Starting /dee2/code/volunteer_pipeline.sh SRR7804106 current disk space = 1541632475136 free memory = 1517840332 SRR7804106 SRAfilesize 6c2f0a140e351ce06b0e3b1b6b2fe12e SRR7804106.sra SRR7804106.sra file validated SRR7804106 is paired end SRR7804106 is conventional basespace SRR7804106 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804106_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2425 37.0 37.0 37.0 37.0 37.0 2 36.24775 37.0 37.0 37.0 37.0 37.0 3 36.3835 37.0 37.0 37.0 37.0 37.0 4 36.5175 37.0 37.0 37.0 37.0 37.0 5 36.588 37.0 37.0 37.0 37.0 37.0 6 36.4405 37.0 37.0 37.0 37.0 37.0 7 36.5035 37.0 37.0 37.0 37.0 37.0 8 36.531 37.0 37.0 37.0 37.0 37.0 9 36.5185 37.0 37.0 37.0 37.0 37.0 10-14 36.5038 37.0 37.0 37.0 37.0 37.0 15-19 36.5093 37.0 37.0 37.0 37.0 37.0 20-24 36.4923 37.0 37.0 37.0 37.0 37.0 25-29 36.4323 37.0 37.0 37.0 37.0 37.0 30-34 36.437 37.0 37.0 37.0 37.0 37.0 35-39 36.3973 37.0 37.0 37.0 37.0 37.0 40-44 36.4311 37.0 37.0 37.0 37.0 37.0 45-49 36.4106 37.0 37.0 37.0 37.0 37.0 50-54 36.33 37.0 37.0 37.0 37.0 37.0 55-59 36.3812 37.0 37.0 37.0 37.0 37.0 60-64 36.2826 37.0 37.0 37.0 37.0 37.0 65-69 36.345600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.194599999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.25320000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1437 37.0 37.0 37.0 37.0 37.0 85-89 36.180899999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.1783 37.0 37.0 37.0 37.0 37.0 95-99 36.108 37.0 37.0 37.0 37.0 37.0 100-104 36.0828 37.0 37.0 37.0 37.0 37.0 105-109 36.0671 37.0 37.0 37.0 37.0 37.0 110-114 36.0013 37.0 37.0 37.0 37.0 37.0 115-119 36.0304 37.0 37.0 37.0 37.0 37.0 120-124 35.9249 37.0 37.0 37.0 37.0 37.0 125-129 35.959700000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.7899 37.0 37.0 37.0 37.0 37.0 135-139 35.844100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.8127 37.0 37.0 37.0 37.0 37.0 145-149 35.7993 37.0 37.0 37.0 37.0 37.0 150-151 35.301249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 5.0 26 4.0 27 8.0 28 13.0 29 21.0 30 22.0 31 52.0 32 52.0 33 90.0 34 135.0 35 365.0 36 2850.0 37 380.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.949999999999996 12.325 7.1 32.625 2 26.67167543200601 13.724017029802155 31.930879038317055 27.67342849987478 3 22.475 18.575 25.724999999999998 33.225 4 28.625 25.2 20.25 25.924999999999997 5 28.075 28.375 21.375 22.175 6 24.474999999999998 31.4 21.0 23.125 7 21.224999999999998 21.775 35.4 21.6 8 22.15 22.0 26.525 29.325000000000003 9 21.925 19.400000000000002 31.275 27.400000000000002 10-14 26.07 23.669999999999998 23.244999999999997 27.015 15-19 25.590000000000003 23.474999999999998 24.115000000000002 26.82 20-24 25.064999999999998 23.885 23.59 27.46 25-29 25.430000000000003 23.95 23.54 27.08 30-34 25.545 23.794999999999998 23.575 27.084999999999997 35-39 25.585 23.585 23.875 26.955000000000002 40-44 25.935000000000002 23.494999999999997 23.29 27.279999999999998 45-49 25.825 23.655 23.405 27.115000000000002 50-54 25.83 23.200000000000003 23.145 27.825 55-59 25.924999999999997 23.549999999999997 23.025000000000002 27.500000000000004 60-64 25.419999999999998 23.815 23.31 27.455000000000002 65-69 25.86 23.32 23.23 27.589999999999996 70-74 25.82 22.785 23.535 27.860000000000003 75-79 26.77 22.98 23.105 27.145000000000003 80-84 25.91 23.799999999999997 22.775000000000002 27.515 85-89 26.355 23.275000000000002 22.85 27.52 90-94 26.605 23.385 22.81 27.200000000000003 95-99 27.48 22.965 22.895 26.66 100-104 26.284999999999997 23.044999999999998 22.830000000000002 27.839999999999996 105-109 26.745 22.814999999999998 22.855 27.584999999999997 110-114 26.424999999999997 22.965 23.085 27.525 115-119 26.825 22.6 23.34 27.235 120-124 27.284999999999997 22.355 22.395 27.965 125-129 27.215 22.825 23.064999999999998 26.895000000000003 130-134 26.775 22.665 22.775000000000002 27.785 135-139 27.36 22.925 22.81 26.905 140-144 26.455000000000002 22.465 23.599999999999998 27.48 145-149 27.060000000000002 22.56 22.91 27.47 150-151 26.7625 22.125 22.7375 28.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 2.0 25 3.0 26 1.0 27 1.5 28 2.5 29 3.0 30 3.5 31 2.0 32 7.0 33 14.5 34 17.5 35 24.5 36 34.0 37 44.0 38 58.5 39 72.5 40 85.5 41 104.0 42 126.5 43 132.0 44 131.5 45 144.0 46 157.5 47 160.5 48 158.5 49 150.0 50 133.5 51 120.0 52 111.0 53 103.0 54 98.0 55 95.5 56 89.0 57 94.0 58 106.5 59 108.0 60 109.0 61 102.5 62 90.5 63 92.0 64 104.0 65 106.0 66 94.5 67 88.0 68 84.5 69 75.5 70 63.5 71 55.0 72 53.0 73 44.0 74 38.5 75 35.5 76 21.5 77 15.5 78 10.5 79 5.0 80 3.5 81 2.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.906333155934 88.225 2 5.774348057477382 10.85 3 0.2927088877062267 0.8250000000000001 4 0.026609898882384245 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.8625 0.0 0.0 0.0 0.0 134-135 2.05 0.0 0.0 0.0 0.0 136-137 2.225 0.0 0.0 0.0 0.0 138-139 2.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 95-99 >>END_MODULE SRR7804106 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804106_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.37225 37.0 37.0 37.0 37.0 37.0 2 36.0095 37.0 37.0 37.0 37.0 37.0 3 36.041 37.0 37.0 37.0 37.0 37.0 4 36.0705 37.0 37.0 37.0 37.0 37.0 5 36.015 37.0 37.0 37.0 37.0 37.0 6 36.092 37.0 37.0 37.0 37.0 37.0 7 35.9595 37.0 37.0 37.0 37.0 37.0 8 36.1945 37.0 37.0 37.0 37.0 37.0 9 35.9975 37.0 37.0 37.0 37.0 37.0 10-14 35.9929 37.0 37.0 37.0 37.0 37.0 15-19 35.8821 37.0 37.0 37.0 37.0 37.0 20-24 35.8943 37.0 37.0 37.0 37.0 37.0 25-29 35.8726 37.0 37.0 37.0 37.0 37.0 30-34 35.8428 37.0 37.0 37.0 37.0 37.0 35-39 35.828700000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.761399999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.7219 37.0 37.0 37.0 37.0 37.0 50-54 35.6622 37.0 37.0 37.0 37.0 37.0 55-59 35.6724 37.0 37.0 37.0 37.0 37.0 60-64 35.6399 37.0 37.0 37.0 37.0 37.0 65-69 35.5883 37.0 37.0 37.0 37.0 37.0 70-74 35.539300000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.4915 37.0 37.0 37.0 37.0 37.0 80-84 35.5723 37.0 37.0 37.0 37.0 37.0 85-89 35.5489 37.0 37.0 37.0 37.0 37.0 90-94 35.527699999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.4418 37.0 37.0 37.0 37.0 37.0 100-104 35.452000000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.3745 37.0 37.0 37.0 37.0 37.0 110-114 35.2587 37.0 37.0 37.0 32.2 37.0 115-119 35.2558 37.0 37.0 37.0 37.0 37.0 120-124 35.2553 37.0 37.0 37.0 37.0 37.0 125-129 35.1837 37.0 37.0 37.0 34.6 37.0 130-134 35.250899999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.085699999999996 37.0 37.0 37.0 27.4 37.0 140-144 35.1383 37.0 37.0 37.0 29.8 37.0 145-149 34.9009 37.0 37.0 37.0 25.0 37.0 150-151 34.3905 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 15.0 14 19.0 15 10.0 16 8.0 17 2.0 18 2.0 19 5.0 20 6.0 21 16.0 22 8.0 23 12.0 24 12.0 25 5.0 26 10.0 27 12.0 28 16.0 29 20.0 30 23.0 31 40.0 32 59.0 33 102.0 34 172.0 35 515.0 36 2631.0 37 280.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.26106526631658 17.879469867466867 7.351837959489872 30.50762690672668 2 31.15 21.125 23.075000000000003 24.65 3 26.900000000000002 23.799999999999997 24.6 24.7 4 28.1 28.599999999999998 17.625 25.674999999999997 5 28.7 29.075 18.725 23.5 6 26.325 32.5 17.25 23.925 7 25.874999999999996 18.75 29.675 25.7 8 25.575 21.725 20.625 32.074999999999996 9 25.7 21.4 24.15 28.749999999999996 10-14 28.494999999999997 23.89 20.105 27.51 15-19 27.92 23.419999999999998 21.46 27.200000000000003 20-24 28.02 23.41 21.525 27.045 25-29 28.439999999999998 23.71 20.79 27.060000000000002 30-34 27.800000000000004 23.985 21.29 26.924999999999997 35-39 27.815 23.955000000000002 20.974999999999998 27.255000000000003 40-44 28.22 23.535 21.615000000000002 26.63 45-49 28.084999999999997 23.375 21.705 26.834999999999997 50-54 28.000000000000004 23.419999999999998 20.835 27.744999999999997 55-59 27.744999999999997 23.075000000000003 21.495 27.685 60-64 27.465 23.11 21.715 27.71 65-69 27.200000000000003 23.35 21.305 28.144999999999996 70-74 27.284999999999997 22.994999999999997 21.43 28.29 75-79 27.500000000000004 22.975 21.67 27.855 80-84 27.625 22.81 21.705 27.860000000000003 85-89 27.275 23.169999999999998 21.3 28.255000000000003 90-94 28.055000000000003 22.78 21.490000000000002 27.675 95-99 27.689999999999998 23.39 21.65 27.27 100-104 28.46 23.26 21.41 26.87 105-109 28.189999999999998 23.369999999999997 21.025 27.415 110-114 27.91 23.345 21.375 27.37 115-119 28.525 22.835 21.385 27.255000000000003 120-124 27.439999999999998 23.54 21.97 27.05 125-129 28.08 23.655 21.32 26.945000000000004 130-134 28.87 23.305 21.22 26.605 135-139 28.165000000000003 23.645 21.490000000000002 26.700000000000003 140-144 28.144999999999996 23.905 21.675 26.275 145-149 28.560000000000002 23.74 21.455 26.245 150-151 27.700000000000003 25.162499999999998 21.4875 25.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.5 24 2.5 25 1.0 26 0.5 27 1.0 28 1.5 29 2.0 30 3.0 31 4.5 32 6.0 33 7.0 34 11.0 35 16.5 36 20.5 37 31.0 38 36.0 39 49.5 40 74.5 41 79.5 42 85.5 43 109.5 44 119.5 45 124.0 46 136.0 47 128.0 48 125.5 49 127.5 50 115.5 51 112.5 52 114.0 53 111.0 54 112.0 55 114.0 56 102.0 57 94.0 58 111.0 59 118.5 60 118.0 61 121.5 62 131.5 63 144.5 64 131.0 65 104.0 66 90.0 67 94.5 68 98.0 69 87.5 70 83.0 71 70.5 72 57.0 73 55.0 74 44.5 75 32.0 76 28.5 77 24.0 78 14.5 79 12.0 80 8.0 81 2.5 82 1.0 83 1.0 84 1.0 85 2.0 86 2.5 87 2.0 88 1.5 89 0.5 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 93.33874898456538 86.175 2 6.011372867587327 11.1 3 0.37909558624424583 1.05 4 0.1083130246412131 0.4 5 0.08123476848090982 0.375 6 0.027078256160303276 0.15 7 0.0 0.0 8 0.027078256160303276 0.2 9 0.0 0.0 >10 0.027078256160303276 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 8 0.2 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit AAACGATCTAGTGCAGCAGCAGCTTGCTCTCTCCTCCATCTAGTAGAAGA 5 0.125 No Hit CAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCG 5 0.125 No Hit CTTCAGTTCTCACTCCACAGCTCAGAGTCAAGAGCTACTAGCAATGGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5375 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.8374999999999999 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.4874999999999998 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.1500000000000004 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138-139 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACGGGC 10 0.006830828 145.0 145 CATACAA 10 0.006830828 145.0 5 >>END_MODULE Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405547 spots for SRR7804106.sra Written 1405547 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra Read 1405533 spots for SRR7804106.sra Written 1405533 spots for SRR7804106.sra SRR ids: ['SRR7804106.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fpboh63y SRR7804106.sra spots: 28110674 blocks: [[1, 1405533], [1405534, 2811066], [2811067, 4216599], [4216600, 5622132], [5622133, 7027665], [7027666, 8433198], [8433199, 9838731], [9838732, 11244264], [11244265, 12649797], [12649798, 14055330], [14055331, 15460863], [15460864, 16866396], [16866397, 18271929], [18271930, 19677462], [19677463, 21082995], [21082996, 22488528], [22488529, 23894061], [23894062, 25299594], [25299595, 26705127], [26705128, 28110674]] SRR7804106 file size 9504084 SRR7804106 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804106 SRR7804106_1.fastq SRR7804106_2.fastq Input file: SRR7804106_1.fastq Paired file: SRR7804106_2.fastq trimmed: SRR7804106-trimmed-pair1.fastq, SRR7804106-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:00:40 2024 >> started Sat Dec 7 17:01:12 2024 >> done (32.114s) 28110674 read pairs processed; of these: 113 ( 0.00%) short read pairs filtered out after trimming by size control 610 ( 0.00%) empty read pairs filtered out after trimming by size control 28109951 (100.00%) read pairs available; of these: 1036452 ( 3.69%) trimmed read pairs available after processing 27073499 (96.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 11 0.00% 20 19 0.00% 21 10 0.00% 22 22 0.00% 23 20 0.00% 24 21 0.00% 25 26 0.00% 26 14 0.00% 27 21 0.00% 28 26 0.00% 29 30 0.00% 30 19 0.00% 31 32 0.00% 32 37 0.00% 33 22 0.00% 34 27 0.00% 35 35 0.00% 36 35 0.00% 37 38 0.00% 38 36 0.00% 39 44 0.00% 40 40 0.00% 41 41 0.00% 42 53 0.00% 43 43 0.00% 44 47 0.00% 45 41 0.00% 46 61 0.00% 47 38 0.00% 48 49 0.00% 49 51 0.00% 50 44 0.00% 51 69 0.00% 52 62 0.00% 53 55 0.00% 54 68 0.00% 55 73 0.00% 56 69 0.00% 57 82 0.00% 58 85 0.00% 59 95 0.00% 60 88 0.00% 61 100 0.00% 62 123 0.00% 63 99 0.00% 64 139 0.00% 65 125 0.00% 66 147 0.00% 67 144 0.00% 68 153 0.00% 69 181 0.00% 70 173 0.00% 71 215 0.00% 72 284 0.00% 73 307 0.00% 74 313 0.00% 75 379 0.00% 76 372 0.00% 77 404 0.00% 78 471 0.00% 79 491 0.00% 80 567 0.00% 81 677 0.00% 82 756 0.00% 83 870 0.00% 84 920 0.00% 85 1118 0.00% 86 1184 0.00% 87 1199 0.00% 88 1366 0.00% 89 1591 0.01% 90 1699 0.01% 91 1910 0.01% 92 2111 0.01% 93 2379 0.01% 94 2639 0.01% 95 2791 0.01% 96 2985 0.01% 97 3332 0.01% 98 3540 0.01% 99 3669 0.01% 100 3992 0.01% 101 4484 0.02% 102 4829 0.02% 103 5273 0.02% 104 5724 0.02% 105 6184 0.02% 106 6283 0.02% 107 6632 0.02% 108 6961 0.02% 109 7537 0.03% 110 7844 0.03% 111 8390 0.03% 112 9042 0.03% 113 9682 0.03% 114 10435 0.04% 115 10957 0.04% 116 11480 0.04% 117 11817 0.04% 118 12393 0.04% 119 12781 0.05% 120 13303 0.05% 121 14054 0.05% 122 14908 0.05% 123 15865 0.06% 124 16873 0.06% 125 17921 0.06% 126 18256 0.06% 127 18997 0.07% 128 19549 0.07% 129 20554 0.07% 130 20775 0.07% 131 21534 0.08% 132 22588 0.08% 133 24266 0.09% 134 25125 0.09% 135 26577 0.09% 136 27331 0.10% 137 27723 0.10% 138 28880 0.10% 139 29881 0.11% 140 30307 0.11% 141 31129 0.11% 142 32773 0.12% 143 33824 0.12% 144 35794 0.13% 145 37633 0.13% 146 38485 0.14% 147 39860 0.14% 148 40799 0.15% 149 41540 0.15% 150 42891 0.15% 151 27073499 96.31% 28109951 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=19 prefix-density=0.95 prefix-fanout=2.9 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGAT criterion=fanout-score sequence-density=0.28 sequence-density-rank=33 fanout-score=13.17 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=4.5 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=11 prefix-density=1.21 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGACGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=27.25 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.4 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804106 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:02:07 Started mapping on | Dec 07 17:02:07 Finished on | Dec 07 17:06:28 Mapping speed, Million of reads per hour | 387.72 Number of input reads | 28109951 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25725407 Uniquely mapped reads % | 91.52% Average mapped length | 299.32 Number of splices: Total | 24437767 Number of splices: Annotated (sjdb) | 23199246 Number of splices: GT/AG | 24101270 Number of splices: GC/AG | 274641 Number of splices: AT/AC | 7864 Number of splices: Non-canonical | 53992 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295316 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 18390 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.84% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2089228 2089228 2089228 N_multimapping 295316 295316 295316 N_noFeature 537186 25030482 715789 N_ambiguous 647964 3678 132364 UnstrandedReadsAssigned:24540257 PositiveStrandReadsAssigned:691247 NegativeStrandReadsAssigned:24877254 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804106 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804106-trimmed-pair1.fastq SRR7804106-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,109,951 reads, 25,346,612 reads pseudoaligned [quant] estimated average fragment length: 292.616 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52973 SRR7804106.ke.tsv 35125 SRR7804106.se.tsv 88098 total ==> SRR7804106.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 644.826 0 0 PNS24247 1044 752.384 59.5437 3.97017 PNS24249 1928 1636.38 116.962 3.5857 PNS24246 1044 752.384 59.5437 3.97017 PNS24248 1044 752.384 59.5437 3.97017 PNS24244 1471 1179.38 77.4065 3.29257 PNS24243 293 78.8534 0 0 KQK14069 1603 1311.38 5133.9 196.395 KQK14071 474 209.944 90.822 21.702 ==> SRR7804106.se.tsv <== BRADI_1g14170v3 5406 BRADI_1g53295v3 1121 BRADI_1g59795v3 335 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1433 BRADI_1g74790v3 964 BRADI_1g09890v3 14 BRADI_1g77505v3 224 BRADI_1g48960v3 0 SRR7804106 completed mapping pipeline successfully