 22.400000000000002 7 19.825 21.875 37.0 21.3 8 21.4 22.825 26.900000000000002 28.875 9 21.65 20.575 31.825 25.95 10-14 25.445 23.59 24.235 26.729999999999997 15-19 25.255 23.400000000000002 24.925 26.419999999999998 20-24 25.185000000000002 24.455 24.295 26.064999999999998 25-29 25.19 23.165 24.285 27.36 30-34 25.230000000000004 23.72 24.175 26.875 35-39 25.509999999999998 23.525 24.085 26.88 40-44 24.745 23.59 24.025 27.639999999999997 45-49 25.2 23.505000000000003 24.07 27.224999999999998 50-54 25.685000000000002 23.200000000000003 23.995 27.12 55-59 25.759999999999998 23.11 23.919999999999998 27.21 60-64 25.335 22.884999999999998 24.169999999999998 27.61 65-69 25.995 22.935 23.875 27.195000000000004 70-74 26.075 22.945 23.355 27.625 75-79 26.105 22.935 23.785 27.175 80-84 25.509999999999998 22.785 24.08 27.625 85-89 26.19 23.07 23.04 27.700000000000003 90-94 26.31 23.125 23.425 27.139999999999997 95-99 25.91 22.745 24.075 27.27 100-104 26.11 23.02 23.455000000000002 27.415 105-109 26.39 23.04 23.735 26.834999999999997 110-114 26.245 22.97 23.75 27.034999999999997 115-119 26.68 22.689999999999998 23.400000000000002 27.229999999999997 120-124 26.615 22.415 23.76 27.21 125-129 26.36 22.655 23.665 27.32 130-134 26.495 22.3 23.79 27.415 135-139 26.615 22.7 23.57 27.115000000000002 140-144 27.150000000000002 21.87 23.46 27.52 145-149 26.974999999999998 22.615 22.615 27.794999999999998 150-151 26.8125 22.8 23.3875 27.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 1.0 29 4.0 30 8.5 31 7.0 32 7.0 33 11.5 34 19.0 35 28.0 36 31.0 37 39.5 38 51.0 39 64.0 40 85.0 41 105.0 42 115.0 43 131.5 44 149.0 45 150.0 46 155.0 47 162.0 48 168.5 49 169.5 50 150.0 51 126.5 52 121.5 53 119.5 54 102.5 55 103.5 56 107.0 57 101.5 58 111.0 59 113.5 60 112.0 61 103.5 62 86.5 63 87.0 64 91.0 65 83.5 66 84.5 67 83.5 68 72.5 69 71.0 70 61.0 71 51.5 72 47.0 73 31.5 74 25.0 75 26.0 76 19.0 77 12.5 78 7.5 79 6.5 80 8.5 81 4.0 82 1.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.97060424605334 84.475 2 7.24006532389766 13.3 3 0.7348938486663037 2.025 4 0.05443658138268917 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0125 104-105 0.16249999999999998 0.0 0.0 0.0 0.025 106-107 0.175 0.0 0.0 0.0 0.025 108-109 0.2 0.0 0.0 0.0 0.025 110-111 0.2625 0.0 0.0 0.0 0.025 112-113 0.3125 0.0 0.0 0.0 0.025 114-115 0.325 0.0 0.0 0.0 0.025 116-117 0.375 0.0 0.0 0.0 0.025 118-119 0.4625 0.0 0.0 0.0 0.025 120-121 0.6499999999999999 0.0 0.0 0.0 0.025 122-123 0.7 0.0 0.0 0.0 0.025 124-125 0.825 0.0 0.0 0.0 0.025 126-127 0.8875 0.0 0.0 0.0 0.025 128-129 1.0 0.0 0.0 0.0 0.025 130-131 1.1375000000000002 0.0 0.0 0.0 0.025 132-133 1.25 0.0 0.0 0.0 0.025 134-135 1.3875000000000002 0.0 0.0 0.0 0.025 136-137 1.5750000000000002 0.0 0.0 0.0 0.025 138-139 1.725 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804099 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804099_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.249 37.0 37.0 37.0 37.0 37.0 2 36.017 37.0 37.0 37.0 37.0 37.0 3 36.092 37.0 37.0 37.0 37.0 37.0 4 36.08 37.0 37.0 37.0 37.0 37.0 5 36.188 37.0 37.0 37.0 37.0 37.0 6 36.1365 37.0 37.0 37.0 37.0 37.0 7 35.9455 37.0 37.0 37.0 37.0 37.0 8 36.1635 37.0 37.0 37.0 37.0 37.0 9 36.097 37.0 37.0 37.0 37.0 37.0 10-14 36.110400000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.0282 37.0 37.0 37.0 37.0 37.0 20-24 36.0588 37.0 37.0 37.0 37.0 37.0 25-29 36.0684 37.0 37.0 37.0 37.0 37.0 30-34 36.048500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.0315 37.0 37.0 37.0 37.0 37.0 40-44 35.9493 37.0 37.0 37.0 37.0 37.0 45-49 35.8915 37.0 37.0 37.0 37.0 37.0 50-54 35.8132 37.0 37.0 37.0 37.0 37.0 55-59 35.8161 37.0 37.0 37.0 37.0 37.0 60-64 35.885 37.0 37.0 37.0 37.0 37.0 65-69 35.75410000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.823299999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7246 37.0 37.0 37.0 37.0 37.0 80-84 35.7464 37.0 37.0 37.0 37.0 37.0 85-89 35.6727 37.0 37.0 37.0 37.0 37.0 90-94 35.7692 37.0 37.0 37.0 37.0 37.0 95-99 35.6382 37.0 37.0 37.0 37.0 37.0 100-104 35.64 37.0 37.0 37.0 37.0 37.0 105-109 35.6149 37.0 37.0 37.0 37.0 37.0 110-114 35.4274 37.0 37.0 37.0 37.0 37.0 115-119 35.459500000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.4324 37.0 37.0 37.0 37.0 37.0 125-129 35.4529 37.0 37.0 37.0 37.0 37.0 130-134 35.3729 37.0 37.0 37.0 37.0 37.0 135-139 35.263 37.0 37.0 37.0 32.2 37.0 140-144 35.3048 37.0 37.0 37.0 32.2 37.0 145-149 35.1204 37.0 37.0 37.0 27.4 37.0 150-151 34.67075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 8.0 15 2.0 16 4.0 17 3.0 18 0.0 19 5.0 20 7.0 21 7.0 22 9.0 23 8.0 24 11.0 25 10.0 26 9.0 27 14.0 28 18.0 29 25.0 30 48.0 31 43.0 32 55.0 33 89.0 34 154.0 35 516.0 36 2683.0 37 267.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.11955977988995 18.234117058529264 9.804902451225612 32.84142071035518 2 31.95 20.925 24.05 23.075000000000003 3 24.25 24.65 25.15 25.95 4 26.35 29.875 18.925 24.85 5 29.575000000000003 29.375 18.4 22.650000000000002 6 25.650000000000002 32.375 18.475 23.5 7 25.474999999999998 19.3 29.15 26.075 8 25.1 21.575 21.7 31.624999999999996 9 25.35 22.2 25.25 27.200000000000003 10-14 27.575 24.474999999999998 20.715 27.235 15-19 26.955000000000002 23.82 22.314999999999998 26.91 20-24 27.405 24.675 20.87 27.05 25-29 27.07 23.555 21.795 27.58 30-34 26.66 24.29 21.92 27.13 35-39 27.029999999999998 24.22 21.240000000000002 27.51 40-44 27.875 23.79 21.745 26.590000000000003 45-49 27.255000000000003 24.16 21.58 27.005000000000003 50-54 26.825 24.185000000000002 21.89 27.1 55-59 27.35 23.94 21.085 27.625 60-64 27.205000000000002 23.755000000000003 21.84 27.200000000000003 65-69 27.205000000000002 24.05 21.185000000000002 27.560000000000002 70-74 27.655 22.99 21.91 27.445000000000004 75-79 27.495000000000005 23.46 21.755 27.29 80-84 27.41 23.46 22.009999999999998 27.12 85-89 27.99 22.82 21.75 27.439999999999998 90-94 27.345000000000002 24.365000000000002 21.65 26.640000000000004 95-99 27.965 23.235 21.81 26.99 100-104 27.474999999999998 23.26 21.765 27.500000000000004 105-109 27.785 23.835 21.41 26.97 110-114 27.91 24.12 21.46 26.51 115-119 28.27 23.805 21.215 26.71 120-124 27.47 24.38 21.66 26.490000000000002 125-129 28.27 23.990000000000002 21.595 26.145000000000003 130-134 27.615000000000002 24.615000000000002 21.32 26.450000000000003 135-139 27.310000000000002 24.29 21.995 26.405 140-144 28.12 23.66 22.025 26.195 145-149 27.29 24.195 22.015 26.5 150-151 28.0875 23.875 22.6375 25.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 1.5 12 2.5 13 1.0 14 0.0 15 0.0 16 1.5 17 2.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 1.5 24 3.5 25 3.5 26 2.5 27 2.0 28 1.5 29 3.0 30 3.5 31 3.5 32 8.5 33 13.5 34 13.5 35 16.0 36 24.0 37 33.0 38 39.0 39 53.5 40 74.5 41 92.5 42 119.5 43 121.0 44 121.5 45 133.5 46 129.0 47 124.5 48 128.0 49 140.5 50 133.5 51 119.5 52 107.0 53 107.5 54 122.5 55 112.5 56 85.5 57 86.5 58 106.0 59 108.5 60 109.0 61 106.5 62 113.5 63 128.0 64 117.5 65 98.0 66 92.0 67 99.5 68 100.5 69 88.5 70 84.0 71 73.5 72 54.5 73 50.5 74 46.0 75 31.0 76 23.0 77 17.5 78 10.5 79 12.0 80 8.0 81 2.5 82 2.5 83 3.0 84 2.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.5 91 1.5 92 0.5 93 0.5 94 0.0 95 1.0 96 1.0 97 0.5 98 0.5 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.65519140732582 83.2 2 7.133021206279262 12.950000000000001 3 0.9914624070503993 2.7 4 0.08262186725419994 0.3 5 0.02754062241806665 0.125 6 0.02754062241806665 0.15 7 0.0550812448361333 0.35000000000000003 8 0.0 0.0 9 0.02754062241806665 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACGTACCACCATATTGCAGCCGCGAGCAGAACAACAGCTAGCTCACAT 9 0.22499999999999998 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit CTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATG 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.6499999999999999 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGCTTC 10 0.006830828 145.0 3 CGCTTCG 10 0.006830828 145.0 4 >>END_MODULE Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048425 spots for SRR7804099.sra Written 2048425 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra Read 2048418 spots for SRR7804099.sra Written 2048418 spots for SRR7804099.sra SRR ids: ['SRR7804099.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t24hi3a4 SRR7804099.sra spots: 40968367 blocks: [[1, 2048418], [2048419, 4096836], [4096837, 6145254], [6145255, 8193672], [8193673, 10242090], [10242091, 12290508], [12290509, 14338926], [14338927, 16387344], [16387345, 18435762], [18435763, 20484180], [20484181, 22532598], [22532599, 24581016], [24581017, 26629434], [26629435, 28677852], [28677853, 30726270], [30726271, 32774688], [32774689, 34823106], [34823107, 36871524], [36871525, 38919942], [38919943, 40968367]] SRR7804099 file size 13861134 SRR7804099 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804099 SRR7804099_1.fastq SRR7804099_2.fastq Input file: SRR7804099_1.fastq Paired file: SRR7804099_2.fastq trimmed: SRR7804099-trimmed-pair1.fastq, SRR7804099-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:43:16 2024 >> started Tue Dec 10 01:44:04 2024 >> done (48.223s) 40968367 read pairs processed; of these: 108 ( 0.00%) short read pairs filtered out after trimming by size control 850 ( 0.00%) empty read pairs filtered out after trimming by size control 40967409 (100.00%) read pairs available; of these: 1228355 ( 3.00%) trimmed read pairs available after processing 39739054 (97.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 12 0.00% 21 15 0.00% 22 15 0.00% 23 21 0.00% 24 17 0.00% 25 20 0.00% 26 22 0.00% 27 21 0.00% 28 39 0.00% 29 26 0.00% 30 17 0.00% 31 39 0.00% 32 36 0.00% 33 30 0.00% 34 34 0.00% 35 37 0.00% 36 38 0.00% 37 27 0.00% 38 32 0.00% 39 42 0.00% 40 39 0.00% 41 30 0.00% 42 37 0.00% 43 45 0.00% 44 40 0.00% 45 41 0.00% 46 50 0.00% 47 50 0.00% 48 53 0.00% 49 61 0.00% 50 74 0.00% 51 45 0.00% 52 61 0.00% 53 52 0.00% 54 58 0.00% 55 79 0.00% 56 68 0.00% 57 76 0.00% 58 82 0.00% 59 84 0.00% 60 75 0.00% 61 84 0.00% 62 102 0.00% 63 110 0.00% 64 113 0.00% 65 121 0.00% 66 118 0.00% 67 129 0.00% 68 127 0.00% 69 138 0.00% 70 189 0.00% 71 204 0.00% 72 228 0.00% 73 247 0.00% 74 275 0.00% 75 266 0.00% 76 311 0.00% 77 343 0.00% 78 369 0.00% 79 458 0.00% 80 518 0.00% 81 585 0.00% 82 670 0.00% 83 767 0.00% 84 859 0.00% 85 978 0.00% 86 1016 0.00% 87 1123 0.00% 88 1297 0.00% 89 1498 0.00% 90 1571 0.00% 91 1759 0.00% 92 2015 0.00% 93 2324 0.01% 94 2453 0.01% 95 2753 0.01% 96 3004 0.01% 97 3221 0.01% 98 3575 0.01% 99 3693 0.01% 100 4224 0.01% 101 4477 0.01% 102 4838 0.01% 103 5422 0.01% 104 5958 0.01% 105 6269 0.02% 106 6701 0.02% 107 7102 0.02% 108 7585 0.02% 109 8068 0.02% 110 8435 0.02% 111 9054 0.02% 112 9647 0.02% 113 10386 0.03% 114 11417 0.03% 115 12348 0.03% 116 12693 0.03% 117 13269 0.03% 118 13824 0.03% 119 14299 0.03% 120 15075 0.04% 121 16082 0.04% 122 16896 0.04% 123 18082 0.04% 124 19454 0.05% 125 20502 0.05% 126 21675 0.05% 127 21985 0.05% 128 22609 0.06% 129 24075 0.06% 130 25264 0.06% 131 25941 0.06% 132 27150 0.07% 133 28942 0.07% 134 30511 0.07% 135 31731 0.08% 136 33192 0.08% 137 33713 0.08% 138 35243 0.09% 139 36650 0.09% 140 37672 0.09% 141 38898 0.09% 142 40901 0.10% 143 42493 0.10% 144 44581 0.11% 145 46310 0.11% 146 47750 0.12% 147 49507 0.12% 148 51328 0.13% 149 52726 0.13% 150 54029 0.13% 151 39739054 97.00% 40967409 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=4.49 fanout-score-rank=11 prefix-density=1.03 prefix-fanout=3.6 sequence=AGGTTCTCGAGGG criterion=fanout-score sequence-density=0.27 sequence-density-rank=29 fanout-score=21.83 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=6.5 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=28 prefix-density=0.94 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=69.24 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=2.3 sequence=GCAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804099 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:44:52 Started mapping on | Dec 10 01:44:52 Finished on | Dec 10 01:51:48 Mapping speed, Million of reads per hour | 354.53 Number of input reads | 40967409 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 37966099 Uniquely mapped reads % | 92.67% Average mapped length | 299.80 Number of splices: Total | 40605392 Number of splices: Annotated (sjdb) | 38575060 Number of splices: GT/AG | 40026868 Number of splices: GC/AG | 485880 Number of splices: AT/AC | 12213 Number of splices: Non-canonical | 80431 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 511358 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 44140 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 0.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2489952 2489952 2489952 N_multimapping 511358 511358 511358 N_noFeature 962256 36935946 1172501 N_ambiguous 1039249 5655 221486 UnstrandedReadsAssigned:35964594 PositiveStrandReadsAssigned:1024498 NegativeStrandReadsAssigned:36572112 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804099 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804099-trimmed-pair1.fastq SRR7804099-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,967,409 reads, 36,675,027 reads pseudoaligned [quant] estimated average fragment length: 296.496 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR7804099.ke.tsv 35125 SRR7804099.se.tsv 88098 total ==> SRR7804099.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 640.951 3.9792e-08 2.04727e-09 PNS24247 1044 748.504 85.9585 3.78703 PNS24249 1928 1632.5 204.329 4.12743 PNS24246 1044 748.504 85.9585 3.78703 PNS24248 1044 748.504 85.9585 3.78703 PNS24244 1471 1175.5 109.796 3.0801 PNS24243 293 73.6746 0 0 KQK14069 1603 1307.5 2026.29 51.105 KQK14071 474 203.893 27.1331 4.38835 ==> SRR7804099.se.tsv <== BRADI_1g14170v3 2132 BRADI_1g53295v3 801 BRADI_1g59795v3 509 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 366 BRADI_1g74790v3 307 BRADI_1g09890v3 0 BRADI_1g77505v3 637 BRADI_1g48960v3 0 SRR7804099 completed mapping pipeline successfully