Starting /dee2/code/volunteer_pipeline.sh SRR7804103 current disk space = 1541688606720 free memory = 1472083056 SRR7804103 SRAfilesize b886a0c38874b6d13055b75015231742 SRR7804103.sra SRR7804103.sra file validated SRR7804103 is paired end SRR7804103 is conventional basespace SRR7804103 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804103_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2175 37.0 37.0 37.0 37.0 37.0 2 36.2895 37.0 37.0 37.0 37.0 37.0 3 36.379 37.0 37.0 37.0 37.0 37.0 4 36.4365 37.0 37.0 37.0 37.0 37.0 5 36.4975 37.0 37.0 37.0 37.0 37.0 6 36.386 37.0 37.0 37.0 37.0 37.0 7 36.4525 37.0 37.0 37.0 37.0 37.0 8 36.535 37.0 37.0 37.0 37.0 37.0 9 36.4305 37.0 37.0 37.0 37.0 37.0 10-14 36.4674 37.0 37.0 37.0 37.0 37.0 15-19 36.478300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.466899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4283 37.0 37.0 37.0 37.0 37.0 30-34 36.373900000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.40050000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4408 37.0 37.0 37.0 37.0 37.0 45-49 36.3935 37.0 37.0 37.0 37.0 37.0 50-54 36.3235 37.0 37.0 37.0 37.0 37.0 55-59 36.3274 37.0 37.0 37.0 37.0 37.0 60-64 36.2907 37.0 37.0 37.0 37.0 37.0 65-69 36.287800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.2805 37.0 37.0 37.0 37.0 37.0 75-79 36.214 37.0 37.0 37.0 37.0 37.0 80-84 36.226099999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2256 37.0 37.0 37.0 37.0 37.0 90-94 36.18920000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.127300000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.132400000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0659 37.0 37.0 37.0 37.0 37.0 110-114 36.086200000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.0475 37.0 37.0 37.0 37.0 37.0 120-124 35.9717 37.0 37.0 37.0 37.0 37.0 125-129 35.9109 37.0 37.0 37.0 37.0 37.0 130-134 35.9077 37.0 37.0 37.0 37.0 37.0 135-139 35.904799999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.7988 37.0 37.0 37.0 37.0 37.0 145-149 35.8061 37.0 37.0 37.0 37.0 37.0 150-151 35.23725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 4.0 26 7.0 27 5.0 28 15.0 29 15.0 30 23.0 31 50.0 32 74.0 33 80.0 34 145.0 35 329.0 36 2818.0 37 433.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.625 11.3 10.2 34.875 2 27.675 12.625 29.825000000000003 29.875 3 25.1 19.225 24.125 31.55 4 28.199999999999996 24.025 22.625 25.15 5 27.625 27.725 21.75 22.900000000000002 6 25.825 29.299999999999997 21.575 23.3 7 20.599999999999998 22.025 35.125 22.25 8 23.875 22.225 24.224999999999998 29.675 9 23.7 19.325 29.5 27.474999999999998 10-14 25.45 23.599999999999998 23.76 27.189999999999998 15-19 25.295 23.875 24.125 26.705000000000002 20-24 25.624999999999996 23.275000000000002 24.09 27.01 25-29 26.045 23.13 23.73 27.095000000000002 30-34 26.165 22.835 23.53 27.47 35-39 26.174999999999997 23.26 23.28 27.284999999999997 40-44 26.46 22.470000000000002 23.585 27.485 45-49 26.365 22.93 23.105 27.6 50-54 25.974999999999998 23.165 23.43 27.43 55-59 25.840000000000003 22.884999999999998 23.91 27.365000000000002 60-64 25.924999999999997 22.34 23.89 27.845 65-69 26.185000000000002 22.470000000000002 23.945 27.400000000000002 70-74 25.929999999999996 22.24 23.69 28.139999999999997 75-79 25.080000000000002 23.49 23.36 28.07 80-84 26.435 22.62 23.24 27.705000000000002 85-89 26.14 22.73 23.31 27.82 90-94 26.650000000000002 22.55 23.055 27.744999999999997 95-99 26.605 23.080000000000002 22.52 27.794999999999998 100-104 26.97 21.905 23.61 27.515 105-109 26.584999999999997 22.84 22.74 27.834999999999997 110-114 27.055 22.605 22.745 27.595 115-119 26.765 22.689999999999998 22.57 27.975 120-124 26.284999999999997 22.775000000000002 23.005 27.935 125-129 27.13 22.17 22.955000000000002 27.744999999999997 130-134 26.99 22.48 22.56 27.97 135-139 27.785 22.61 22.745 26.86 140-144 27.43 22.295 22.67 27.605 145-149 26.674999999999997 22.29 23.345 27.689999999999998 150-151 26.724999999999998 22.975 22.275 28.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.5 29 4.0 30 5.0 31 6.0 32 5.5 33 8.5 34 20.0 35 22.5 36 23.5 37 39.0 38 50.5 39 61.0 40 74.0 41 104.5 42 144.0 43 138.5 44 125.5 45 140.0 46 151.5 47 143.0 48 141.5 49 134.0 50 130.5 51 144.0 52 121.0 53 99.0 54 97.0 55 92.5 56 95.5 57 105.0 58 105.0 59 110.5 60 121.0 61 112.0 62 113.0 63 110.0 64 95.5 65 94.5 66 95.5 67 96.5 68 90.5 69 76.0 70 78.0 71 64.5 72 43.5 73 46.0 74 38.5 75 24.0 76 19.0 77 17.0 78 9.0 79 4.0 80 2.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.6855600539811 85.85000000000001 2 6.774628879892037 12.55 3 0.4588394062078272 1.275 4 0.053981106612685556 0.2 5 0.026990553306342778 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.15 0.0 0.0 0.0 0.0 136-137 1.3 0.0 0.0 0.0 0.0 138-139 1.4500000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTTT 10 0.006830828 145.0 6 GCAGTTT 10 0.006830828 145.0 5 ATGCAAG 10 0.006830828 145.0 6 >>END_MODULE SRR7804103 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804103_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.24725 37.0 37.0 37.0 37.0 37.0 2 36.033 37.0 37.0 37.0 37.0 37.0 3 35.918 37.0 37.0 37.0 37.0 37.0 4 35.9955 37.0 37.0 37.0 37.0 37.0 5 36.136 37.0 37.0 37.0 37.0 37.0 6 36.0945 37.0 37.0 37.0 37.0 37.0 7 36.0045 37.0 37.0 37.0 37.0 37.0 8 36.0965 37.0 37.0 37.0 37.0 37.0 9 35.9175 37.0 37.0 37.0 37.0 37.0 10-14 36.03060000000001 37.0 37.0 37.0 37.0 37.0 15-19 35.9393 37.0 37.0 37.0 37.0 37.0 20-24 35.9187 37.0 37.0 37.0 37.0 37.0 25-29 35.8609 37.0 37.0 37.0 37.0 37.0 30-34 35.814299999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.761 37.0 37.0 37.0 37.0 37.0 40-44 35.7717 37.0 37.0 37.0 37.0 37.0 45-49 35.7113 37.0 37.0 37.0 37.0 37.0 50-54 35.626 37.0 37.0 37.0 37.0 37.0 55-59 35.638400000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.6527 37.0 37.0 37.0 37.0 37.0 65-69 35.546899999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.589200000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.5221 37.0 37.0 37.0 37.0 37.0 80-84 35.5284 37.0 37.0 37.0 37.0 37.0 85-89 35.5257 37.0 37.0 37.0 37.0 37.0 90-94 35.5102 37.0 37.0 37.0 37.0 37.0 95-99 35.410399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.46659999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.321299999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.30030000000001 37.0 37.0 37.0 34.6 37.0 115-119 35.205200000000005 37.0 37.0 37.0 32.2 37.0 120-124 35.197199999999995 37.0 37.0 37.0 34.6 37.0 125-129 35.1497 37.0 37.0 37.0 32.2 37.0 130-134 35.1616 37.0 37.0 37.0 34.6 37.0 135-139 35.075100000000006 37.0 37.0 37.0 27.4 37.0 140-144 35.038 37.0 37.0 37.0 25.0 37.0 145-149 34.8267 37.0 37.0 37.0 25.0 37.0 150-151 34.4355 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 12.0 14 5.0 15 10.0 16 5.0 17 3.0 18 0.0 19 2.0 20 8.0 21 13.0 22 13.0 23 9.0 24 8.0 25 11.0 26 10.0 27 13.0 28 25.0 29 25.0 30 29.0 31 49.0 32 70.0 33 96.0 34 215.0 35 578.0 36 2556.0 37 232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.484871217804454 18.229557389347338 10.502625656414104 31.782945736434108 2 33.25 21.15 23.075000000000003 22.525000000000002 3 25.25 25.575 23.7 25.474999999999998 4 28.175 29.675 17.775 24.375 5 29.075 30.5 16.125 24.3 6 23.974999999999998 33.5 17.424999999999997 25.1 7 25.324999999999996 18.675 30.175 25.825 8 28.050000000000004 20.200000000000003 18.525 33.225 9 25.025 22.900000000000002 22.8 29.275000000000002 10-14 27.169999999999998 24.145 20.575 28.110000000000003 15-19 27.575 23.235 21.29 27.900000000000002 20-24 27.82 23.415 21.285 27.48 25-29 27.48 23.615 20.724999999999998 28.18 30-34 27.534999999999997 23.445 21.575 27.445000000000004 35-39 27.925 23.32 21.115000000000002 27.639999999999997 40-44 27.27 23.565 21.465 27.700000000000003 45-49 28.005000000000003 23.44 21.23 27.325 50-54 28.185 23.49 21.115000000000002 27.21 55-59 27.925 23.41 20.89 27.775 60-64 27.35 23.015 21.485000000000003 28.15 65-69 28.194999999999997 22.75 21.395 27.66 70-74 27.52 22.8 21.095 28.585 75-79 27.58 23.0 21.75 27.67 80-84 27.73 23.025000000000002 21.265 27.98 85-89 27.744999999999997 22.615 21.195 28.444999999999997 90-94 27.905 23.095 21.48 27.52 95-99 27.98 23.16 21.59 27.27 100-104 28.565 23.64 20.78 27.015 105-109 27.994999999999997 22.96 21.815 27.229999999999997 110-114 27.77 23.18 21.490000000000002 27.560000000000002 115-119 28.310000000000002 23.29 21.075 27.325 120-124 28.74 23.32 21.505 26.435 125-129 27.97 23.665 20.72 27.644999999999996 130-134 28.38 23.415 20.965 27.24 135-139 28.095 23.62 21.575 26.71 140-144 28.015 23.919999999999998 21.29 26.775 145-149 28.785 23.445 21.39 26.38 150-151 28.225 24.1375 21.9 25.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 0.5 27 1.0 28 3.5 29 3.0 30 3.0 31 6.0 32 4.5 33 6.0 34 10.5 35 11.0 36 16.0 37 30.0 38 38.5 39 45.0 40 70.0 41 92.0 42 96.0 43 100.0 44 110.0 45 131.0 46 141.0 47 131.5 48 121.0 49 115.0 50 115.5 51 110.5 52 105.5 53 103.5 54 121.0 55 135.0 56 109.0 57 90.0 58 105.5 59 110.0 60 107.5 61 114.5 62 122.5 63 130.0 64 119.5 65 115.0 66 120.0 67 118.5 68 103.0 69 88.0 70 80.0 71 73.5 72 66.0 73 56.5 74 50.0 75 34.5 76 25.5 77 20.5 78 11.5 79 6.5 80 6.5 81 5.5 82 2.5 83 2.5 84 1.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 1.0 95 1.0 96 1.0 97 1.0 98 0.5 99 1.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.63072338119751 85.475 2 6.746139257653752 12.45 3 0.5147656461663506 1.425 4 0.0541858574911948 0.2 5 0.0 0.0 6 0.0270929287455974 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0270929287455974 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 1.0 0.0 0.0 0.0 0.0 134-135 1.2 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATATC 10 0.006830828 145.0 2 >>END_MODULE Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241865 spots for SRR7804103.sra Written 1241865 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra Read 1241851 spots for SRR7804103.sra Written 1241851 spots for SRR7804103.sra SRR ids: ['SRR7804103.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2i4m5188 SRR7804103.sra spots: 24837034 blocks: [[1, 1241851], [1241852, 2483702], [2483703, 3725553], [3725554, 4967404], [4967405, 6209255], [6209256, 7451106], [7451107, 8692957], [8692958, 9934808], [9934809, 11176659], [11176660, 12418510], [12418511, 13660361], [13660362, 14902212], [14902213, 16144063], [16144064, 17385914], [17385915, 18627765], [18627766, 19869616], [19869617, 21111467], [21111468, 22353318], [22353319, 23595169], [23595170, 24837034]] SRR7804103 file size 8394755 SRR7804103 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804103 SRR7804103_1.fastq SRR7804103_2.fastq Input file: SRR7804103_1.fastq Paired file: SRR7804103_2.fastq trimmed: SRR7804103-trimmed-pair1.fastq, SRR7804103-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:58:40 2024 >> started Sat Dec 7 16:59:07 2024 >> done (27.827s) 24837034 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 607 ( 0.00%) empty read pairs filtered out after trimming by size control 24836332 (100.00%) read pairs available; of these: 700441 ( 2.82%) trimmed read pairs available after processing 24135891 (97.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 13 0.00% 21 13 0.00% 22 15 0.00% 23 18 0.00% 24 17 0.00% 25 13 0.00% 26 15 0.00% 27 22 0.00% 28 18 0.00% 29 21 0.00% 30 26 0.00% 31 22 0.00% 32 27 0.00% 33 29 0.00% 34 28 0.00% 35 32 0.00% 36 29 0.00% 37 34 0.00% 38 42 0.00% 39 32 0.00% 40 31 0.00% 41 24 0.00% 42 42 0.00% 43 27 0.00% 44 44 0.00% 45 24 0.00% 46 44 0.00% 47 48 0.00% 48 47 0.00% 49 47 0.00% 50 42 0.00% 51 40 0.00% 52 42 0.00% 53 53 0.00% 54 42 0.00% 55 71 0.00% 56 64 0.00% 57 52 0.00% 58 58 0.00% 59 66 0.00% 60 73 0.00% 61 82 0.00% 62 85 0.00% 63 90 0.00% 64 85 0.00% 65 101 0.00% 66 107 0.00% 67 89 0.00% 68 97 0.00% 69 121 0.00% 70 141 0.00% 71 154 0.00% 72 161 0.00% 73 211 0.00% 74 195 0.00% 75 224 0.00% 76 219 0.00% 77 259 0.00% 78 292 0.00% 79 371 0.00% 80 334 0.00% 81 405 0.00% 82 468 0.00% 83 600 0.00% 84 602 0.00% 85 630 0.00% 86 719 0.00% 87 792 0.00% 88 844 0.00% 89 945 0.00% 90 1090 0.00% 91 1236 0.00% 92 1344 0.01% 93 1532 0.01% 94 1738 0.01% 95 1841 0.01% 96 1931 0.01% 97 1991 0.01% 98 2211 0.01% 99 2364 0.01% 100 2503 0.01% 101 2868 0.01% 102 3064 0.01% 103 3514 0.01% 104 3648 0.01% 105 3920 0.02% 106 4149 0.02% 107 4265 0.02% 108 4442 0.02% 109 4828 0.02% 110 4933 0.02% 111 5316 0.02% 112 5993 0.02% 113 6355 0.03% 114 6798 0.03% 115 7309 0.03% 116 7431 0.03% 117 7716 0.03% 118 8041 0.03% 119 8286 0.03% 120 8854 0.04% 121 9323 0.04% 122 9817 0.04% 123 10400 0.04% 124 11278 0.05% 125 11937 0.05% 126 12329 0.05% 127 12803 0.05% 128 12999 0.05% 129 13596 0.05% 130 13769 0.06% 131 14404 0.06% 132 15326 0.06% 133 16364 0.07% 134 17197 0.07% 135 18042 0.07% 136 18212 0.07% 137 19046 0.08% 138 19405 0.08% 139 20599 0.08% 140 20612 0.08% 141 21604 0.09% 142 22637 0.09% 143 23477 0.09% 144 24866 0.10% 145 26189 0.11% 146 26960 0.11% 147 27942 0.11% 148 28589 0.12% 149 28955 0.12% 150 29364 0.12% 151 24135891 97.18% 24836332 reads passed initial QC criterion=sequence-density sequence-density=1.21 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=25 prefix-density=1.25 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.26 sequence-density-rank=29 fanout-score=13.59 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=4.4 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=29 prefix-density=1.01 prefix-fanout=2.1 sequence=ATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=20.65 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.4 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804103 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:00:25 Started mapping on | Dec 07 17:00:25 Finished on | Dec 07 17:03:49 Mapping speed, Million of reads per hour | 438.29 Number of input reads | 24836332 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 22866394 Uniquely mapped reads % | 92.07% Average mapped length | 299.69 Number of splices: Total | 21275272 Number of splices: Annotated (sjdb) | 20158568 Number of splices: GT/AG | 20985988 Number of splices: GC/AG | 232606 Number of splices: AT/AC | 9059 Number of splices: Non-canonical | 47619 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306315 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 23062 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.87% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1663623 1663623 1663623 N_multimapping 306315 306315 306315 N_noFeature 579688 22220396 767485 N_ambiguous 571567 3544 113692 UnstrandedReadsAssigned:21715139 PositiveStrandReadsAssigned:642454 NegativeStrandReadsAssigned:21985217 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804103 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804103-trimmed-pair1.fastq SRR7804103-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,836,332 reads, 22,233,407 reads pseudoaligned [quant] estimated average fragment length: 297.552 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR7804103.ke.tsv 35125 SRR7804103.se.tsv 88098 total ==> SRR7804103.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 639.937 5.50619e-05 4.74294e-06 PNS24247 1044 747.448 48.0128 3.54088 PNS24249 1928 1631.45 96.7684 3.2696 PNS24246 1044 747.448 48.0128 3.54088 PNS24248 1044 747.448 48.0128 3.54088 PNS24244 1471 1174.45 84.193 3.95163 PNS24243 293 73.5968 0 0 KQK14069 1603 1306.45 7481.25 315.658 KQK14071 474 202.127 41.8871 11.4232 ==> SRR7804103.se.tsv <== BRADI_1g14170v3 7568 BRADI_1g53295v3 1593 BRADI_1g59795v3 175 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 1586 BRADI_1g74790v3 459 BRADI_1g09890v3 47 BRADI_1g77505v3 302 BRADI_1g48960v3 0 SRR7804103 completed mapping pipeline successfully