Starting /dee2/code/volunteer_pipeline.sh SRR7804107 current disk space = 1523723087872 free memory = 1565024876 SRR7804107 SRAfilesize b0cb90a70effa9cdae547256354b2dfb SRR7804107.sra SRR7804107.sra file validated SRR7804107 is paired end SRR7804107 is conventional basespace SRR7804107 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804107_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.229 37.0 37.0 37.0 37.0 37.0 2 36.12775 37.0 37.0 37.0 37.0 37.0 3 36.329 37.0 37.0 37.0 37.0 37.0 4 36.453 37.0 37.0 37.0 37.0 37.0 5 36.442 37.0 37.0 37.0 37.0 37.0 6 36.3935 37.0 37.0 37.0 37.0 37.0 7 36.371 37.0 37.0 37.0 37.0 37.0 8 36.4475 37.0 37.0 37.0 37.0 37.0 9 36.478 37.0 37.0 37.0 37.0 37.0 10-14 36.4914 37.0 37.0 37.0 37.0 37.0 15-19 36.4615 37.0 37.0 37.0 37.0 37.0 20-24 36.415800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.375 37.0 37.0 37.0 37.0 37.0 30-34 36.3896 37.0 37.0 37.0 37.0 37.0 35-39 36.3525 37.0 37.0 37.0 37.0 37.0 40-44 36.3709 37.0 37.0 37.0 37.0 37.0 45-49 36.352 37.0 37.0 37.0 37.0 37.0 50-54 36.2737 37.0 37.0 37.0 37.0 37.0 55-59 36.319100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.31320000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.281600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.233000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.1917 37.0 37.0 37.0 37.0 37.0 80-84 36.1839 37.0 37.0 37.0 37.0 37.0 85-89 36.11319999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.136300000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.115300000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.11750000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.02969999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.0604 37.0 37.0 37.0 37.0 37.0 115-119 36.027499999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.978899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.8471 37.0 37.0 37.0 37.0 37.0 130-134 35.8799 37.0 37.0 37.0 37.0 37.0 135-139 35.908100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.8035 37.0 37.0 37.0 37.0 37.0 145-149 35.7269 37.0 37.0 37.0 37.0 37.0 150-151 35.1555 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 0.0 25 3.0 26 7.0 27 8.0 28 16.0 29 30.0 30 33.0 31 42.0 32 64.0 33 81.0 34 154.0 35 302.0 36 2850.0 37 407.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.2 12.525 8.200000000000001 33.074999999999996 2 26.93173293323331 12.653163290822706 31.282820705176295 29.132283070767688 3 22.75 17.925 24.5 34.825 4 28.249999999999996 22.825 20.8 28.125 5 27.1 26.924999999999997 22.025 23.95 6 25.025 29.349999999999998 21.55 24.075 7 21.25 22.6 35.225 20.925 8 22.35 22.400000000000002 27.675 27.575 9 21.275 21.55 29.599999999999998 27.575 10-14 25.419999999999998 24.235 23.655 26.69 15-19 25.19 23.805 24.265 26.740000000000002 20-24 25.080000000000002 23.49 24.224999999999998 27.205000000000002 25-29 25.25 23.645 23.91 27.195000000000004 30-34 24.735 23.98 23.794999999999998 27.49 35-39 25.535000000000004 23.53 23.195 27.74 40-44 26.055 23.195 23.595 27.155 45-49 25.424999999999997 22.939999999999998 24.175 27.46 50-54 25.64 23.3 24.355 26.705000000000002 55-59 25.46 23.225 23.7 27.615000000000002 60-64 25.540000000000003 23.39 23.71 27.36 65-69 25.755 23.09 23.405 27.750000000000004 70-74 26.419999999999998 23.145 23.53 26.905 75-79 26.415 23.25 23.125 27.21 80-84 26.584999999999997 23.23 23.369999999999997 26.815 85-89 26.08 23.345 23.325000000000003 27.250000000000004 90-94 26.284999999999997 23.35 22.96 27.405 95-99 26.39 23.49 23.03 27.089999999999996 100-104 26.445 22.875 23.21 27.47 105-109 26.805 22.919999999999998 22.96 27.315 110-114 25.95 23.11 23.674999999999997 27.265 115-119 26.86 22.42 23.23 27.49 120-124 26.325 22.005 23.845 27.825 125-129 26.265 22.305 23.34 28.09 130-134 27.295 22.32 23.400000000000002 26.985 135-139 26.884999999999998 22.634999999999998 23.325000000000003 27.155 140-144 26.450000000000003 22.770000000000003 23.54 27.24 145-149 26.729999999999997 22.67 22.93 27.67 150-151 26.25 22.7375 22.6375 28.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 1.5 28 1.5 29 2.5 30 5.0 31 8.5 32 12.5 33 15.0 34 13.0 35 19.0 36 37.5 37 50.5 38 57.5 39 63.0 40 82.0 41 99.0 42 110.5 43 138.5 44 152.5 45 154.5 46 158.0 47 159.5 48 151.0 49 138.5 50 131.0 51 129.0 52 132.0 53 122.5 54 96.5 55 88.5 56 100.5 57 107.5 58 106.5 59 103.0 60 106.0 61 107.0 62 105.5 63 96.0 64 86.5 65 94.0 66 103.0 67 91.0 68 73.5 69 67.5 70 63.0 71 52.0 72 41.5 73 33.5 74 30.0 75 28.5 76 22.0 77 13.5 78 9.0 79 9.0 80 6.0 81 3.5 82 2.0 83 1.5 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.52941176470588 87.45 2 6.06951871657754 11.35 3 0.34759358288770054 0.975 4 0.026737967914438502 0.1 5 0.026737967914438502 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTGCGTATTACGGGACATGTTTTTAAGAATTGCAGCTACAAGTTGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6625000000000001 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.4375 0.0 0.0 0.0 0.0 132-133 1.525 0.0 0.0 0.0 0.0 134-135 1.65 0.0 0.0 0.0 0.0 136-137 1.7625000000000002 0.0 0.0 0.0 0.0 138-139 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 25 4.977651E-4 29.0 75-79 >>END_MODULE SRR7804107 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804107_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3475 37.0 37.0 37.0 37.0 37.0 2 36.1265 37.0 37.0 37.0 37.0 37.0 3 36.1485 37.0 37.0 37.0 37.0 37.0 4 36.1555 37.0 37.0 37.0 37.0 37.0 5 36.217 37.0 37.0 37.0 37.0 37.0 6 36.214 37.0 37.0 37.0 37.0 37.0 7 36.156 37.0 37.0 37.0 37.0 37.0 8 36.1875 37.0 37.0 37.0 37.0 37.0 9 35.997 37.0 37.0 37.0 37.0 37.0 10-14 36.107299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.0448 37.0 37.0 37.0 37.0 37.0 20-24 36.021100000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.9984 37.0 37.0 37.0 37.0 37.0 30-34 35.967600000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.948899999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.9197 37.0 37.0 37.0 37.0 37.0 45-49 35.855399999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.8037 37.0 37.0 37.0 37.0 37.0 55-59 35.796400000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.7834 37.0 37.0 37.0 37.0 37.0 65-69 35.7553 37.0 37.0 37.0 37.0 37.0 70-74 35.808299999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.758300000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.669500000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.6975 37.0 37.0 37.0 37.0 37.0 90-94 35.58540000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.594300000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.610200000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.580799999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.3848 37.0 37.0 37.0 37.0 37.0 115-119 35.3931 37.0 37.0 37.0 37.0 37.0 120-124 35.414199999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.300200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.339999999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.2612 37.0 37.0 37.0 37.0 37.0 140-144 35.2859 37.0 37.0 37.0 37.0 37.0 145-149 35.0383 37.0 37.0 37.0 25.0 37.0 150-151 34.6095 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 8.0 15 11.0 16 4.0 17 4.0 18 6.0 19 4.0 20 4.0 21 9.0 22 14.0 23 10.0 24 12.0 25 10.0 26 14.0 27 16.0 28 14.0 29 26.0 30 20.0 31 37.0 32 41.0 33 93.0 34 168.0 35 424.0 36 2747.0 37 296.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.55 17.625 9.85 30.975 2 31.95 21.45 22.95 23.65 3 25.7 24.45 24.05 25.8 4 27.85 30.0 18.9 23.25 5 29.5 29.599999999999998 18.675 22.225 6 26.6 31.474999999999998 18.425 23.5 7 25.874999999999996 17.849999999999998 30.425 25.85 8 26.275 21.325 21.025 31.374999999999996 9 25.75 22.5 23.0 28.749999999999996 10-14 27.700000000000003 23.835 21.26 27.205000000000002 15-19 27.534999999999997 23.645 21.525 27.295 20-24 27.97 24.015 21.27 26.745 25-29 27.845 23.935000000000002 21.6 26.619999999999997 30-34 27.150000000000002 23.71 21.64 27.500000000000004 35-39 27.935 23.95 21.41 26.705000000000002 40-44 28.050000000000004 23.95 21.34 26.66 45-49 27.37 23.325000000000003 21.89 27.415 50-54 27.884999999999998 23.34 21.43 27.345000000000002 55-59 28.035 22.939999999999998 21.545 27.48 60-64 27.02 23.69 21.69 27.6 65-69 27.755000000000003 23.31 21.759999999999998 27.175 70-74 27.265 23.31 21.515 27.91 75-79 27.860000000000003 23.485 21.17 27.485 80-84 27.505000000000003 23.41 21.77 27.315 85-89 27.42 23.555 21.065 27.96 90-94 27.450000000000003 23.669999999999998 21.75 27.13 95-99 27.33 23.815 21.615000000000002 27.24 100-104 27.935 23.22 21.51 27.334999999999997 105-109 27.560000000000002 23.7 21.535 27.205000000000002 110-114 27.72 23.14 21.790000000000003 27.35 115-119 27.88 23.625 21.42 27.075 120-124 27.779999999999998 23.79 21.560000000000002 26.87 125-129 27.155 23.925 21.85 27.07 130-134 28.43 24.005000000000003 21.025 26.540000000000003 135-139 28.04 23.655 22.035 26.27 140-144 28.349999999999998 24.01 21.595 26.045 145-149 27.474999999999998 23.86 22.0 26.665 150-151 27.900000000000002 24.725 21.2 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 0.5 20 1.5 21 3.5 22 2.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 2.5 29 3.5 30 3.0 31 4.0 32 7.0 33 8.5 34 13.5 35 18.0 36 20.0 37 30.5 38 42.5 39 58.5 40 86.0 41 99.5 42 95.5 43 99.0 44 106.0 45 118.5 46 133.0 47 132.0 48 142.5 49 137.0 50 111.5 51 100.5 52 105.5 53 111.5 54 114.0 55 111.0 56 97.0 57 108.0 58 116.0 59 121.0 60 127.5 61 119.5 62 112.5 63 115.5 64 107.0 65 98.5 66 104.5 67 105.5 68 102.0 69 95.0 70 81.0 71 65.0 72 65.0 73 54.0 74 45.5 75 36.5 76 16.0 77 13.5 78 12.5 79 7.5 80 6.5 81 3.5 82 2.0 83 2.5 84 2.0 85 2.0 86 1.5 87 1.5 88 1.5 89 0.5 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.5 96 0.5 97 1.0 98 1.0 99 0.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.3621154883972 86.5 2 5.963302752293578 11.05 3 0.48569886670264434 1.35 4 0.08094981111710739 0.3 5 0.053966540744738264 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026983270372369132 0.22499999999999998 >10 0.026983270372369132 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 9 0.22499999999999998 No Hit GGTATTGGCACTTCAGAAAAGGGTGCTGACTGTTCTGAATGAGGCCAGGC 5 0.125 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.2625 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.5 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.7374999999999998 0.0 0.0 0.0 0.0 138-139 1.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGGGC 10 0.006830828 145.0 8 ACCCCGA 10 0.006830828 145.0 4 ATCGAGG 10 0.006830828 145.0 6 TCGAGGG 10 0.006830828 145.0 7 CTATCTC 10 0.006830828 145.0 2 >>END_MODULE Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133123 spots for SRR7804107.sra Written 1133123 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra Read 1133122 spots for SRR7804107.sra Written 1133122 spots for SRR7804107.sra SRR ids: ['SRR7804107.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1o0enbi9 SRR7804107.sra spots: 22662441 blocks: [[1, 1133122], [1133123, 2266244], [2266245, 3399366], [3399367, 4532488], [4532489, 5665610], [5665611, 6798732], [6798733, 7931854], [7931855, 9064976], [9064977, 10198098], [10198099, 11331220], [11331221, 12464342], [12464343, 13597464], [13597465, 14730586], [14730587, 15863708], [15863709, 16996830], [16996831, 18129952], [18129953, 19263074], [19263075, 20396196], [20396197, 21529318], [21529319, 22662441]] SRR7804107 file size 7657857 SRR7804107 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804107 SRR7804107_1.fastq SRR7804107_2.fastq Input file: SRR7804107_1.fastq Paired file: SRR7804107_2.fastq trimmed: SRR7804107-trimmed-pair1.fastq, SRR7804107-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:47:12 2024 >> started Tue Dec 10 01:47:40 2024 >> done (27.706s) 22662441 read pairs processed; of these: 81 ( 0.00%) short read pairs filtered out after trimming by size control 628 ( 0.00%) empty read pairs filtered out after trimming by size control 22661732 (100.00%) read pairs available; of these: 775611 ( 3.42%) trimmed read pairs available after processing 21886121 (96.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 16 0.00% 20 10 0.00% 21 14 0.00% 22 9 0.00% 23 12 0.00% 24 14 0.00% 25 15 0.00% 26 18 0.00% 27 11 0.00% 28 14 0.00% 29 16 0.00% 30 19 0.00% 31 16 0.00% 32 23 0.00% 33 7 0.00% 34 18 0.00% 35 26 0.00% 36 20 0.00% 37 22 0.00% 38 24 0.00% 39 26 0.00% 40 14 0.00% 41 24 0.00% 42 23 0.00% 43 25 0.00% 44 30 0.00% 45 21 0.00% 46 29 0.00% 47 27 0.00% 48 18 0.00% 49 27 0.00% 50 32 0.00% 51 32 0.00% 52 42 0.00% 53 32 0.00% 54 39 0.00% 55 29 0.00% 56 36 0.00% 57 51 0.00% 58 46 0.00% 59 48 0.00% 60 50 0.00% 61 56 0.00% 62 53 0.00% 63 58 0.00% 64 49 0.00% 65 74 0.00% 66 68 0.00% 67 73 0.00% 68 84 0.00% 69 103 0.00% 70 92 0.00% 71 110 0.00% 72 104 0.00% 73 144 0.00% 74 140 0.00% 75 179 0.00% 76 185 0.00% 77 219 0.00% 78 267 0.00% 79 286 0.00% 80 282 0.00% 81 345 0.00% 82 418 0.00% 83 456 0.00% 84 485 0.00% 85 537 0.00% 86 590 0.00% 87 737 0.00% 88 786 0.00% 89 896 0.00% 90 969 0.00% 91 1080 0.00% 92 1167 0.01% 93 1414 0.01% 94 1514 0.01% 95 1667 0.01% 96 1902 0.01% 97 2107 0.01% 98 2246 0.01% 99 2314 0.01% 100 2619 0.01% 101 2640 0.01% 102 3097 0.01% 103 3442 0.02% 104 3703 0.02% 105 4048 0.02% 106 4191 0.02% 107 4402 0.02% 108 4658 0.02% 109 5020 0.02% 110 5217 0.02% 111 5849 0.03% 112 6307 0.03% 113 6605 0.03% 114 7313 0.03% 115 7658 0.03% 116 8023 0.04% 117 8510 0.04% 118 8906 0.04% 119 9239 0.04% 120 9882 0.04% 121 10419 0.05% 122 10712 0.05% 123 11476 0.05% 124 12292 0.05% 125 13111 0.06% 126 13475 0.06% 127 14512 0.06% 128 14747 0.07% 129 15088 0.07% 130 15703 0.07% 131 16743 0.07% 132 17464 0.08% 133 18068 0.08% 134 19412 0.09% 135 19845 0.09% 136 20701 0.09% 137 21388 0.09% 138 22394 0.10% 139 22686 0.10% 140 23734 0.10% 141 24593 0.11% 142 25914 0.11% 143 27147 0.12% 144 28168 0.12% 145 29408 0.13% 146 29980 0.13% 147 31047 0.14% 148 32214 0.14% 149 32851 0.14% 150 33699 0.15% 151 21886121 96.58% 22661732 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=19 prefix-density=0.83 prefix-fanout=2.9 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=18.73 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.6 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=14 prefix-density=1.02 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGACGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=46.01 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.7 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804107 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:48:35 Started mapping on | Dec 10 01:48:36 Finished on | Dec 10 01:52:08 Mapping speed, Million of reads per hour | 384.82 Number of input reads | 22661732 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20780813 Uniquely mapped reads % | 91.70% Average mapped length | 299.55 Number of splices: Total | 21032549 Number of splices: Annotated (sjdb) | 19895779 Number of splices: GT/AG | 20722450 Number of splices: GC/AG | 255742 Number of splices: AT/AC | 7498 Number of splices: Non-canonical | 46859 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330858 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 22851 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.93% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1550061 1550061 1550061 N_multimapping 330858 330858 330858 N_noFeature 625980 20198579 758403 N_ambiguous 564979 3799 115633 UnstrandedReadsAssigned:19589854 PositiveStrandReadsAssigned:578435 NegativeStrandReadsAssigned:19906777 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804107 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804107-trimmed-pair1.fastq SRR7804107-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,661,732 reads, 20,189,648 reads pseudoaligned [quant] estimated average fragment length: 294.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52973 SRR7804107.ke.tsv 35125 SRR7804107.se.tsv 88098 total ==> SRR7804107.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 642.87 0 0 PNS24247 1044 750.421 61.9772 5.01312 PNS24249 1928 1634.42 133.221 4.94754 PNS24246 1044 750.421 61.9772 5.01312 PNS24248 1044 750.421 61.9772 5.01312 PNS24244 1471 1177.42 37.8474 1.95113 PNS24243 293 76.4957 0 0 KQK14069 1603 1309.42 16097.6 746.213 KQK14071 474 206.572 211.483 62.1419 ==> SRR7804107.se.tsv <== BRADI_1g14170v3 16935 BRADI_1g53295v3 688 BRADI_1g59795v3 255 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1106 BRADI_1g74790v3 656 BRADI_1g09890v3 6 BRADI_1g77505v3 263 BRADI_1g48960v3 0 SRR7804107 completed mapping pipeline successfully