Starting /dee2/code/volunteer_pipeline.sh SRR7804101 current disk space = 1541601345536 free memory = 1601120900 SRR7804101 SRAfilesize 3b574b30af11cd1174842132e1309a10 SRR7804101.sra SRR7804101.sra file validated SRR7804101 is paired end SRR7804101 is conventional basespace SRR7804101 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804101_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1835 37.0 37.0 37.0 37.0 37.0 2 36.225 37.0 37.0 37.0 37.0 37.0 3 36.4065 37.0 37.0 37.0 37.0 37.0 4 36.5435 37.0 37.0 37.0 37.0 37.0 5 36.4515 37.0 37.0 37.0 37.0 37.0 6 36.4605 37.0 37.0 37.0 37.0 37.0 7 36.3675 37.0 37.0 37.0 37.0 37.0 8 36.4875 37.0 37.0 37.0 37.0 37.0 9 36.4595 37.0 37.0 37.0 37.0 37.0 10-14 36.4755 37.0 37.0 37.0 37.0 37.0 15-19 36.4765 37.0 37.0 37.0 37.0 37.0 20-24 36.4523 37.0 37.0 37.0 37.0 37.0 25-29 36.4611 37.0 37.0 37.0 37.0 37.0 30-34 36.3851 37.0 37.0 37.0 37.0 37.0 35-39 36.38420000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.354200000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3461 37.0 37.0 37.0 37.0 37.0 50-54 36.3338 37.0 37.0 37.0 37.0 37.0 55-59 36.3262 37.0 37.0 37.0 37.0 37.0 60-64 36.3064 37.0 37.0 37.0 37.0 37.0 65-69 36.3346 37.0 37.0 37.0 37.0 37.0 70-74 36.266200000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.279 37.0 37.0 37.0 37.0 37.0 80-84 36.1794 37.0 37.0 37.0 37.0 37.0 85-89 36.1457 37.0 37.0 37.0 37.0 37.0 90-94 36.162 37.0 37.0 37.0 37.0 37.0 95-99 36.1104 37.0 37.0 37.0 37.0 37.0 100-104 36.1639 37.0 37.0 37.0 37.0 37.0 105-109 36.0529 37.0 37.0 37.0 37.0 37.0 110-114 36.01819999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0156 37.0 37.0 37.0 37.0 37.0 120-124 35.95219999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.9059 37.0 37.0 37.0 37.0 37.0 130-134 35.8877 37.0 37.0 37.0 37.0 37.0 135-139 35.849000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7537 37.0 37.0 37.0 37.0 37.0 145-149 35.764799999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.288250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 4.0 25 3.0 26 3.0 27 8.0 28 13.0 29 16.0 30 36.0 31 41.0 32 47.0 33 84.0 34 153.0 35 349.0 36 2847.0 37 393.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.975 13.025 9.0 33.0 2 26.263131565782892 13.506753376688344 30.81540770385193 29.41470735367684 3 22.675 18.625 25.6 33.1 4 25.2 25.825 21.65 27.325 5 26.875 27.575 21.925 23.625 6 25.25 30.275000000000002 23.125 21.349999999999998 7 19.575 22.125 37.974999999999994 20.325 8 22.95 22.8 26.174999999999997 28.075 9 20.349999999999998 20.8 31.15 27.700000000000003 10-14 24.099999999999998 24.3 24.42 27.18 15-19 24.46 24.27 24.959999999999997 26.31 20-24 24.375 23.96 24.875 26.790000000000003 25-29 24.13 24.21 24.995 26.665 30-34 24.305 24.095 25.080000000000002 26.52 35-39 24.77 23.200000000000003 25.415 26.615 40-44 24.490000000000002 23.715 24.675 27.12 45-49 24.21 23.095 24.545 28.15 50-54 24.775 22.935 24.9 27.389999999999997 55-59 24.72 23.919999999999998 24.474999999999998 26.884999999999998 60-64 24.79 23.695 23.86 27.655 65-69 24.595 23.735 24.099999999999998 27.57 70-74 24.505 23.044999999999998 24.610000000000003 27.839999999999996 75-79 24.995 23.200000000000003 24.115000000000002 27.689999999999998 80-84 24.765 23.3 24.240000000000002 27.694999999999997 85-89 24.805 23.335 23.785 28.075 90-94 25.5 22.919999999999998 24.535 27.045 95-99 25.345000000000002 22.695 24.224999999999998 27.735 100-104 25.124999999999996 22.5 24.33 28.044999999999998 105-109 25.89 22.99 23.395 27.725 110-114 25.264999999999997 22.79 23.955000000000002 27.99 115-119 24.9 22.85 24.26 27.99 120-124 25.6 22.805 23.48 28.115000000000002 125-129 25.319999999999997 23.05 23.91 27.72 130-134 25.795 22.755 24.005000000000003 27.445000000000004 135-139 25.825 23.064999999999998 23.755000000000003 27.355 140-144 26.474999999999998 22.835 23.705000000000002 26.985 145-149 26.174999999999997 23.195 23.200000000000003 27.43 150-151 26.0 22.8625 23.3125 27.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 2.0 29 5.0 30 8.0 31 10.0 32 11.5 33 14.5 34 27.0 35 36.5 36 41.0 37 52.5 38 68.0 39 78.5 40 80.5 41 108.5 42 139.5 43 142.5 44 134.0 45 133.0 46 141.5 47 150.0 48 148.0 49 145.0 50 133.0 51 128.0 52 140.5 53 132.5 54 136.0 55 145.5 56 137.5 57 121.0 58 115.5 59 122.0 60 111.0 61 93.5 62 85.5 63 75.5 64 77.0 65 72.5 66 62.0 67 62.5 68 54.0 69 52.5 70 52.5 71 40.0 72 36.0 73 30.0 74 21.5 75 20.0 76 18.0 77 15.5 78 9.5 79 5.0 80 4.5 81 3.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 92.59962049335864 85.39999999999999 2 6.5329357549471405 12.049999999999999 3 0.7590132827324478 2.1 4 0.0813228517213337 0.3 5 0.0 0.0 6 0.02710761724044456 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.8999999999999999 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.15 0.0 0.0 0.0 0.0 136-137 1.3875000000000002 0.0 0.0 0.0 0.0 138-139 1.5125000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAACC 10 0.006830828 145.0 3 TTCTTCT 10 0.006830828 145.0 6 >>END_MODULE SRR7804101 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804101_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4765 37.0 37.0 37.0 37.0 37.0 2 36.1425 37.0 37.0 37.0 37.0 37.0 3 36.064 37.0 37.0 37.0 37.0 37.0 4 36.188 37.0 37.0 37.0 37.0 37.0 5 36.1865 37.0 37.0 37.0 37.0 37.0 6 36.286 37.0 37.0 37.0 37.0 37.0 7 36.1105 37.0 37.0 37.0 37.0 37.0 8 36.313 37.0 37.0 37.0 37.0 37.0 9 36.0125 37.0 37.0 37.0 37.0 37.0 10-14 36.15409999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.0967 37.0 37.0 37.0 37.0 37.0 20-24 36.092400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.042100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.0146 37.0 37.0 37.0 37.0 37.0 35-39 36.0098 37.0 37.0 37.0 37.0 37.0 40-44 35.9732 37.0 37.0 37.0 37.0 37.0 45-49 35.9006 37.0 37.0 37.0 37.0 37.0 50-54 35.886700000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.862500000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.86129999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.8187 37.0 37.0 37.0 37.0 37.0 70-74 35.8209 37.0 37.0 37.0 37.0 37.0 75-79 35.8038 37.0 37.0 37.0 37.0 37.0 80-84 35.807 37.0 37.0 37.0 37.0 37.0 85-89 35.7463 37.0 37.0 37.0 37.0 37.0 90-94 35.7898 37.0 37.0 37.0 37.0 37.0 95-99 35.66799999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.7132 37.0 37.0 37.0 37.0 37.0 105-109 35.614999999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.543400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.549099999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.55310000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.482299999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4489 37.0 37.0 37.0 37.0 37.0 135-139 35.362700000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.381800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.226800000000004 37.0 37.0 37.0 32.2 37.0 150-151 34.70575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 4.0 15 11.0 16 6.0 17 6.0 18 1.0 19 4.0 20 10.0 21 7.0 22 11.0 23 16.0 24 13.0 25 6.0 26 2.0 27 8.0 28 12.0 29 12.0 30 25.0 31 39.0 32 49.0 33 93.0 34 139.0 35 483.0 36 2754.0 37 285.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.75 17.849999999999998 9.375 28.025 2 31.125000000000004 22.725 23.400000000000002 22.75 3 26.174999999999997 24.025 26.75 23.05 4 28.575 29.875 19.075 22.475 5 27.425 31.75 18.675 22.15 6 26.55 32.875 18.975 21.6 7 25.424999999999997 19.650000000000002 30.25 24.675 8 26.200000000000003 21.9 19.950000000000003 31.95 9 25.775 22.225 24.825 27.175 10-14 28.155 24.67 21.17 26.005 15-19 28.26 24.195 21.855 25.69 20-24 28.055000000000003 24.265 22.155 25.525 25-29 27.455000000000002 24.465 21.85 26.229999999999997 30-34 27.450000000000003 25.064999999999998 22.08 25.405 35-39 27.63 24.935 21.915000000000003 25.52 40-44 27.98 23.855 22.075 26.090000000000003 45-49 28.035 24.3 21.73 25.935000000000002 50-54 28.360000000000003 24.635 21.945 25.06 55-59 28.08 24.27 21.8 25.85 60-64 28.22 23.84 22.439999999999998 25.5 65-69 27.49 24.02 22.015 26.474999999999998 70-74 27.615000000000002 24.490000000000002 21.58 26.314999999999998 75-79 27.834999999999997 24.435000000000002 22.02 25.71 80-84 27.634999999999998 24.4 21.64 26.325 85-89 27.694999999999997 24.235 22.235 25.835 90-94 27.325 24.365000000000002 22.075 26.235000000000003 95-99 28.175 24.665 21.72 25.44 100-104 27.395000000000003 25.180000000000003 21.755 25.669999999999998 105-109 27.639999999999997 24.355 22.085 25.919999999999998 110-114 27.51 24.715 22.085 25.69 115-119 27.38 24.66 21.990000000000002 25.97 120-124 27.74 25.035 21.529999999999998 25.695 125-129 27.37 24.505 22.11 26.015 130-134 27.860000000000003 24.64 22.14 25.36 135-139 27.565 24.815 22.185 25.435000000000002 140-144 27.634999999999998 24.759999999999998 22.52 25.085 145-149 27.639999999999997 24.365000000000002 22.48 25.515 150-151 27.5875 24.712500000000002 22.2125 25.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.5 12 1.0 13 0.0 14 0.0 15 1.0 16 2.5 17 1.5 18 0.5 19 2.0 20 2.5 21 2.5 22 3.5 23 3.0 24 1.0 25 1.0 26 2.0 27 2.0 28 3.5 29 4.5 30 4.5 31 6.0 32 7.5 33 10.5 34 17.0 35 20.0 36 21.0 37 34.0 38 43.5 39 62.5 40 79.5 41 89.5 42 108.0 43 113.0 44 121.5 45 130.5 46 131.5 47 137.0 48 146.5 49 144.5 50 134.0 51 126.5 52 127.0 53 125.5 54 124.5 55 129.0 56 141.0 57 130.0 58 115.0 59 132.0 60 120.0 61 100.0 62 104.5 63 96.5 64 86.5 65 84.5 66 79.0 67 74.5 68 70.0 69 68.0 70 73.0 71 63.5 72 45.0 73 42.5 74 34.5 75 26.0 76 21.0 77 15.0 78 12.0 79 8.0 80 6.0 81 4.0 82 1.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 1.0 98 2.0 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.2846237731734 84.625 2 6.815703380588876 12.5 3 0.7633587786259541 2.1 4 0.10905125408942204 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02726281352235551 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.8999999999999999 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.15 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTTT 10 0.006830828 145.0 2 >>END_MODULE Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444686 spots for SRR7804101.sra Written 1444686 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra Read 1444681 spots for SRR7804101.sra Written 1444681 spots for SRR7804101.sra SRR ids: ['SRR7804101.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_09jf3buh SRR7804101.sra spots: 28893625 blocks: [[1, 1444681], [1444682, 2889362], [2889363, 4334043], [4334044, 5778724], [5778725, 7223405], [7223406, 8668086], [8668087, 10112767], [10112768, 11557448], [11557449, 13002129], [13002130, 14446810], [14446811, 15891491], [15891492, 17336172], [17336173, 18780853], [18780854, 20225534], [20225535, 21670215], [21670216, 23114896], [23114897, 24559577], [24559578, 26004258], [26004259, 27448939], [27448940, 28893625]] SRR7804101 file size 9769401 SRR7804101 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804101 SRR7804101_1.fastq SRR7804101_2.fastq Input file: SRR7804101_1.fastq Paired file: SRR7804101_2.fastq trimmed: SRR7804101-trimmed-pair1.fastq, SRR7804101-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:58:30 2024 >> started Sat Dec 7 16:59:00 2024 >> done (29.997s) 28893625 read pairs processed; of these: 109 ( 0.00%) short read pairs filtered out after trimming by size control 722 ( 0.00%) empty read pairs filtered out after trimming by size control 28892794 (100.00%) read pairs available; of these: 890890 ( 3.08%) trimmed read pairs available after processing 28001904 (96.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 10 0.00% 21 20 0.00% 22 12 0.00% 23 20 0.00% 24 13 0.00% 25 16 0.00% 26 18 0.00% 27 16 0.00% 28 24 0.00% 29 8 0.00% 30 13 0.00% 31 12 0.00% 32 20 0.00% 33 24 0.00% 34 16 0.00% 35 25 0.00% 36 30 0.00% 37 20 0.00% 38 28 0.00% 39 26 0.00% 40 34 0.00% 41 27 0.00% 42 28 0.00% 43 32 0.00% 44 34 0.00% 45 36 0.00% 46 36 0.00% 47 33 0.00% 48 24 0.00% 49 31 0.00% 50 33 0.00% 51 27 0.00% 52 28 0.00% 53 35 0.00% 54 43 0.00% 55 45 0.00% 56 32 0.00% 57 40 0.00% 58 45 0.00% 59 43 0.00% 60 53 0.00% 61 43 0.00% 62 63 0.00% 63 61 0.00% 64 53 0.00% 65 76 0.00% 66 57 0.00% 67 64 0.00% 68 88 0.00% 69 95 0.00% 70 78 0.00% 71 105 0.00% 72 123 0.00% 73 154 0.00% 74 133 0.00% 75 177 0.00% 76 162 0.00% 77 191 0.00% 78 259 0.00% 79 252 0.00% 80 266 0.00% 81 365 0.00% 82 400 0.00% 83 451 0.00% 84 489 0.00% 85 565 0.00% 86 556 0.00% 87 630 0.00% 88 679 0.00% 89 803 0.00% 90 891 0.00% 91 1065 0.00% 92 1202 0.00% 93 1396 0.00% 94 1527 0.01% 95 1743 0.01% 96 1882 0.01% 97 1953 0.01% 98 2112 0.01% 99 2310 0.01% 100 2537 0.01% 101 2776 0.01% 102 3140 0.01% 103 3498 0.01% 104 3771 0.01% 105 4133 0.01% 106 4443 0.02% 107 4568 0.02% 108 4839 0.02% 109 5387 0.02% 110 5389 0.02% 111 6090 0.02% 112 6565 0.02% 113 7024 0.02% 114 8086 0.03% 115 8594 0.03% 116 8929 0.03% 117 9081 0.03% 118 9424 0.03% 119 10026 0.03% 120 10656 0.04% 121 11122 0.04% 122 11945 0.04% 123 13131 0.05% 124 13985 0.05% 125 14982 0.05% 126 15795 0.05% 127 16325 0.06% 128 16375 0.06% 129 17195 0.06% 130 17509 0.06% 131 18419 0.06% 132 19748 0.07% 133 21044 0.07% 134 22449 0.08% 135 23664 0.08% 136 24683 0.09% 137 25156 0.09% 138 26213 0.09% 139 26963 0.09% 140 27183 0.09% 141 28354 0.10% 142 30133 0.10% 143 31964 0.11% 144 34005 0.12% 145 36144 0.13% 146 36703 0.13% 147 38123 0.13% 148 38460 0.13% 149 38794 0.13% 150 40722 0.14% 151 28001904 96.92% 28892794 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=35 prefix-density=0.74 prefix-fanout=1.9 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=42.78 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.8 sequence=GGAGGAGAGAGCACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTACCCAGCGTTTACCGTAGGCACGATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAACGCCCACACCGGATATGGACCGAACTGTCTCACGACGTTCTGAACCCAGCTCACGTACCGCATTAATGGGCGAACAGCCCAACCCTTGGAACCACCTACAGCTCCAGGTGGCGAAGAGCCGACATCGAGGTGCCAAACCTTCCCGTCGATGTGGACTCTTGGGGAAGATCAGCCTGTTATCCCTAGAGTAACTTTTATCCGTTGAGCGACGGCCCTTCCACTCGGCACCGTCGGATCACTAAGGCCGACTTTCGTCTCTGCTCGACGGGTGAGTCTTGCAGTCAAGCTCCCTTCTGCCTTTGCACTCGAGGACCAATGTCCGTCTGGCCCGAGGAAACCTTT criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=10 prefix-density=0.93 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=17.16 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804101 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:59:52 Started mapping on | Dec 07 16:59:53 Finished on | Dec 07 17:06:01 Mapping speed, Million of reads per hour | 282.65 Number of input reads | 28892794 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 23596885 Uniquely mapped reads % | 81.67% Average mapped length | 299.69 Number of splices: Total | 23189782 Number of splices: Annotated (sjdb) | 21950102 Number of splices: GT/AG | 22835137 Number of splices: GC/AG | 294430 Number of splices: AT/AC | 8141 Number of splices: Non-canonical | 52074 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1356160 % of reads mapped to multiple loci | 4.69% Number of reads mapped to too many loci | 172236 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.48% % of reads unmapped: other | 4.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3939749 3939749 3939749 N_multimapping 1356160 1356160 1356160 N_noFeature 1913815 22887094 2069699 N_ambiguous 700302 4174 147971 UnstrandedReadsAssigned:20982768 PositiveStrandReadsAssigned:705617 NegativeStrandReadsAssigned:21379215 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804101 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804101-trimmed-pair1.fastq SRR7804101-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,892,794 reads, 22,249,067 reads pseudoaligned [quant] estimated average fragment length: 294.613 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR7804101.ke.tsv 35125 SRR7804101.se.tsv 88098 total ==> SRR7804101.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 642.893 0 0 PNS24247 1044 750.387 67.4971 4.55129 PNS24249 1928 1634.39 95.0611 2.94294 PNS24246 1044 750.387 67.4971 4.55129 PNS24248 1044 750.387 67.4971 4.55129 PNS24244 1471 1177.39 131.447 5.64894 PNS24243 293 75.457 0 0 KQK14069 1603 1309.39 4003.85 154.719 KQK14071 474 205.572 74.414 18.3158 ==> SRR7804101.se.tsv <== BRADI_1g14170v3 4142 BRADI_1g53295v3 853 BRADI_1g59795v3 294 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 256 BRADI_1g74790v3 487 BRADI_1g09890v3 0 BRADI_1g77505v3 511 BRADI_1g48960v3 0 SRR7804101 completed mapping pipeline successfully