Starting /dee2/code/volunteer_pipeline.sh SRR7804105 current disk space = 1523723087872 free memory = 1565024496 SRR7804105 SRAfilesize 0530190c4d3f91502407d8413cc5d4b4 SRR7804105.sra SRR7804105.sra file validated SRR7804105 is paired end SRR7804105 is conventional basespace SRR7804105 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804105_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2345 37.0 37.0 37.0 37.0 37.0 2 36.36375 37.0 37.0 37.0 37.0 37.0 3 36.213 37.0 37.0 37.0 37.0 37.0 4 36.408 37.0 37.0 37.0 37.0 37.0 5 36.5305 37.0 37.0 37.0 37.0 37.0 6 36.4905 37.0 37.0 37.0 37.0 37.0 7 36.463 37.0 37.0 37.0 37.0 37.0 8 36.4415 37.0 37.0 37.0 37.0 37.0 9 36.4515 37.0 37.0 37.0 37.0 37.0 10-14 36.4935 37.0 37.0 37.0 37.0 37.0 15-19 36.4971 37.0 37.0 37.0 37.0 37.0 20-24 36.4782 37.0 37.0 37.0 37.0 37.0 25-29 36.4352 37.0 37.0 37.0 37.0 37.0 30-34 36.40579999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4191 37.0 37.0 37.0 37.0 37.0 40-44 36.398 37.0 37.0 37.0 37.0 37.0 45-49 36.3857 37.0 37.0 37.0 37.0 37.0 50-54 36.35260000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.347899999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.319500000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.291199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.244 37.0 37.0 37.0 37.0 37.0 75-79 36.2673 37.0 37.0 37.0 37.0 37.0 80-84 36.225699999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.144000000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.175599999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1197 37.0 37.0 37.0 37.0 37.0 100-104 36.1445 37.0 37.0 37.0 37.0 37.0 105-109 36.0384 37.0 37.0 37.0 37.0 37.0 110-114 36.1161 37.0 37.0 37.0 37.0 37.0 115-119 36.0475 37.0 37.0 37.0 37.0 37.0 120-124 35.9765 37.0 37.0 37.0 37.0 37.0 125-129 35.9363 37.0 37.0 37.0 37.0 37.0 130-134 35.8968 37.0 37.0 37.0 37.0 37.0 135-139 35.8822 37.0 37.0 37.0 37.0 37.0 140-144 35.7833 37.0 37.0 37.0 37.0 37.0 145-149 35.7822 37.0 37.0 37.0 37.0 37.0 150-151 35.215 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 8.0 26 4.0 27 6.0 28 18.0 29 15.0 30 35.0 31 38.0 32 63.0 33 84.0 34 140.0 35 338.0 36 2815.0 37 434.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.4 13.450000000000001 9.0 36.15 2 27.50938673341677 12.190237797246558 29.61201501877347 30.688360450563202 3 22.575 16.025 24.975 36.425000000000004 4 27.825 20.150000000000002 21.4 30.625000000000004 5 29.225 23.025000000000002 21.675 26.075 6 25.95 27.650000000000002 22.125 24.275 7 19.85 23.35 35.975 20.825 8 22.125 23.25 27.250000000000004 27.375 9 22.05 21.099999999999998 29.525000000000002 27.325 10-14 25.445 23.575 24.240000000000002 26.740000000000002 15-19 24.95 23.71 24.654999999999998 26.685 20-24 25.655 23.885 23.625 26.834999999999997 25-29 25.41 23.400000000000002 23.84 27.35 30-34 24.825 23.135 24.67 27.37 35-39 24.654999999999998 23.75 24.02 27.575 40-44 25.81 23.494999999999997 24.03 26.665 45-49 25.575 23.055 24.27 27.1 50-54 25.240000000000002 22.71 24.11 27.939999999999998 55-59 25.25 23.75 23.169999999999998 27.83 60-64 25.915 23.474999999999998 23.195 27.415 65-69 25.8 22.93 23.515 27.755000000000003 70-74 25.445 23.225 23.72 27.61 75-79 25.759999999999998 23.01 23.794999999999998 27.435 80-84 26.015 23.155 23.294999999999998 27.534999999999997 85-89 26.0 22.975 23.03 27.994999999999997 90-94 26.240000000000002 22.314999999999998 23.845 27.6 95-99 25.97 22.355 23.71 27.965 100-104 26.145000000000003 22.445 23.544999999999998 27.865000000000002 105-109 26.685 22.875 23.119999999999997 27.32 110-114 26.21 22.555 23.830000000000002 27.405 115-119 26.765 22.32 23.825 27.089999999999996 120-124 26.355 22.59 23.05 28.005000000000003 125-129 25.85 22.5 23.275000000000002 28.375 130-134 26.669999999999998 22.634999999999998 22.994999999999997 27.700000000000003 135-139 26.784999999999997 22.545 23.03 27.639999999999997 140-144 26.979999999999997 22.6 22.98 27.439999999999998 145-149 27.05 22.865 23.135 26.950000000000003 150-151 27.075 22.3625 22.525000000000002 28.037499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 1.0 26 1.5 27 1.5 28 0.0 29 1.0 30 6.0 31 11.5 32 16.0 33 16.0 34 20.0 35 27.0 36 36.5 37 44.5 38 64.5 39 77.5 40 74.5 41 82.5 42 105.0 43 130.0 44 138.0 45 138.0 46 140.0 47 144.0 48 134.0 49 125.0 50 122.5 51 130.5 52 137.5 53 132.0 54 128.5 55 131.0 56 131.5 57 124.5 58 119.5 59 120.5 60 104.0 61 92.5 62 94.0 63 76.5 64 84.5 65 100.5 66 83.0 67 78.5 68 76.0 69 61.0 70 53.0 71 45.5 72 48.0 73 45.5 74 34.5 75 26.5 76 21.5 77 17.5 78 14.5 79 9.0 80 3.0 81 5.5 82 4.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.68262653898769 83.775 2 7.387140902872777 13.5 3 0.7934336525307797 2.175 4 0.08207934336525308 0.3 5 0.05471956224350205 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGAAGTTACGGGGCTATTTTGCCGAGTTCCTTAGAGAGAGTTGTCTCG 5 0.125 No Hit ACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.1375 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.5499999999999998 0.0 0.0 0.0 0.0 136-137 1.7999999999999998 0.0 0.0 0.0 0.0 138-139 2.0999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAACCC 10 0.006830828 145.0 145 CATGCTC 10 0.006830828 145.0 2 CTCCACC 25 5.7044963E-6 116.0 6 TCCACCG 25 5.7044963E-6 116.0 7 GCTCCAC 30 0.0017973486 72.5 5 >>END_MODULE SRR7804105 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804105_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31275 37.0 37.0 37.0 37.0 37.0 2 35.9455 37.0 37.0 37.0 37.0 37.0 3 36.042 37.0 37.0 37.0 37.0 37.0 4 36.0315 37.0 37.0 37.0 37.0 37.0 5 36.0295 37.0 37.0 37.0 37.0 37.0 6 36.0715 37.0 37.0 37.0 37.0 37.0 7 35.865 37.0 37.0 37.0 37.0 37.0 8 36.023 37.0 37.0 37.0 37.0 37.0 9 35.8695 37.0 37.0 37.0 37.0 37.0 10-14 36.036500000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.9363 37.0 37.0 37.0 37.0 37.0 20-24 35.9139 37.0 37.0 37.0 37.0 37.0 25-29 35.8448 37.0 37.0 37.0 37.0 37.0 30-34 35.8275 37.0 37.0 37.0 37.0 37.0 35-39 35.8042 37.0 37.0 37.0 37.0 37.0 40-44 35.763400000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.706399999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.6683 37.0 37.0 37.0 37.0 37.0 55-59 35.673700000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.6574 37.0 37.0 37.0 37.0 37.0 65-69 35.6184 37.0 37.0 37.0 37.0 37.0 70-74 35.5623 37.0 37.0 37.0 37.0 37.0 75-79 35.6057 37.0 37.0 37.0 37.0 37.0 80-84 35.5707 37.0 37.0 37.0 37.0 37.0 85-89 35.541000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.483 37.0 37.0 37.0 37.0 37.0 95-99 35.4628 37.0 37.0 37.0 37.0 37.0 100-104 35.4476 37.0 37.0 37.0 37.0 37.0 105-109 35.4227 37.0 37.0 37.0 37.0 37.0 110-114 35.2471 37.0 37.0 37.0 32.2 37.0 115-119 35.251 37.0 37.0 37.0 34.6 37.0 120-124 35.186099999999996 37.0 37.0 37.0 32.2 37.0 125-129 35.156 37.0 37.0 37.0 29.8 37.0 130-134 35.235200000000006 37.0 37.0 37.0 32.2 37.0 135-139 35.12050000000001 37.0 37.0 37.0 27.4 37.0 140-144 35.095 37.0 37.0 37.0 27.4 37.0 145-149 34.851099999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.37175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 9.0 14 8.0 15 9.0 16 6.0 17 4.0 18 4.0 19 6.0 20 9.0 21 3.0 22 8.0 23 7.0 24 11.0 25 11.0 26 11.0 27 21.0 28 26.0 29 24.0 30 39.0 31 37.0 32 61.0 33 111.0 34 185.0 35 620.0 36 2554.0 37 216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.834708677169296 18.95473868467117 9.927481870467616 32.283070767691925 2 33.650000000000006 20.9 22.275 23.175 3 25.674999999999997 24.0 25.224999999999998 25.1 4 28.1 27.3 18.45 26.150000000000002 5 31.2 28.599999999999998 18.45 21.75 6 27.05 33.875 15.950000000000001 23.125 7 24.45 20.175 30.025000000000002 25.35 8 26.900000000000002 22.25 19.825 31.025000000000002 9 26.174999999999997 22.525000000000002 23.599999999999998 27.700000000000003 10-14 28.355000000000004 24.565 20.07 27.01 15-19 27.68 24.085 21.58 26.655 20-24 28.12 23.615 21.310000000000002 26.955000000000002 25-29 28.015 24.385 21.185000000000002 26.415 30-34 28.749999999999996 23.64 21.240000000000002 26.369999999999997 35-39 27.750000000000004 25.069999999999997 20.855 26.325 40-44 28.285 23.87 21.215 26.63 45-49 27.450000000000003 23.794999999999998 21.825 26.93 50-54 28.42 23.66 21.4 26.52 55-59 28.055000000000003 23.405 21.605 26.935 60-64 28.249999999999996 23.365 21.905 26.479999999999997 65-69 28.15 23.52 21.18 27.150000000000002 70-74 28.63 23.27 21.485000000000003 26.615 75-79 27.515 23.715 21.52 27.250000000000004 80-84 27.965 23.369999999999997 21.955 26.71 85-89 28.43 23.205000000000002 21.135 27.229999999999997 90-94 28.055000000000003 24.01 21.605 26.33 95-99 27.925 23.31 21.46 27.305 100-104 28.055000000000003 23.294999999999998 21.815 26.834999999999997 105-109 28.1 23.565 21.555 26.779999999999998 110-114 27.88 23.57 21.634999999999998 26.915 115-119 28.860000000000003 23.169999999999998 21.63 26.340000000000003 120-124 27.644999999999996 23.400000000000002 21.93 27.025 125-129 28.194999999999997 23.36 21.92 26.525 130-134 28.405 24.085 21.255 26.255 135-139 27.675 24.175 22.345000000000002 25.805 140-144 28.16 24.135 22.009999999999998 25.695 145-149 27.91 24.675 21.445 25.97 150-151 28.537499999999998 23.8125 21.3125 26.337500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 1.5 13 1.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 2.0 20 2.5 21 1.5 22 1.5 23 1.0 24 0.5 25 0.5 26 2.0 27 3.5 28 3.5 29 4.5 30 6.0 31 6.0 32 6.0 33 6.5 34 12.5 35 19.5 36 22.5 37 25.0 38 39.0 39 58.0 40 71.5 41 83.0 42 93.0 43 109.5 44 126.5 45 123.0 46 118.5 47 118.5 48 119.5 49 124.5 50 119.5 51 118.5 52 122.0 53 122.0 54 127.0 55 133.5 56 120.0 57 113.0 58 122.5 59 124.0 60 123.0 61 102.5 62 90.0 63 99.0 64 110.5 65 119.5 66 116.5 67 107.0 68 92.0 69 81.0 70 72.0 71 67.5 72 60.0 73 47.5 74 38.5 75 28.5 76 22.0 77 20.5 78 15.5 79 9.0 80 4.5 81 1.5 82 3.5 83 3.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.5 89 2.0 90 2.0 91 1.0 92 1.0 93 0.5 94 0.0 95 1.0 96 1.0 97 1.0 98 2.5 99 2.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.18579234972678 84.35000000000001 2 6.857923497267759 12.55 3 0.7103825136612022 1.95 4 0.16393442622950818 0.6 5 0.0546448087431694 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0273224043715847 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.3625 0.0 0.0 0.0 0.0 132-133 1.45 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.85 0.0 0.0 0.0 0.0 138-139 2.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGCC 10 0.006830828 145.0 2 CGGTGTT 10 0.006830828 145.0 1 GGCTCGA 10 0.006830828 145.0 9 >>END_MODULE Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184292 spots for SRR7804105.sra Written 1184292 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra Read 1184291 spots for SRR7804105.sra Written 1184291 spots for SRR7804105.sra SRR ids: ['SRR7804105.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5voal5_7 SRR7804105.sra spots: 23685821 blocks: [[1, 1184291], [1184292, 2368582], [2368583, 3552873], [3552874, 4737164], [4737165, 5921455], [5921456, 7105746], [7105747, 8290037], [8290038, 9474328], [9474329, 10658619], [10658620, 11842910], [11842911, 13027201], [13027202, 14211492], [14211493, 15395783], [15395784, 16580074], [16580075, 17764365], [17764366, 18948656], [18948657, 20132947], [20132948, 21317238], [21317239, 22501529], [22501530, 23685821]] SRR7804105 file size 8004647 SRR7804105 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804105 SRR7804105_1.fastq SRR7804105_2.fastq Input file: SRR7804105_1.fastq Paired file: SRR7804105_2.fastq trimmed: SRR7804105-trimmed-pair1.fastq, SRR7804105-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:47:47 2024 >> started Tue Dec 10 01:48:14 2024 >> done (27.532s) 23685821 read pairs processed; of these: 83 ( 0.00%) short read pairs filtered out after trimming by size control 2949 ( 0.01%) empty read pairs filtered out after trimming by size control 23682789 (99.99%) read pairs available; of these: 861660 ( 3.64%) trimmed read pairs available after processing 22821129 (96.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 6 0.00% 21 8 0.00% 22 8 0.00% 23 8 0.00% 24 14 0.00% 25 4 0.00% 26 16 0.00% 27 14 0.00% 28 9 0.00% 29 18 0.00% 30 17 0.00% 31 14 0.00% 32 22 0.00% 33 23 0.00% 34 12 0.00% 35 26 0.00% 36 18 0.00% 37 22 0.00% 38 16 0.00% 39 19 0.00% 40 20 0.00% 41 32 0.00% 42 18 0.00% 43 23 0.00% 44 26 0.00% 45 36 0.00% 46 25 0.00% 47 29 0.00% 48 34 0.00% 49 38 0.00% 50 34 0.00% 51 29 0.00% 52 24 0.00% 53 34 0.00% 54 37 0.00% 55 45 0.00% 56 43 0.00% 57 43 0.00% 58 44 0.00% 59 59 0.00% 60 50 0.00% 61 50 0.00% 62 55 0.00% 63 56 0.00% 64 53 0.00% 65 46 0.00% 66 54 0.00% 67 70 0.00% 68 61 0.00% 69 81 0.00% 70 93 0.00% 71 93 0.00% 72 103 0.00% 73 122 0.00% 74 113 0.00% 75 127 0.00% 76 186 0.00% 77 168 0.00% 78 201 0.00% 79 204 0.00% 80 276 0.00% 81 297 0.00% 82 322 0.00% 83 342 0.00% 84 424 0.00% 85 447 0.00% 86 514 0.00% 87 577 0.00% 88 669 0.00% 89 666 0.00% 90 835 0.00% 91 891 0.00% 92 1076 0.00% 93 1215 0.01% 94 1266 0.01% 95 1492 0.01% 96 1660 0.01% 97 1747 0.01% 98 1893 0.01% 99 2080 0.01% 100 2381 0.01% 101 2493 0.01% 102 2803 0.01% 103 2996 0.01% 104 3289 0.01% 105 3557 0.02% 106 3955 0.02% 107 4310 0.02% 108 4499 0.02% 109 4948 0.02% 110 5161 0.02% 111 5514 0.02% 112 6149 0.03% 113 6426 0.03% 114 7176 0.03% 115 7658 0.03% 116 8215 0.03% 117 8474 0.04% 118 8986 0.04% 119 9486 0.04% 120 10289 0.04% 121 10850 0.05% 122 11537 0.05% 123 12381 0.05% 124 13014 0.05% 125 13853 0.06% 126 14761 0.06% 127 15518 0.07% 128 16176 0.07% 129 16750 0.07% 130 17656 0.07% 131 18481 0.08% 132 19670 0.08% 133 20615 0.09% 134 21679 0.09% 135 22738 0.10% 136 24022 0.10% 137 24419 0.10% 138 25241 0.11% 139 26837 0.11% 140 27722 0.12% 141 28581 0.12% 142 29740 0.13% 143 31295 0.13% 144 32789 0.14% 145 34231 0.14% 146 35838 0.15% 147 36616 0.15% 148 38262 0.16% 149 38999 0.16% 150 40974 0.17% 151 22821129 96.36% 23682789 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=28 prefix-density=0.88 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=59.24 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=4.7 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=25 prefix-density=0.87 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=24.49 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.6 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804105 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:49:05 Started mapping on | Dec 10 01:49:05 Finished on | Dec 10 01:53:18 Mapping speed, Million of reads per hour | 336.99 Number of input reads | 23682789 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20018826 Uniquely mapped reads % | 84.53% Average mapped length | 299.55 Number of splices: Total | 18570273 Number of splices: Annotated (sjdb) | 17577695 Number of splices: GT/AG | 18304955 Number of splices: GC/AG | 212851 Number of splices: AT/AC | 6758 Number of splices: Non-canonical | 45709 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1025831 % of reads mapped to multiple loci | 4.33% Number of reads mapped to too many loci | 128804 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.42% % of reads unmapped: other | 4.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2638132 2638132 2638132 N_multimapping 1025831 1025831 1025831 N_noFeature 1417999 19417621 1548519 N_ambiguous 583608 3211 113610 UnstrandedReadsAssigned:18017219 PositiveStrandReadsAssigned:597994 NegativeStrandReadsAssigned:18356697 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804105 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804105-trimmed-pair1.fastq SRR7804105-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,682,789 reads, 18,802,241 reads pseudoaligned [quant] estimated average fragment length: 280.576 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR7804105.ke.tsv 35125 SRR7804105.se.tsv 88098 total ==> SRR7804105.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.92 34.6674 3.16486 PNS24247 1044 764.424 65.0752 5.10537 PNS24249 1928 1648.42 110.571 4.02271 PNS24246 1044 764.424 65.0752 5.10537 PNS24248 1044 764.424 65.0752 5.10537 PNS24244 1471 1191.42 111.536 5.61429 PNS24243 293 77.973 0 0 KQK14069 1603 1323.42 7361.52 333.591 KQK14071 474 214.2 190.028 53.2039 ==> SRR7804105.se.tsv <== BRADI_1g14170v3 7823 BRADI_1g53295v3 819 BRADI_1g59795v3 391 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 175 BRADI_1g74790v3 307 BRADI_1g09890v3 0 BRADI_1g77505v3 462 BRADI_1g48960v3 0 SRR7804105 completed mapping pipeline successfully