Starting /dee2/code/volunteer_pipeline.sh SRR7804102 current disk space = 1541688606720 free memory = 1472074688 SRR7804102 SRAfilesize a9e49367f87efa5b8d4306a6b2d74aea SRR7804102.sra SRR7804102.sra file validated SRR7804102 is paired end SRR7804102 is conventional basespace SRR7804102 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804102_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2335 37.0 37.0 37.0 37.0 37.0 2 36.19075 37.0 37.0 37.0 37.0 37.0 3 36.3635 37.0 37.0 37.0 37.0 37.0 4 36.356 37.0 37.0 37.0 37.0 37.0 5 36.521 37.0 37.0 37.0 37.0 37.0 6 36.409 37.0 37.0 37.0 37.0 37.0 7 36.3995 37.0 37.0 37.0 37.0 37.0 8 36.4815 37.0 37.0 37.0 37.0 37.0 9 36.465 37.0 37.0 37.0 37.0 37.0 10-14 36.4648 37.0 37.0 37.0 37.0 37.0 15-19 36.481300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.442099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3791 37.0 37.0 37.0 37.0 37.0 30-34 36.3733 37.0 37.0 37.0 37.0 37.0 35-39 36.383599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4167 37.0 37.0 37.0 37.0 37.0 45-49 36.3601 37.0 37.0 37.0 37.0 37.0 50-54 36.347 37.0 37.0 37.0 37.0 37.0 55-59 36.2887 37.0 37.0 37.0 37.0 37.0 60-64 36.3504 37.0 37.0 37.0 37.0 37.0 65-69 36.308099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.176500000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.236399999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.184000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.173100000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.154399999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1046 37.0 37.0 37.0 37.0 37.0 100-104 36.09949999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.0911 37.0 37.0 37.0 37.0 37.0 110-114 36.083800000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.042 37.0 37.0 37.0 37.0 37.0 120-124 35.9402 37.0 37.0 37.0 37.0 37.0 125-129 35.9015 37.0 37.0 37.0 37.0 37.0 130-134 35.7975 37.0 37.0 37.0 37.0 37.0 135-139 35.80929999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7633 37.0 37.0 37.0 37.0 37.0 145-149 35.7692 37.0 37.0 37.0 37.0 37.0 150-151 35.233 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 0.0 24 1.0 25 2.0 26 8.0 27 8.0 28 9.0 29 25.0 30 33.0 31 46.0 32 54.0 33 95.0 34 129.0 35 317.0 36 2890.0 37 379.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.725 12.3 9.725 37.25 2 26.556639159789945 14.053513378344586 31.45786446611653 27.93198299574894 3 21.2 20.025000000000002 25.874999999999996 32.9 4 25.825 26.85 21.975 25.35 5 26.924999999999997 28.499999999999996 22.55 22.025 6 23.724999999999998 30.599999999999998 22.3 23.375 7 19.375 24.3 38.074999999999996 18.25 8 23.625 22.175 26.025 28.175 9 20.25 20.45 31.4 27.900000000000002 10-14 23.580000000000002 25.585 24.529999999999998 26.305 15-19 23.565 24.825 24.490000000000002 27.12 20-24 23.855 25.14 25.019999999999996 25.985000000000003 25-29 23.985 25.025 24.615000000000002 26.375 30-34 23.74 25.174999999999997 24.349999999999998 26.735 35-39 23.945 24.79 24.81 26.455000000000002 40-44 23.95 25.405 24.4 26.245 45-49 24.425 24.95 24.115000000000002 26.51 50-54 24.21 24.41 24.825 26.555 55-59 24.474999999999998 24.169999999999998 24.740000000000002 26.615 60-64 24.560000000000002 24.349999999999998 24.45 26.640000000000004 65-69 24.87 24.13 24.435000000000002 26.565 70-74 24.610000000000003 24.39 24.22 26.779999999999998 75-79 24.709999999999997 24.445 23.880000000000003 26.965 80-84 24.709999999999997 24.610000000000003 23.79 26.889999999999997 85-89 24.92 24.12 24.285 26.674999999999997 90-94 24.145 24.325 24.560000000000002 26.97 95-99 24.92 23.905 24.605 26.57 100-104 24.610000000000003 23.71 24.834999999999997 26.845000000000002 105-109 24.605 23.580000000000002 24.005000000000003 27.810000000000002 110-114 24.32 23.25 25.035 27.395000000000003 115-119 24.62 23.705000000000002 24.310000000000002 27.365000000000002 120-124 25.230000000000004 23.549999999999997 24.135 27.084999999999997 125-129 24.709999999999997 23.494999999999997 24.365000000000002 27.43 130-134 24.62 23.505000000000003 24.365000000000002 27.51 135-139 24.94 23.615 24.415 27.029999999999998 140-144 25.185000000000002 23.0 24.64 27.175 145-149 25.369999999999997 23.585 23.685000000000002 27.36 150-151 26.05 23.35 23.6625 26.937499999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 1.0 28 1.5 29 3.5 30 5.5 31 7.0 32 8.5 33 12.0 34 13.5 35 18.0 36 40.5 37 60.0 38 70.0 39 87.5 40 110.0 41 136.0 42 152.5 43 147.0 44 148.5 45 171.0 46 185.5 47 191.5 48 184.5 49 181.0 50 172.5 51 147.5 52 135.5 53 130.0 54 117.0 55 114.5 56 120.0 57 101.0 58 81.0 59 80.0 60 73.5 61 65.0 62 72.0 63 78.0 64 69.0 65 59.5 66 56.5 67 57.0 68 57.0 69 52.5 70 41.5 71 33.0 72 38.0 73 34.5 74 21.0 75 15.5 76 14.0 77 10.5 78 5.5 79 2.0 80 1.5 81 2.0 82 1.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.99140708915145 86.575 2 6.6058002148227715 12.3 3 0.4027926960257788 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.05 0.0 0.0 0.0 0.0 130-131 1.1125 0.0 0.0 0.0 0.0 132-133 1.1749999999999998 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.3625 0.0 0.0 0.0 0.0 138-139 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804102 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804102_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3135 37.0 37.0 37.0 37.0 37.0 2 36.026 37.0 37.0 37.0 37.0 37.0 3 36.0675 37.0 37.0 37.0 37.0 37.0 4 36.1555 37.0 37.0 37.0 37.0 37.0 5 36.244 37.0 37.0 37.0 37.0 37.0 6 36.214 37.0 37.0 37.0 37.0 37.0 7 36.214 37.0 37.0 37.0 37.0 37.0 8 36.217 37.0 37.0 37.0 37.0 37.0 9 36.1185 37.0 37.0 37.0 37.0 37.0 10-14 36.2053 37.0 37.0 37.0 37.0 37.0 15-19 36.147 37.0 37.0 37.0 37.0 37.0 20-24 36.112 37.0 37.0 37.0 37.0 37.0 25-29 36.11749999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.13099999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.031099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0039 37.0 37.0 37.0 37.0 37.0 45-49 35.929 37.0 37.0 37.0 37.0 37.0 50-54 35.975199999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.8975 37.0 37.0 37.0 37.0 37.0 60-64 35.9375 37.0 37.0 37.0 37.0 37.0 65-69 35.8475 37.0 37.0 37.0 37.0 37.0 70-74 35.8202 37.0 37.0 37.0 37.0 37.0 75-79 35.8717 37.0 37.0 37.0 37.0 37.0 80-84 35.7854 37.0 37.0 37.0 37.0 37.0 85-89 35.822900000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.782500000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.6642 37.0 37.0 37.0 37.0 37.0 100-104 35.6879 37.0 37.0 37.0 37.0 37.0 105-109 35.617000000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5327 37.0 37.0 37.0 37.0 37.0 115-119 35.53000000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.5048 37.0 37.0 37.0 37.0 37.0 125-129 35.4084 37.0 37.0 37.0 37.0 37.0 130-134 35.484 37.0 37.0 37.0 37.0 37.0 135-139 35.4091 37.0 37.0 37.0 37.0 37.0 140-144 35.4265 37.0 37.0 37.0 34.6 37.0 145-149 35.2353 37.0 37.0 37.0 29.8 37.0 150-151 34.66225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 5.0 15 3.0 16 2.0 17 4.0 18 0.0 19 2.0 20 6.0 21 8.0 22 13.0 23 5.0 24 7.0 25 7.0 26 6.0 27 16.0 28 16.0 29 19.0 30 28.0 31 46.0 32 61.0 33 97.0 34 178.0 35 526.0 36 2687.0 37 255.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.25 17.05 11.774999999999999 32.925 2 31.25 22.45 24.474999999999998 21.825 3 24.175 24.775 26.275 24.775 4 26.075 31.85 19.125 22.95 5 28.849999999999998 30.8 17.549999999999997 22.8 6 25.5 34.225 17.9 22.375 7 24.075 19.275000000000002 32.175 24.474999999999998 8 25.15 22.375 20.1 32.375 9 25.45 21.775 25.4 27.375 10-14 26.655 25.0 21.115000000000002 27.229999999999997 15-19 26.51 24.14 22.5 26.85 20-24 27.005000000000003 24.39 22.314999999999998 26.290000000000003 25-29 27.08 24.415 21.88 26.625 30-34 26.39 24.805 22.28 26.525 35-39 27.32 24.279999999999998 22.145 26.255 40-44 27.275 24.65 22.12 25.955000000000002 45-49 27.310000000000002 24.474999999999998 22.39 25.825 50-54 26.93 24.785 22.55 25.735000000000003 55-59 27.485 24.45 22.21 25.855 60-64 26.889999999999997 23.825 22.830000000000002 26.455000000000002 65-69 27.61 25.025 21.95 25.415 70-74 27.54 24.54 22.045 25.874999999999996 75-79 27.82 23.59 23.075000000000003 25.515 80-84 27.29 25.230000000000004 22.045 25.435000000000002 85-89 27.74 24.625 22.13 25.505 90-94 27.185 24.37 22.495 25.95 95-99 27.065 24.255 22.61 26.07 100-104 27.435 24.145 22.95 25.47 105-109 27.395000000000003 24.315 23.03 25.259999999999998 110-114 27.685 24.33 22.64 25.345000000000002 115-119 27.794999999999998 24.335 22.09 25.779999999999998 120-124 27.445000000000004 24.349999999999998 22.994999999999997 25.21 125-129 27.49 24.245 22.55 25.715 130-134 27.450000000000003 25.185000000000002 22.425 24.94 135-139 27.744999999999997 24.81 22.62 24.825 140-144 27.66 24.775 22.12 25.445 145-149 27.755000000000003 24.97 22.405 24.87 150-151 27.875 24.1625 23.275000000000002 24.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.5 6 1.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 0.5 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 0.5 27 1.0 28 2.0 29 1.0 30 1.0 31 3.5 32 5.0 33 8.5 34 11.0 35 17.5 36 28.0 37 36.0 38 52.0 39 66.5 40 83.5 41 99.5 42 108.5 43 130.0 44 152.0 45 152.0 46 157.0 47 172.0 48 172.5 49 164.0 50 140.0 51 135.5 52 130.0 53 119.5 54 121.5 55 112.0 56 101.5 57 98.0 58 107.0 59 97.0 60 90.0 61 89.0 62 79.5 63 91.5 64 92.5 65 80.5 66 82.0 67 78.0 68 85.5 69 77.0 70 60.0 71 57.5 72 51.0 73 45.0 74 36.0 75 27.5 76 19.5 77 16.0 78 12.5 79 8.5 80 4.0 81 1.5 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.125 #Duplication Level Percentage of deduplicated Percentage of total 1 93.26174496644295 86.85000000000001 2 6.281879194630872 11.700000000000001 3 0.4026845637583893 1.125 4 0.026845637583892613 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026845637583892613 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.7124999999999999 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.05 0.0 0.0 0.0 0.0 130-131 1.1125 0.0 0.0 0.0 0.0 132-133 1.1749999999999998 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.3625 0.0 0.0 0.0 0.0 138-139 1.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTAAG 10 0.006830828 145.0 6 >>END_MODULE Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323509 spots for SRR7804102.sra Written 1323509 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra Read 1323505 spots for SRR7804102.sra Written 1323505 spots for SRR7804102.sra SRR ids: ['SRR7804102.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_105k53iw SRR7804102.sra spots: 26470104 blocks: [[1, 1323505], [1323506, 2647010], [2647011, 3970515], [3970516, 5294020], [5294021, 6617525], [6617526, 7941030], [7941031, 9264535], [9264536, 10588040], [10588041, 11911545], [11911546, 13235050], [13235051, 14558555], [14558556, 15882060], [15882061, 17205565], [17205566, 18529070], [18529071, 19852575], [19852576, 21176080], [21176081, 22499585], [22499586, 23823090], [23823091, 25146595], [25146596, 26470104]] SRR7804102 file size 8948149 SRR7804102 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804102 SRR7804102_1.fastq SRR7804102_2.fastq Input file: SRR7804102_1.fastq Paired file: SRR7804102_2.fastq trimmed: SRR7804102-trimmed-pair1.fastq, SRR7804102-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:59:48 2024 >> started Sat Dec 7 17:00:24 2024 >> done (36.523s) 26470104 read pairs processed; of these: 79 ( 0.00%) short read pairs filtered out after trimming by size control 398 ( 0.00%) empty read pairs filtered out after trimming by size control 26469627 (100.00%) read pairs available; of these: 753858 ( 2.85%) trimmed read pairs available after processing 25715769 (97.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 17 0.00% 20 10 0.00% 21 11 0.00% 22 13 0.00% 23 12 0.00% 24 21 0.00% 25 16 0.00% 26 9 0.00% 27 17 0.00% 28 9 0.00% 29 26 0.00% 30 23 0.00% 31 25 0.00% 32 26 0.00% 33 29 0.00% 34 25 0.00% 35 33 0.00% 36 16 0.00% 37 30 0.00% 38 41 0.00% 39 33 0.00% 40 31 0.00% 41 29 0.00% 42 36 0.00% 43 34 0.00% 44 33 0.00% 45 37 0.00% 46 44 0.00% 47 42 0.00% 48 43 0.00% 49 46 0.00% 50 43 0.00% 51 55 0.00% 52 45 0.00% 53 59 0.00% 54 38 0.00% 55 51 0.00% 56 49 0.00% 57 52 0.00% 58 46 0.00% 59 59 0.00% 60 64 0.00% 61 67 0.00% 62 70 0.00% 63 66 0.00% 64 79 0.00% 65 72 0.00% 66 83 0.00% 67 84 0.00% 68 81 0.00% 69 101 0.00% 70 145 0.00% 71 126 0.00% 72 158 0.00% 73 180 0.00% 74 175 0.00% 75 191 0.00% 76 218 0.00% 77 244 0.00% 78 237 0.00% 79 302 0.00% 80 283 0.00% 81 358 0.00% 82 417 0.00% 83 516 0.00% 84 553 0.00% 85 599 0.00% 86 642 0.00% 87 729 0.00% 88 747 0.00% 89 817 0.00% 90 914 0.00% 91 1127 0.00% 92 1323 0.00% 93 1395 0.01% 94 1511 0.01% 95 1649 0.01% 96 1805 0.01% 97 1932 0.01% 98 2112 0.01% 99 2227 0.01% 100 2478 0.01% 101 2723 0.01% 102 3031 0.01% 103 3360 0.01% 104 3556 0.01% 105 3901 0.01% 106 4248 0.02% 107 4321 0.02% 108 4562 0.02% 109 4732 0.02% 110 5044 0.02% 111 5648 0.02% 112 6057 0.02% 113 6568 0.02% 114 7221 0.03% 115 7448 0.03% 116 7892 0.03% 117 8191 0.03% 118 8308 0.03% 119 8838 0.03% 120 9307 0.04% 121 9729 0.04% 122 10431 0.04% 123 11357 0.04% 124 12364 0.05% 125 12642 0.05% 126 13350 0.05% 127 13787 0.05% 128 13886 0.05% 129 14522 0.05% 130 15110 0.06% 131 15562 0.06% 132 16436 0.06% 133 17825 0.07% 134 18784 0.07% 135 19588 0.07% 136 20366 0.08% 137 21097 0.08% 138 21675 0.08% 139 22278 0.08% 140 22584 0.09% 141 23754 0.09% 142 24651 0.09% 143 25814 0.10% 144 27330 0.10% 145 29027 0.11% 146 30063 0.11% 147 30834 0.12% 148 31456 0.12% 149 31645 0.12% 150 32757 0.12% 151 25715769 97.15% 26469627 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=12.91 fanout-score-rank=10 prefix-density=0.78 prefix-fanout=3.9 sequence=TCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=225.81 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=25.7 sequence=CCTTCTTCTCCAC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=30 prefix-density=0.46 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=1131.71 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=21.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGA SRR7804102 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:01:50 Started mapping on | Dec 07 17:01:50 Finished on | Dec 07 17:05:45 Mapping speed, Million of reads per hour | 405.49 Number of input reads | 26469627 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 24384448 Uniquely mapped reads % | 92.12% Average mapped length | 299.77 Number of splices: Total | 26182905 Number of splices: Annotated (sjdb) | 24727846 Number of splices: GT/AG | 25800774 Number of splices: GC/AG | 310953 Number of splices: AT/AC | 18666 Number of splices: Non-canonical | 52512 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 3.16 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410384 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 36966 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.06% % of reads unmapped: other | 1.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1674795 1674795 1674795 N_multimapping 410384 410384 410384 N_noFeature 587874 23783139 726806 N_ambiguous 550510 4133 88671 UnstrandedReadsAssigned:23246064 PositiveStrandReadsAssigned:597176 NegativeStrandReadsAssigned:23568971 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804102 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804102-trimmed-pair1.fastq SRR7804102-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,469,627 reads, 23,864,040 reads pseudoaligned [quant] estimated average fragment length: 301.928 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52973 SRR7804102.ke.tsv 35125 SRR7804102.se.tsv 88098 total ==> SRR7804102.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 635.801 58.9542 4.78646 PNS24247 1044 743.072 83.7599 5.81871 PNS24249 1928 1627.07 287.39 9.11773 PNS24246 1044 743.072 83.7599 5.81871 PNS24248 1044 743.072 83.7599 5.81871 PNS24244 1471 1170.07 93.3758 4.11948 PNS24243 293 73.454 0 0 KQK14069 1603 1302.07 8433.53 334.345 KQK14071 474 200.336 158.454 40.8287 ==> SRR7804102.se.tsv <== BRADI_1g14170v3 9112 BRADI_1g53295v3 372 BRADI_1g59795v3 304 BRADI_1g07683v3 0 BRADI_1g00485v3 123 BRADI_1g20270v3 3652 BRADI_1g74790v3 239 BRADI_1g09890v3 6 BRADI_1g77505v3 450 BRADI_1g48960v3 0 SRR7804102 completed mapping pipeline successfully