Starting /dee2/code/volunteer_pipeline.sh SRR7804104 current disk space = 1523247120384 free memory = 1561438884 SRR7804104 SRAfilesize 13ff87ba2d6ee787f7d18142fc2c2bf7 SRR7804104.sra SRR7804104.sra file validated SRR7804104 is paired end SRR7804104 is conventional basespace SRR7804104 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804104_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1995 37.0 37.0 37.0 37.0 37.0 2 36.21525 37.0 37.0 37.0 37.0 37.0 3 36.3155 37.0 37.0 37.0 37.0 37.0 4 36.507 37.0 37.0 37.0 37.0 37.0 5 36.5755 37.0 37.0 37.0 37.0 37.0 6 36.5115 37.0 37.0 37.0 37.0 37.0 7 36.509 37.0 37.0 37.0 37.0 37.0 8 36.498 37.0 37.0 37.0 37.0 37.0 9 36.549 37.0 37.0 37.0 37.0 37.0 10-14 36.506899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.516 37.0 37.0 37.0 37.0 37.0 20-24 36.513 37.0 37.0 37.0 37.0 37.0 25-29 36.4419 37.0 37.0 37.0 37.0 37.0 30-34 36.4073 37.0 37.0 37.0 37.0 37.0 35-39 36.3919 37.0 37.0 37.0 37.0 37.0 40-44 36.462599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3662 37.0 37.0 37.0 37.0 37.0 50-54 36.361200000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3789 37.0 37.0 37.0 37.0 37.0 60-64 36.3716 37.0 37.0 37.0 37.0 37.0 65-69 36.3474 37.0 37.0 37.0 37.0 37.0 70-74 36.299699999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.3109 37.0 37.0 37.0 37.0 37.0 80-84 36.1986 37.0 37.0 37.0 37.0 37.0 85-89 36.1986 37.0 37.0 37.0 37.0 37.0 90-94 36.2097 37.0 37.0 37.0 37.0 37.0 95-99 36.144000000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1959 37.0 37.0 37.0 37.0 37.0 105-109 36.0719 37.0 37.0 37.0 37.0 37.0 110-114 36.0739 37.0 37.0 37.0 37.0 37.0 115-119 36.053399999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.003699999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.9193 37.0 37.0 37.0 37.0 37.0 130-134 35.8347 37.0 37.0 37.0 37.0 37.0 135-139 35.8274 37.0 37.0 37.0 37.0 37.0 140-144 35.7783 37.0 37.0 37.0 37.0 37.0 145-149 35.7875 37.0 37.0 37.0 37.0 37.0 150-151 35.22725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 2.0 26 1.0 27 5.0 28 16.0 29 25.0 30 31.0 31 49.0 32 40.0 33 76.0 34 120.0 35 374.0 36 2880.0 37 378.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.9 13.075000000000001 8.85 32.175 2 27.745809357017766 14.135601701275958 29.046785088816613 29.071803852889666 3 22.35 17.925 24.375 35.35 4 25.674999999999997 23.599999999999998 22.0 28.725 5 26.8 26.75 22.125 24.325 6 24.45 30.275000000000002 22.525000000000002 22.75 7 18.85 23.474999999999998 36.725 20.95 8 22.95 23.9 26.3 26.85 9 21.125 21.9 31.4 25.575 10-14 24.025 25.009999999999998 25.245 25.72 15-19 23.66 24.165 25.474999999999998 26.700000000000003 20-24 23.96 24.73 25.135 26.174999999999997 25-29 23.945 24.995 24.295 26.765 30-34 24.255 25.345000000000002 24.654999999999998 25.745 35-39 24.32 24.29 25.195 26.195 40-44 24.135 24.515 24.705 26.645000000000003 45-49 24.13 25.009999999999998 24.4 26.46 50-54 24.335 23.580000000000002 24.795 27.29 55-59 24.665 24.2 24.224999999999998 26.91 60-64 24.560000000000002 24.224999999999998 24.445 26.77 65-69 24.51 23.87 24.505 27.115000000000002 70-74 24.925 24.055 24.215 26.805 75-79 25.324999999999996 24.185000000000002 24.154999999999998 26.334999999999997 80-84 24.745 24.415 24.104999999999997 26.735 85-89 24.755 23.56 24.65 27.034999999999997 90-94 25.174999999999997 23.64 24.275 26.91 95-99 25.005 23.91 24.425 26.66 100-104 25.590000000000003 23.665 23.805 26.939999999999998 105-109 25.56 24.044999999999998 23.674999999999997 26.72 110-114 25.290000000000003 23.880000000000003 23.65 27.18 115-119 25.005 23.535 24.125 27.334999999999997 120-124 25.064999999999998 23.599999999999998 24.04 27.295 125-129 25.27 24.44 23.51 26.779999999999998 130-134 25.39 23.61 23.96 27.04 135-139 24.77 23.115 25.019999999999996 27.095000000000002 140-144 25.305 23.445 24.085 27.165 145-149 25.869999999999997 22.98 23.96 27.189999999999998 150-151 25.474999999999998 23.1 24.462500000000002 26.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 0.0 28 1.5 29 5.0 30 6.0 31 7.5 32 13.0 33 18.0 34 18.5 35 25.0 36 35.0 37 49.0 38 71.5 39 85.5 40 102.0 41 126.5 42 122.5 43 137.5 44 172.0 45 180.0 46 179.5 47 174.5 48 180.0 49 181.0 50 178.5 51 158.5 52 142.0 53 135.5 54 117.0 55 113.0 56 102.0 57 86.0 58 84.0 59 86.0 60 76.0 61 62.0 62 69.5 63 73.0 64 73.5 65 74.0 66 60.5 67 55.5 68 59.5 69 51.5 70 41.0 71 39.0 72 37.5 73 33.0 74 29.5 75 21.0 76 14.5 77 14.0 78 7.5 79 3.0 80 3.5 81 3.5 82 1.5 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.63976483164083 87.6 2 5.879208979155532 11.0 3 0.4543025120256547 1.275 4 0.0 0.0 5 0.026723677177979688 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCTCCCCGCCGGCCATCTCCAGCCCACCAGAGCTCCCCTTGTGGGTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.4500000000000002 0.0 0.0 0.0 0.0 132-133 1.6124999999999998 0.0 0.0 0.0 0.0 134-135 1.7000000000000002 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138-139 2.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804104 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804104_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18925 37.0 37.0 37.0 37.0 37.0 2 35.96 37.0 37.0 37.0 37.0 37.0 3 35.902 37.0 37.0 37.0 37.0 37.0 4 36.0925 37.0 37.0 37.0 37.0 37.0 5 36.0635 37.0 37.0 37.0 37.0 37.0 6 36.0925 37.0 37.0 37.0 37.0 37.0 7 35.9885 37.0 37.0 37.0 37.0 37.0 8 36.049 37.0 37.0 37.0 37.0 37.0 9 35.9535 37.0 37.0 37.0 37.0 37.0 10-14 36.098 37.0 37.0 37.0 37.0 37.0 15-19 35.970299999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.936 37.0 37.0 37.0 37.0 37.0 25-29 35.9058 37.0 37.0 37.0 37.0 37.0 30-34 35.9074 37.0 37.0 37.0 37.0 37.0 35-39 35.8437 37.0 37.0 37.0 37.0 37.0 40-44 35.785799999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.744299999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.7544 37.0 37.0 37.0 37.0 37.0 55-59 35.71329999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.706599999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.6786 37.0 37.0 37.0 37.0 37.0 70-74 35.6804 37.0 37.0 37.0 37.0 37.0 75-79 35.624199999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.68729999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.6078 37.0 37.0 37.0 37.0 37.0 90-94 35.5869 37.0 37.0 37.0 37.0 37.0 95-99 35.5982 37.0 37.0 37.0 37.0 37.0 100-104 35.554199999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.455799999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.2856 37.0 37.0 37.0 32.2 37.0 115-119 35.3523 37.0 37.0 37.0 37.0 37.0 120-124 35.3577 37.0 37.0 37.0 34.6 37.0 125-129 35.214800000000004 37.0 37.0 37.0 29.8 37.0 130-134 35.30899999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.1792 37.0 37.0 37.0 29.8 37.0 140-144 35.054899999999996 37.0 37.0 37.0 27.4 37.0 145-149 34.964299999999994 37.0 37.0 37.0 25.0 37.0 150-151 34.501000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 7.0 14 5.0 15 9.0 16 4.0 17 3.0 18 6.0 19 5.0 20 10.0 21 8.0 22 15.0 23 10.0 24 4.0 25 5.0 26 10.0 27 12.0 28 19.0 29 21.0 30 27.0 31 42.0 32 66.0 33 100.0 34 205.0 35 614.0 36 2551.0 37 242.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.78058543907931 19.614711033274958 10.933199899924944 28.67150362772079 2 33.1 22.95 22.35 21.6 3 25.45 24.975 25.0 24.575 4 28.299999999999997 29.849999999999998 18.525 23.325000000000003 5 29.025000000000002 29.95 18.525 22.5 6 26.025 33.125 18.224999999999998 22.625 7 24.05 19.15 31.424999999999997 25.374999999999996 8 25.900000000000002 22.1 21.175 30.825000000000003 9 25.55 22.025 24.925 27.500000000000004 10-14 26.834999999999997 24.884999999999998 21.91 26.369999999999997 15-19 26.72 24.349999999999998 22.365 26.565 20-24 26.355 24.745 22.365 26.534999999999997 25-29 26.495 24.175 23.06 26.27 30-34 26.619999999999997 24.895 22.830000000000002 25.655 35-39 26.795 24.895 22.245 26.064999999999998 40-44 26.615 24.154999999999998 22.785 26.445 45-49 26.93 24.775 22.555 25.740000000000002 50-54 27.025 24.64 22.89 25.445 55-59 27.26 24.935 22.765 25.040000000000003 60-64 27.455000000000002 24.765 22.295 25.485000000000003 65-69 27.61 25.014999999999997 22.165000000000003 25.21 70-74 27.96 24.67 22.455 24.915000000000003 75-79 27.229999999999997 24.435000000000002 23.39 24.945 80-84 27.455000000000002 24.29 22.515 25.740000000000002 85-89 27.500000000000004 24.73 22.365 25.405 90-94 26.87 25.119999999999997 22.38 25.629999999999995 95-99 27.415 24.625 22.665 25.295 100-104 27.71 24.37 22.54 25.380000000000003 105-109 27.01 24.32 23.085 25.585 110-114 27.12 25.005 22.855 25.019999999999996 115-119 27.595 24.86 22.439999999999998 25.105 120-124 27.05 24.884999999999998 23.06 25.005 125-129 27.18 25.040000000000003 23.105 24.675 130-134 26.729999999999997 24.89 23.189999999999998 25.19 135-139 27.02 24.955 23.03 24.995 140-144 27.534999999999997 25.085 22.45 24.93 145-149 27.185 24.875 22.99 24.95 150-151 27.425 24.474999999999998 23.200000000000003 24.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 2.0 17 2.0 18 2.0 19 2.0 20 1.5 21 2.0 22 1.0 23 0.0 24 0.5 25 2.5 26 3.5 27 3.0 28 3.0 29 3.0 30 4.5 31 5.5 32 6.5 33 10.5 34 11.0 35 16.0 36 33.0 37 36.5 38 42.0 39 63.0 40 80.5 41 105.0 42 127.0 43 138.0 44 155.5 45 159.5 46 159.0 47 175.0 48 172.0 49 147.5 50 138.5 51 142.5 52 138.0 53 122.0 54 123.0 55 126.0 56 102.0 57 92.5 58 98.5 59 99.5 60 103.5 61 95.5 62 79.0 63 78.5 64 87.0 65 78.5 66 61.0 67 64.0 68 66.0 69 56.0 70 61.0 71 62.5 72 51.5 73 43.0 74 33.5 75 26.5 76 22.5 77 20.0 78 14.5 79 7.0 80 2.5 81 3.0 82 2.5 83 1.5 84 1.0 85 1.0 86 1.5 87 0.5 88 0.0 89 0.5 90 0.5 91 1.0 92 1.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 1.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.72485921158487 87.375 2 5.738803968892464 10.7 3 0.37543577366586217 1.05 4 0.08045052292839903 0.3 5 0.026816840976133013 0.125 6 0.026816840976133013 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026816840976133013 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GAAACATCCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTC 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.6625 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.4249999999999998 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.75 0.0 0.0 0.0 0.0 136-137 1.95 0.0 0.0 0.0 0.0 138-139 2.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTACAC 10 0.006830828 145.0 8 >>END_MODULE Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322778 spots for SRR7804104.sra Written 1322778 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra Read 1322766 spots for SRR7804104.sra Written 1322766 spots for SRR7804104.sra SRR ids: ['SRR7804104.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i8fqdyl1 SRR7804104.sra spots: 26455332 blocks: [[1, 1322766], [1322767, 2645532], [2645533, 3968298], [3968299, 5291064], [5291065, 6613830], [6613831, 7936596], [7936597, 9259362], [9259363, 10582128], [10582129, 11904894], [11904895, 13227660], [13227661, 14550426], [14550427, 15873192], [15873193, 17195958], [17195959, 18518724], [18518725, 19841490], [19841491, 21164256], [21164257, 22487022], [22487023, 23809788], [23809789, 25132554], [25132555, 26455332]] SRR7804104 file size 8943143 SRR7804104 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804104 SRR7804104_1.fastq SRR7804104_2.fastq Input file: SRR7804104_1.fastq Paired file: SRR7804104_2.fastq trimmed: SRR7804104-trimmed-pair1.fastq, SRR7804104-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:44:34 2024 >> started Tue Dec 10 01:46:20 2024 >> done (105.845s) 26455332 read pairs processed; of these: 103 ( 0.00%) short read pairs filtered out after trimming by size control 1046 ( 0.00%) empty read pairs filtered out after trimming by size control 26454183 (100.00%) read pairs available; of these: 783885 ( 2.96%) trimmed read pairs available after processing 25670298 (97.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 14 0.00% 20 9 0.00% 21 11 0.00% 22 11 0.00% 23 28 0.00% 24 21 0.00% 25 14 0.00% 26 16 0.00% 27 20 0.00% 28 23 0.00% 29 30 0.00% 30 35 0.00% 31 28 0.00% 32 27 0.00% 33 45 0.00% 34 26 0.00% 35 35 0.00% 36 36 0.00% 37 36 0.00% 38 45 0.00% 39 36 0.00% 40 56 0.00% 41 31 0.00% 42 44 0.00% 43 38 0.00% 44 39 0.00% 45 52 0.00% 46 42 0.00% 47 58 0.00% 48 49 0.00% 49 45 0.00% 50 46 0.00% 51 52 0.00% 52 51 0.00% 53 60 0.00% 54 65 0.00% 55 67 0.00% 56 72 0.00% 57 67 0.00% 58 69 0.00% 59 54 0.00% 60 79 0.00% 61 77 0.00% 62 85 0.00% 63 72 0.00% 64 92 0.00% 65 85 0.00% 66 103 0.00% 67 114 0.00% 68 113 0.00% 69 144 0.00% 70 139 0.00% 71 134 0.00% 72 142 0.00% 73 173 0.00% 74 202 0.00% 75 226 0.00% 76 207 0.00% 77 242 0.00% 78 259 0.00% 79 312 0.00% 80 333 0.00% 81 380 0.00% 82 463 0.00% 83 532 0.00% 84 560 0.00% 85 619 0.00% 86 667 0.00% 87 808 0.00% 88 842 0.00% 89 931 0.00% 90 1010 0.00% 91 1133 0.00% 92 1281 0.00% 93 1376 0.01% 94 1570 0.01% 95 1657 0.01% 96 1793 0.01% 97 2080 0.01% 98 2115 0.01% 99 2276 0.01% 100 2628 0.01% 101 2833 0.01% 102 3006 0.01% 103 3324 0.01% 104 3710 0.01% 105 3899 0.01% 106 4294 0.02% 107 4366 0.02% 108 4731 0.02% 109 5147 0.02% 110 5443 0.02% 111 5717 0.02% 112 6086 0.02% 113 6716 0.03% 114 6988 0.03% 115 7421 0.03% 116 7871 0.03% 117 8392 0.03% 118 8681 0.03% 119 9133 0.03% 120 9469 0.04% 121 10210 0.04% 122 10850 0.04% 123 11461 0.04% 124 12177 0.05% 125 13169 0.05% 126 13589 0.05% 127 14145 0.05% 128 14426 0.05% 129 15051 0.06% 130 15764 0.06% 131 16097 0.06% 132 17379 0.07% 133 18156 0.07% 134 18987 0.07% 135 20597 0.08% 136 21254 0.08% 137 22095 0.08% 138 22348 0.08% 139 22958 0.09% 140 23954 0.09% 141 24364 0.09% 142 26179 0.10% 143 27074 0.10% 144 28589 0.11% 145 30161 0.11% 146 31206 0.12% 147 32389 0.12% 148 33107 0.13% 149 34132 0.13% 150 35121 0.13% 151 25670298 97.04% 26454183 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=18 prefix-density=0.55 prefix-fanout=3.1 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=280.47 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=32.2 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=1.45 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=25 prefix-density=1.62 prefix-fanout=2.9 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=1027.38 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=20.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAA SRR7804104 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:47:26 Started mapping on | Dec 10 01:47:26 Finished on | Dec 10 01:53:59 Mapping speed, Million of reads per hour | 242.33 Number of input reads | 26454183 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 23861039 Uniquely mapped reads % | 90.20% Average mapped length | 299.45 Number of splices: Total | 23506334 Number of splices: Annotated (sjdb) | 21999709 Number of splices: GT/AG | 23160750 Number of splices: GC/AG | 260545 Number of splices: AT/AC | 16513 Number of splices: Non-canonical | 68526 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 365080 % of reads mapped to multiple loci | 1.38% Number of reads mapped to too many loci | 22830 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.66% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2228064 2228064 2228064 N_multimapping 365080 365080 365080 N_noFeature 663762 23209609 867930 N_ambiguous 537551 4306 93721 UnstrandedReadsAssigned:22659726 PositiveStrandReadsAssigned:647124 NegativeStrandReadsAssigned:22899388 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804104 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804104-trimmed-pair1.fastq SRR7804104-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,454,183 reads, 23,391,922 reads pseudoaligned [quant] estimated average fragment length: 294.026 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52973 SRR7804104.ke.tsv 35125 SRR7804104.se.tsv 88098 total ==> SRR7804104.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 643.577 0 0 PNS24247 1044 750.974 132.262 9.50514 PNS24249 1928 1634.97 287.059 9.47567 PNS24246 1044 750.974 132.262 9.50514 PNS24248 1044 750.974 132.262 9.50514 PNS24244 1471 1177.97 208.157 9.53683 PNS24243 293 73.7605 0 0 KQK14069 1603 1309.97 11502.5 473.892 KQK14071 474 204.115 92.6998 24.5106 ==> SRR7804104.se.tsv <== BRADI_1g14170v3 11676 BRADI_1g53295v3 1257 BRADI_1g59795v3 359 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 1026 BRADI_1g74790v3 161 BRADI_1g09890v3 0 BRADI_1g77505v3 500 BRADI_1g48960v3 0 SRR7804104 completed mapping pipeline successfully