Starting /dee2/code/volunteer_pipeline.sh SRR7804100 current disk space = 1541741490176 free memory = 1417512000 SRR7804100 SRAfilesize 4d0d729fba3ad40ae1d264c1a092b3c1 SRR7804100.sra SRR7804100.sra file validated SRR7804100 is paired end SRR7804100 is conventional basespace SRR7804100 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804100_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3085 37.0 37.0 37.0 37.0 37.0 2 36.35325 37.0 37.0 37.0 37.0 37.0 3 36.415 37.0 37.0 37.0 37.0 37.0 4 36.473 37.0 37.0 37.0 37.0 37.0 5 36.604 37.0 37.0 37.0 37.0 37.0 6 36.403 37.0 37.0 37.0 37.0 37.0 7 36.4275 37.0 37.0 37.0 37.0 37.0 8 36.5075 37.0 37.0 37.0 37.0 37.0 9 36.5745 37.0 37.0 37.0 37.0 37.0 10-14 36.517700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.48870000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4902 37.0 37.0 37.0 37.0 37.0 25-29 36.4266 37.0 37.0 37.0 37.0 37.0 30-34 36.4684 37.0 37.0 37.0 37.0 37.0 35-39 36.443 37.0 37.0 37.0 37.0 37.0 40-44 36.448299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4267 37.0 37.0 37.0 37.0 37.0 50-54 36.3597 37.0 37.0 37.0 37.0 37.0 55-59 36.3976 37.0 37.0 37.0 37.0 37.0 60-64 36.3781 37.0 37.0 37.0 37.0 37.0 65-69 36.3465 37.0 37.0 37.0 37.0 37.0 70-74 36.2945 37.0 37.0 37.0 37.0 37.0 75-79 36.314800000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.294 37.0 37.0 37.0 37.0 37.0 85-89 36.2187 37.0 37.0 37.0 37.0 37.0 90-94 36.2131 37.0 37.0 37.0 37.0 37.0 95-99 36.1862 37.0 37.0 37.0 37.0 37.0 100-104 36.1826 37.0 37.0 37.0 37.0 37.0 105-109 36.1519 37.0 37.0 37.0 37.0 37.0 110-114 36.106 37.0 37.0 37.0 37.0 37.0 115-119 36.128099999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0303 37.0 37.0 37.0 37.0 37.0 125-129 35.9578 37.0 37.0 37.0 37.0 37.0 130-134 35.8851 37.0 37.0 37.0 37.0 37.0 135-139 35.9271 37.0 37.0 37.0 37.0 37.0 140-144 35.822 37.0 37.0 37.0 37.0 37.0 145-149 35.8327 37.0 37.0 37.0 37.0 37.0 150-151 35.313 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 3.0 25 3.0 26 5.0 27 3.0 28 12.0 29 22.0 30 26.0 31 36.0 32 51.0 33 73.0 34 116.0 35 313.0 36 2929.0 37 406.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.775 11.600000000000001 8.55 35.075 2 26.30657664416104 13.078269567391848 32.55813953488372 28.057014253563388 3 22.625 17.875 24.2 35.3 4 28.125 24.15 21.725 26.0 5 27.85 27.950000000000003 22.8 21.4 6 24.725 30.85 21.675 22.75 7 18.65 23.9 37.675 19.775000000000002 8 20.3 24.325 29.049999999999997 26.325 9 20.724999999999998 22.725 31.574999999999996 24.975 10-14 23.599999999999998 26.35 24.705 25.345000000000002 15-19 23.330000000000002 25.53 25.2 25.94 20-24 23.455000000000002 25.4 25.405 25.740000000000002 25-29 23.79 24.935 25.740000000000002 25.535000000000004 30-34 23.5 24.985 25.535000000000004 25.979999999999997 35-39 23.405 24.87 25.155 26.57 40-44 23.595 25.14 25.415 25.85 45-49 23.65 25.474999999999998 24.635 26.240000000000002 50-54 23.345 25.56 25.035 26.06 55-59 23.64 25.569999999999997 24.615000000000002 26.174999999999997 60-64 23.935000000000002 24.935 24.62 26.51 65-69 23.635 24.834999999999997 25.119999999999997 26.41 70-74 24.34 24.6 24.955 26.105 75-79 23.79 24.415 25.045 26.75 80-84 24.445 24.59 24.855 26.11 85-89 23.915 24.68 25.05 26.355 90-94 24.085 24.72 24.92 26.275 95-99 23.59 24.82 25.095 26.495 100-104 23.669999999999998 25.180000000000003 24.759999999999998 26.39 105-109 24.255 24.610000000000003 24.925 26.21 110-114 23.705000000000002 24.605 24.97 26.72 115-119 23.9 25.430000000000003 24.38 26.290000000000003 120-124 24.779999999999998 24.075 24.685000000000002 26.46 125-129 23.905 24.62 25.014999999999997 26.46 130-134 24.015 24.529999999999998 25.165 26.290000000000003 135-139 24.185000000000002 24.44 25.06 26.314999999999998 140-144 24.39 24.955 24.545 26.11 145-149 24.745 24.39 24.75 26.115 150-151 24.3625 25.5625 24.099999999999998 25.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 1.5 28 3.5 29 4.5 30 6.5 31 11.5 32 15.0 33 18.0 34 29.5 35 37.0 36 49.0 37 66.0 38 85.0 39 101.0 40 113.0 41 134.5 42 155.5 43 187.5 44 216.5 45 210.5 46 202.0 47 179.0 48 159.0 49 170.5 50 160.0 51 136.0 52 124.0 53 111.0 54 96.5 55 92.0 56 89.5 57 93.0 58 80.5 59 63.0 60 64.0 61 63.0 62 53.0 63 56.5 64 55.5 65 51.0 66 55.5 67 49.5 68 51.0 69 50.5 70 45.5 71 34.5 72 36.0 73 32.5 74 21.5 75 22.0 76 18.5 77 13.0 78 7.5 79 5.5 80 3.5 81 2.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.05 #Duplication Level Percentage of deduplicated Percentage of total 1 93.22944653412144 86.75 2 6.125738850080602 11.4 3 0.5910800644814616 1.6500000000000001 4 0.05373455131649651 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.30000000000000004 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.8625 0.0 0.0 0.0 0.0 134-135 0.9375 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138-139 1.2000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCTC 10 0.006830828 145.0 2 CAGCAAA 10 0.006830828 145.0 9 ATCAGTG 10 0.006830828 145.0 6 CCTCTCT 10 0.006830828 145.0 3 >>END_MODULE SRR7804100 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804100_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.23125 37.0 37.0 37.0 37.0 37.0 2 35.985 37.0 37.0 37.0 37.0 37.0 3 36.1245 37.0 37.0 37.0 37.0 37.0 4 36.2415 37.0 37.0 37.0 37.0 37.0 5 36.1295 37.0 37.0 37.0 37.0 37.0 6 36.179 37.0 37.0 37.0 37.0 37.0 7 36.0045 37.0 37.0 37.0 37.0 37.0 8 36.1995 37.0 37.0 37.0 37.0 37.0 9 36.088 37.0 37.0 37.0 37.0 37.0 10-14 36.1935 37.0 37.0 37.0 37.0 37.0 15-19 36.1337 37.0 37.0 37.0 37.0 37.0 20-24 36.1162 37.0 37.0 37.0 37.0 37.0 25-29 36.1459 37.0 37.0 37.0 37.0 37.0 30-34 36.043699999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.0015 37.0 37.0 37.0 37.0 37.0 40-44 36.0009 37.0 37.0 37.0 37.0 37.0 45-49 35.91439999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.88289999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.8418 37.0 37.0 37.0 37.0 37.0 60-64 35.837599999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.807 37.0 37.0 37.0 37.0 37.0 70-74 35.842 37.0 37.0 37.0 37.0 37.0 75-79 35.792500000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.7647 37.0 37.0 37.0 37.0 37.0 85-89 35.7595 37.0 37.0 37.0 37.0 37.0 90-94 35.7817 37.0 37.0 37.0 37.0 37.0 95-99 35.67909999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.6648 37.0 37.0 37.0 37.0 37.0 105-109 35.594 37.0 37.0 37.0 37.0 37.0 110-114 35.4751 37.0 37.0 37.0 37.0 37.0 115-119 35.4641 37.0 37.0 37.0 37.0 37.0 120-124 35.4473 37.0 37.0 37.0 37.0 37.0 125-129 35.372400000000006 37.0 37.0 37.0 34.6 37.0 130-134 35.448499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.3131 37.0 37.0 37.0 32.2 37.0 140-144 35.2475 37.0 37.0 37.0 32.2 37.0 145-149 35.117 37.0 37.0 37.0 25.0 37.0 150-151 34.65925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 4.0 16 2.0 17 0.0 18 2.0 19 1.0 20 2.0 21 4.0 22 5.0 23 3.0 24 5.0 25 13.0 26 12.0 27 9.0 28 23.0 29 22.0 30 31.0 31 47.0 32 75.0 33 107.0 34 222.0 35 655.0 36 2564.0 37 188.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.084021005251316 20.080020005001252 12.278069517379345 31.557889472368096 2 31.525 22.675 25.1 20.7 3 22.875 25.2 27.1 24.825 4 25.525 30.725 20.974999999999998 22.775000000000002 5 28.775000000000002 31.125000000000004 19.775000000000002 20.325 6 24.125 34.425 19.45 22.0 7 21.099999999999998 19.5 35.875 23.525 8 25.3 22.575 23.150000000000002 28.975 9 23.575 23.599999999999998 26.825 26.0 10-14 26.13 25.374999999999996 23.21 25.285000000000004 15-19 25.374999999999996 25.4 24.165 25.06 20-24 25.865 25.21 23.77 25.155 25-29 26.105 24.365000000000002 24.08 25.45 30-34 25.205 25.195 24.51 25.09 35-39 25.6 25.4 23.880000000000003 25.119999999999997 40-44 26.145000000000003 24.45 23.865 25.540000000000003 45-49 26.0 25.069999999999997 23.925 25.005 50-54 25.7 25.055 23.97 25.275 55-59 26.515 25.335 23.595 24.555 60-64 26.334999999999997 25.39 23.74 24.535 65-69 25.86 24.605 24.610000000000003 24.925 70-74 26.340000000000003 25.074999999999996 24.095 24.490000000000002 75-79 25.94 24.51 24.865000000000002 24.685000000000002 80-84 26.06 24.725 23.805 25.41 85-89 26.529999999999998 25.064999999999998 24.055 24.349999999999998 90-94 26.255 24.23 24.654999999999998 24.86 95-99 26.525 25.34 23.294999999999998 24.84 100-104 26.77 24.85 23.97 24.41 105-109 26.39 24.25 24.42 24.94 110-114 26.31 25.180000000000003 24.065 24.445 115-119 26.625 24.85 23.995 24.529999999999998 120-124 26.605 24.665 24.145 24.585 125-129 26.345000000000002 25.319999999999997 23.68 24.654999999999998 130-134 26.150000000000002 24.79 24.25 24.81 135-139 26.465 25.415 23.825 24.295 140-144 27.13 25.430000000000003 23.935000000000002 23.505000000000003 145-149 26.625 25.14 23.724999999999998 24.51 150-151 26.3125 25.124999999999996 23.7125 24.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.5 25 1.0 26 1.5 27 4.5 28 6.0 29 4.5 30 6.0 31 13.5 32 21.5 33 22.0 34 24.5 35 34.5 36 46.5 37 62.5 38 75.5 39 90.5 40 103.5 41 123.0 42 143.0 43 155.0 44 160.0 45 177.0 46 191.0 47 183.0 48 183.5 49 177.0 50 153.0 51 126.0 52 111.0 53 93.0 54 80.5 55 87.0 56 88.0 57 89.0 58 86.5 59 82.5 60 76.5 61 73.0 62 82.0 63 79.5 64 75.5 65 73.5 66 73.0 67 74.0 68 62.5 69 60.0 70 61.0 71 41.5 72 31.5 73 30.5 74 21.5 75 15.5 76 16.0 77 14.5 78 8.0 79 5.0 80 3.0 81 1.0 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.42105263157895 86.97500000000001 2 5.827067669172932 10.85 3 0.6713211600429645 1.875 4 0.08055853920515575 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.30000000000000004 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.8625 0.0 0.0 0.0 0.0 134-135 0.9375 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138-139 1.2000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGGGT 10 0.006830828 145.0 145 GTTTTTC 10 0.006830828 145.0 1 >>END_MODULE Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917507 spots for SRR7804100.sra Written 1917507 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra Read 1917492 spots for SRR7804100.sra Written 1917492 spots for SRR7804100.sra SRR ids: ['SRR7804100.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sac31agc SRR7804100.sra spots: 38349855 blocks: [[1, 1917492], [1917493, 3834984], [3834985, 5752476], [5752477, 7669968], [7669969, 9587460], [9587461, 11504952], [11504953, 13422444], [13422445, 15339936], [15339937, 17257428], [17257429, 19174920], [19174921, 21092412], [21092413, 23009904], [23009905, 24927396], [24927397, 26844888], [26844889, 28762380], [28762381, 30679872], [30679873, 32597364], [32597365, 34514856], [34514857, 36432348], [36432349, 38349855]] SRR7804100 file size 12973807 SRR7804100 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804100 SRR7804100_1.fastq SRR7804100_2.fastq Input file: SRR7804100_1.fastq Paired file: SRR7804100_2.fastq trimmed: SRR7804100-trimmed-pair1.fastq, SRR7804100-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:52:00 2024 >> started Sat Dec 7 16:53:32 2024 >> done (91.940s) 38349855 read pairs processed; of these: 132 ( 0.00%) short read pairs filtered out after trimming by size control 326 ( 0.00%) empty read pairs filtered out after trimming by size control 38349397 (100.00%) read pairs available; of these: 799991 ( 2.09%) trimmed read pairs available after processing 37549406 (97.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 16 0.00% 21 14 0.00% 22 21 0.00% 23 18 0.00% 24 29 0.00% 25 25 0.00% 26 31 0.00% 27 30 0.00% 28 36 0.00% 29 41 0.00% 30 40 0.00% 31 46 0.00% 32 51 0.00% 33 44 0.00% 34 44 0.00% 35 57 0.00% 36 52 0.00% 37 53 0.00% 38 65 0.00% 39 42 0.00% 40 70 0.00% 41 48 0.00% 42 57 0.00% 43 61 0.00% 44 41 0.00% 45 62 0.00% 46 72 0.00% 47 56 0.00% 48 66 0.00% 49 82 0.00% 50 79 0.00% 51 61 0.00% 52 89 0.00% 53 76 0.00% 54 72 0.00% 55 89 0.00% 56 96 0.00% 57 82 0.00% 58 82 0.00% 59 99 0.00% 60 120 0.00% 61 90 0.00% 62 95 0.00% 63 104 0.00% 64 114 0.00% 65 103 0.00% 66 80 0.00% 67 117 0.00% 68 145 0.00% 69 134 0.00% 70 140 0.00% 71 152 0.00% 72 154 0.00% 73 179 0.00% 74 201 0.00% 75 219 0.00% 76 240 0.00% 77 242 0.00% 78 279 0.00% 79 315 0.00% 80 338 0.00% 81 341 0.00% 82 414 0.00% 83 505 0.00% 84 532 0.00% 85 554 0.00% 86 637 0.00% 87 676 0.00% 88 760 0.00% 89 845 0.00% 90 937 0.00% 91 1041 0.00% 92 1202 0.00% 93 1273 0.00% 94 1463 0.00% 95 1620 0.00% 96 1710 0.00% 97 1984 0.01% 98 1961 0.01% 99 2153 0.01% 100 2428 0.01% 101 2638 0.01% 102 2772 0.01% 103 3080 0.01% 104 3488 0.01% 105 3669 0.01% 106 3929 0.01% 107 4117 0.01% 108 4452 0.01% 109 4765 0.01% 110 5113 0.01% 111 5502 0.01% 112 5848 0.02% 113 6239 0.02% 114 6894 0.02% 115 7173 0.02% 116 7659 0.02% 117 7951 0.02% 118 8621 0.02% 119 8918 0.02% 120 9547 0.02% 121 10081 0.03% 122 10526 0.03% 123 11288 0.03% 124 12100 0.03% 125 12887 0.03% 126 13404 0.03% 127 13933 0.04% 128 14641 0.04% 129 15482 0.04% 130 15868 0.04% 131 16518 0.04% 132 17579 0.05% 133 18719 0.05% 134 19573 0.05% 135 20712 0.05% 136 21604 0.06% 137 22357 0.06% 138 23329 0.06% 139 24040 0.06% 140 25031 0.07% 141 26110 0.07% 142 27358 0.07% 143 28553 0.07% 144 30047 0.08% 145 31402 0.08% 146 32682 0.09% 147 34238 0.09% 148 35444 0.09% 149 36005 0.09% 150 37294 0.10% 151 37549406 97.91% 38349397 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=35 prefix-density=0.42 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=167.92 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=12.5 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=28 prefix-density=0.45 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=149.44 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.7 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804100 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:54:33 Started mapping on | Dec 07 16:54:33 Finished on | Dec 07 16:59:19 Mapping speed, Million of reads per hour | 482.72 Number of input reads | 38349397 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 36021958 Uniquely mapped reads % | 93.93% Average mapped length | 300.02 Number of splices: Total | 38692909 Number of splices: Annotated (sjdb) | 36432719 Number of splices: GT/AG | 38117805 Number of splices: GC/AG | 468307 Number of splices: AT/AC | 16323 Number of splices: Non-canonical | 90474 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433295 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 29601 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.30% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1894144 1894144 1894144 N_multimapping 433295 433295 433295 N_noFeature 1468021 34988229 1730121 N_ambiguous 922819 6812 150896 UnstrandedReadsAssigned:33631118 PositiveStrandReadsAssigned:1026917 NegativeStrandReadsAssigned:34140941 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804100 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804100-trimmed-pair1.fastq SRR7804100-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,349,397 reads, 34,321,208 reads pseudoaligned [quant] estimated average fragment length: 310.079 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,272 rounds 52973 SRR7804100.ke.tsv 35125 SRR7804100.se.tsv 88098 total ==> SRR7804100.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 627.546 0 0 PNS24247 1044 734.92 118.124 6.60544 PNS24249 1928 1618.92 203.894 5.17584 PNS24246 1044 734.92 118.124 6.60544 PNS24248 1044 734.92 118.124 6.60544 PNS24244 1471 1161.92 182.734 6.46317 PNS24243 293 69.5801 0 0 KQK14069 1603 1293.92 5949.48 188.962 KQK14071 474 194.937 121.527 25.6202 ==> SRR7804100.se.tsv <== BRADI_1g14170v3 6940 BRADI_1g53295v3 1075 BRADI_1g59795v3 621 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 690 BRADI_1g74790v3 1019 BRADI_1g09890v3 3 BRADI_1g77505v3 593 BRADI_1g48960v3 3 SRR7804100 completed mapping pipeline successfully