Starting /dee2/code/volunteer_pipeline.sh SRR7804108 current disk space = 1541457223680 free memory = 1445127376 SRR7804108 SRAfilesize 470d5634b5780fe7f2c79461a30efa0b SRR7804108.sra SRR7804108.sra file validated SRR7804108 is paired end SRR7804108 is conventional basespace SRR7804108 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804108_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2245 37.0 37.0 37.0 37.0 37.0 2 36.121 37.0 37.0 37.0 37.0 37.0 3 36.3345 37.0 37.0 37.0 37.0 37.0 4 36.398 37.0 37.0 37.0 37.0 37.0 5 36.451 37.0 37.0 37.0 37.0 37.0 6 36.415 37.0 37.0 37.0 37.0 37.0 7 36.3535 37.0 37.0 37.0 37.0 37.0 8 36.473 37.0 37.0 37.0 37.0 37.0 9 36.4165 37.0 37.0 37.0 37.0 37.0 10-14 36.476 37.0 37.0 37.0 37.0 37.0 15-19 36.4611 37.0 37.0 37.0 37.0 37.0 20-24 36.4271 37.0 37.0 37.0 37.0 37.0 25-29 36.3963 37.0 37.0 37.0 37.0 37.0 30-34 36.373599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.39470000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.39030000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.31 37.0 37.0 37.0 37.0 37.0 50-54 36.3275 37.0 37.0 37.0 37.0 37.0 55-59 36.3094 37.0 37.0 37.0 37.0 37.0 60-64 36.273900000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2256 37.0 37.0 37.0 37.0 37.0 70-74 36.185500000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2063 37.0 37.0 37.0 37.0 37.0 80-84 36.1811 37.0 37.0 37.0 37.0 37.0 85-89 36.1449 37.0 37.0 37.0 37.0 37.0 90-94 36.1409 37.0 37.0 37.0 37.0 37.0 95-99 36.086 37.0 37.0 37.0 37.0 37.0 100-104 36.0989 37.0 37.0 37.0 37.0 37.0 105-109 35.9335 37.0 37.0 37.0 37.0 37.0 110-114 36.0599 37.0 37.0 37.0 37.0 37.0 115-119 35.9939 37.0 37.0 37.0 37.0 37.0 120-124 35.8822 37.0 37.0 37.0 37.0 37.0 125-129 35.852199999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.731 37.0 37.0 37.0 37.0 37.0 135-139 35.7842 37.0 37.0 37.0 37.0 37.0 140-144 35.6742 37.0 37.0 37.0 37.0 37.0 145-149 35.6945 37.0 37.0 37.0 37.0 37.0 150-151 35.05775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 0.0 24 2.0 25 4.0 26 2.0 27 12.0 28 16.0 29 18.0 30 35.0 31 59.0 32 71.0 33 77.0 34 141.0 35 346.0 36 2820.0 37 394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.725 12.35 7.2749999999999995 34.65 2 26.263131565782892 13.606803401700851 31.96598299149575 28.16408204102051 3 23.825 18.975 24.975 32.225 4 26.950000000000003 26.1 20.775 26.174999999999997 5 26.6 30.0 20.8 22.6 6 24.4 30.75 22.075 22.775000000000002 7 20.0 21.4 36.775000000000006 21.825 8 21.675 23.150000000000002 26.875 28.299999999999997 9 21.375 21.075 30.9 26.650000000000002 10-14 24.42 24.98 23.98 26.619999999999997 15-19 24.9 23.9 24.77 26.43 20-24 24.18 24.395 24.72 26.705000000000002 25-29 24.815 24.29 24.445 26.450000000000003 30-34 25.05 24.095 24.43 26.424999999999997 35-39 24.57 24.63 24.18 26.619999999999997 40-44 24.985 24.044999999999998 24.15 26.82 45-49 24.8 23.925 24.275 27.0 50-54 25.335 24.005000000000003 23.265 27.395000000000003 55-59 24.97 23.74 24.04 27.250000000000004 60-64 25.11 24.275 23.515 27.1 65-69 25.119999999999997 23.985 24.52 26.375 70-74 25.290000000000003 23.74 24.275 26.695 75-79 25.585 23.79 23.405 27.22 80-84 26.69 23.26 23.630000000000003 26.419999999999998 85-89 25.615 23.585 23.49 27.310000000000002 90-94 25.995 23.865 24.075 26.064999999999998 95-99 26.35 23.415 23.669999999999998 26.565 100-104 25.44 23.785 23.630000000000003 27.145000000000003 105-109 25.619999999999997 23.175 23.74 27.465 110-114 25.21 23.775 23.77 27.245 115-119 25.235000000000003 23.53 23.580000000000002 27.655 120-124 26.029999999999998 23.25 23.665 27.055 125-129 25.27 23.119999999999997 23.880000000000003 27.73 130-134 26.174999999999997 23.73 23.35 26.745 135-139 25.85 22.74 23.995 27.415 140-144 25.935000000000002 23.16 23.415 27.49 145-149 26.279999999999998 22.965 23.9 26.855 150-151 26.075 22.537499999999998 24.212500000000002 27.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 2.0 27 3.0 28 4.0 29 4.5 30 2.0 31 4.5 32 10.5 33 16.0 34 23.0 35 30.0 36 42.5 37 53.0 38 61.5 39 73.0 40 98.5 41 133.0 42 140.0 43 141.5 44 148.5 45 153.5 46 156.5 47 151.5 48 166.0 49 175.5 50 147.5 51 121.5 52 120.0 53 119.5 54 104.0 55 104.5 56 102.5 57 92.5 58 84.5 59 84.0 60 110.0 61 116.0 62 94.0 63 83.0 64 85.5 65 79.0 66 72.5 67 74.0 68 64.0 69 51.0 70 53.0 71 57.0 72 50.0 73 33.5 74 25.0 75 21.0 76 12.0 77 9.5 78 10.5 79 8.0 80 4.5 81 3.5 82 3.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.2 #Duplication Level Percentage of deduplicated Percentage of total 1 92.43492407809111 85.225 2 6.778741865509762 12.5 3 0.7049891540130151 1.95 4 0.05422993492407809 0.2 5 0.027114967462039046 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8875 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.4500000000000002 0.0 0.0 0.0 0.0 136-137 1.5125 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804108 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804108_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.23575 37.0 37.0 37.0 37.0 37.0 2 35.9215 37.0 37.0 37.0 37.0 37.0 3 35.8975 37.0 37.0 37.0 37.0 37.0 4 36.032 37.0 37.0 37.0 37.0 37.0 5 36.019 37.0 37.0 37.0 37.0 37.0 6 36.0685 37.0 37.0 37.0 37.0 37.0 7 35.8455 37.0 37.0 37.0 37.0 37.0 8 36.1985 37.0 37.0 37.0 37.0 37.0 9 36.024 37.0 37.0 37.0 37.0 37.0 10-14 36.043899999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.9516 37.0 37.0 37.0 37.0 37.0 20-24 36.033100000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.95740000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.908300000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.9311 37.0 37.0 37.0 37.0 37.0 40-44 35.8652 37.0 37.0 37.0 37.0 37.0 45-49 35.8091 37.0 37.0 37.0 37.0 37.0 50-54 35.8065 37.0 37.0 37.0 37.0 37.0 55-59 35.709799999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.7596 37.0 37.0 37.0 37.0 37.0 65-69 35.69160000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.64900000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.5937 37.0 37.0 37.0 37.0 37.0 80-84 35.633 37.0 37.0 37.0 37.0 37.0 85-89 35.659400000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.602700000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.5563 37.0 37.0 37.0 37.0 37.0 100-104 35.592699999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.482000000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.3506 37.0 37.0 37.0 37.0 37.0 115-119 35.3625 37.0 37.0 37.0 34.6 37.0 120-124 35.3128 37.0 37.0 37.0 32.2 37.0 125-129 35.2375 37.0 37.0 37.0 32.2 37.0 130-134 35.3656 37.0 37.0 37.0 37.0 37.0 135-139 35.205799999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.2404 37.0 37.0 37.0 29.8 37.0 145-149 34.973299999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.51275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 7.0 15 4.0 16 6.0 17 2.0 18 5.0 19 3.0 20 6.0 21 8.0 22 9.0 23 9.0 24 7.0 25 12.0 26 14.0 27 16.0 28 19.0 29 26.0 30 26.0 31 45.0 32 76.0 33 103.0 34 208.0 35 580.0 36 2587.0 37 220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.485371342835705 18.829707426856714 9.32733183295824 30.357589397349336 2 32.375 19.950000000000003 26.525 21.15 3 25.074999999999996 22.75 27.325 24.85 4 26.775 28.999999999999996 18.825 25.4 5 28.999999999999996 30.575000000000003 19.2 21.224999999999998 6 26.625 32.525 16.975 23.875 7 23.400000000000002 18.65 31.825 26.125 8 25.825 22.575 21.8 29.799999999999997 9 25.2 21.4 24.05 29.349999999999998 10-14 27.450000000000003 24.54 21.515 26.495 15-19 27.41 23.990000000000002 22.33 26.27 20-24 26.91 24.37 22.425 26.295 25-29 27.625 24.060000000000002 22.055 26.26 30-34 26.790000000000003 24.595 21.86 26.755000000000003 35-39 26.99 24.709999999999997 21.91 26.39 40-44 27.305 23.66 21.925 27.11 45-49 26.950000000000003 23.745 22.400000000000002 26.905 50-54 27.245 24.11 22.335 26.31 55-59 27.22 23.77 22.634999999999998 26.375 60-64 27.26 23.625 21.995 27.12 65-69 26.965 24.065 22.384999999999998 26.584999999999997 70-74 27.18 23.855 21.935 27.029999999999998 75-79 26.75 23.52 22.884999999999998 26.845000000000002 80-84 27.315 23.835 22.515 26.334999999999997 85-89 27.800000000000004 23.175 22.335 26.69 90-94 27.250000000000004 23.72 22.045 26.985 95-99 27.925 23.05 22.93 26.095000000000002 100-104 27.250000000000004 24.33 21.945 26.474999999999998 105-109 26.915 23.544999999999998 22.64 26.900000000000002 110-114 26.995 23.76 22.66 26.584999999999997 115-119 27.13 23.785 22.525000000000002 26.56 120-124 27.52 23.89 22.134999999999998 26.455000000000002 125-129 27.529999999999998 24.060000000000002 22.445 25.965 130-134 27.55 24.21 22.36 25.88 135-139 26.815 24.33 22.205 26.650000000000002 140-144 27.505000000000003 24.29 22.220000000000002 25.985000000000003 145-149 27.67 24.09 22.89 25.35 150-151 27.3875 24.1625 22.662499999999998 25.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 1.0 7 1.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 2.0 28 3.0 29 4.5 30 6.5 31 10.5 32 10.0 33 12.0 34 20.0 35 24.5 36 30.0 37 40.5 38 47.5 39 64.0 40 82.0 41 90.5 42 109.5 43 114.0 44 122.0 45 133.0 46 134.0 47 145.5 48 155.0 49 151.5 50 150.0 51 126.0 52 100.5 53 102.0 54 105.0 55 111.5 56 94.0 57 79.0 58 95.5 59 107.0 60 107.0 61 111.5 62 116.5 63 119.5 64 99.5 65 83.0 66 95.0 67 102.5 68 89.0 69 81.5 70 76.0 71 60.0 72 54.5 73 48.5 74 43.0 75 32.5 76 22.0 77 19.0 78 13.0 79 7.0 80 2.5 81 2.0 82 2.5 83 2.5 84 2.0 85 0.5 86 0.5 87 1.5 88 1.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.53528773072746 85.225 2 6.731813246471227 12.4 3 0.5157437567861021 1.425 4 0.10857763300760044 0.4 5 0.08143322475570033 0.375 6 0.0 0.0 7 0.02714440825190011 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGC 7 0.17500000000000002 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8999999999999999 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.4500000000000002 0.0 0.0 0.0 0.0 136-137 1.5125 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGCCA 10 0.006830828 145.0 9 >>END_MODULE Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522019 spots for SRR7804108.sra Written 1522019 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra Read 1522001 spots for SRR7804108.sra Written 1522001 spots for SRR7804108.sra SRR ids: ['SRR7804108.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__atlm9c7 SRR7804108.sra spots: 30440038 blocks: [[1, 1522001], [1522002, 3044002], [3044003, 4566003], [4566004, 6088004], [6088005, 7610005], [7610006, 9132006], [9132007, 10654007], [10654008, 12176008], [12176009, 13698009], [13698010, 15220010], [15220011, 16742011], [16742012, 18264012], [18264013, 19786013], [19786014, 21308014], [21308015, 22830015], [22830016, 24352016], [24352017, 25874017], [25874018, 27396018], [27396019, 28918019], [28918020, 30440038]] SRR7804108 file size 10293429 SRR7804108 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804108 SRR7804108_1.fastq SRR7804108_2.fastq Input file: SRR7804108_1.fastq Paired file: SRR7804108_2.fastq trimmed: SRR7804108-trimmed-pair1.fastq, SRR7804108-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:11:17 2024 >> started Sat Dec 7 17:11:57 2024 >> done (39.869s) 30440038 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 355 ( 0.00%) empty read pairs filtered out after trimming by size control 30439588 (100.00%) read pairs available; of these: 845368 ( 2.78%) trimmed read pairs available after processing 29594220 (97.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 13 0.00% 20 10 0.00% 21 6 0.00% 22 17 0.00% 23 15 0.00% 24 15 0.00% 25 17 0.00% 26 28 0.00% 27 23 0.00% 28 32 0.00% 29 20 0.00% 30 17 0.00% 31 29 0.00% 32 29 0.00% 33 25 0.00% 34 24 0.00% 35 41 0.00% 36 36 0.00% 37 37 0.00% 38 33 0.00% 39 29 0.00% 40 45 0.00% 41 32 0.00% 42 43 0.00% 43 50 0.00% 44 38 0.00% 45 44 0.00% 46 42 0.00% 47 43 0.00% 48 49 0.00% 49 57 0.00% 50 54 0.00% 51 45 0.00% 52 45 0.00% 53 64 0.00% 54 61 0.00% 55 62 0.00% 56 77 0.00% 57 56 0.00% 58 66 0.00% 59 78 0.00% 60 85 0.00% 61 61 0.00% 62 93 0.00% 63 84 0.00% 64 75 0.00% 65 100 0.00% 66 118 0.00% 67 118 0.00% 68 126 0.00% 69 123 0.00% 70 142 0.00% 71 157 0.00% 72 169 0.00% 73 228 0.00% 74 215 0.00% 75 232 0.00% 76 242 0.00% 77 229 0.00% 78 289 0.00% 79 289 0.00% 80 339 0.00% 81 441 0.00% 82 496 0.00% 83 562 0.00% 84 538 0.00% 85 620 0.00% 86 759 0.00% 87 829 0.00% 88 883 0.00% 89 868 0.00% 90 1058 0.00% 91 1239 0.00% 92 1375 0.00% 93 1454 0.00% 94 1649 0.01% 95 1817 0.01% 96 2044 0.01% 97 2170 0.01% 98 2372 0.01% 99 2540 0.01% 100 2671 0.01% 101 3057 0.01% 102 3271 0.01% 103 3592 0.01% 104 3919 0.01% 105 4169 0.01% 106 4357 0.01% 107 4849 0.02% 108 4966 0.02% 109 5236 0.02% 110 5609 0.02% 111 6011 0.02% 112 6497 0.02% 113 7028 0.02% 114 7589 0.02% 115 8256 0.03% 116 8691 0.03% 117 8702 0.03% 118 9325 0.03% 119 9496 0.03% 120 10066 0.03% 121 10801 0.04% 122 11324 0.04% 123 12453 0.04% 124 13247 0.04% 125 14162 0.05% 126 14647 0.05% 127 15307 0.05% 128 15461 0.05% 129 16314 0.05% 130 16464 0.05% 131 17417 0.06% 132 18337 0.06% 133 19925 0.07% 134 21035 0.07% 135 21979 0.07% 136 22898 0.08% 137 23338 0.08% 138 24238 0.08% 139 25239 0.08% 140 25960 0.09% 141 26938 0.09% 142 28530 0.09% 143 29705 0.10% 144 30931 0.10% 145 32782 0.11% 146 33963 0.11% 147 35547 0.12% 148 36006 0.12% 149 36722 0.12% 150 37552 0.12% 151 29594220 97.22% 30439588 reads passed initial QC criterion=sequence-density sequence-density=1.21 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=26 prefix-density=1.24 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.27 sequence-density-rank=32 fanout-score=12.00 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=21 prefix-density=0.80 prefix-fanout=2.8 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.28 sequence-density-rank=22 fanout-score=10.19 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=4.0 sequence=CAGAGCATCCTCGCCAT SRR7804108 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:13:48 Started mapping on | Dec 07 17:13:48 Finished on | Dec 07 17:17:17 Mapping speed, Million of reads per hour | 524.32 Number of input reads | 30439588 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 27726409 Uniquely mapped reads % | 91.09% Average mapped length | 296.09 Number of splices: Total | 26555728 Number of splices: Annotated (sjdb) | 25163746 Number of splices: GT/AG | 26187528 Number of splices: GC/AG | 299559 Number of splices: AT/AC | 8291 Number of splices: Non-canonical | 60350 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380001 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 37198 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.87% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2333178 2333178 2333178 N_multimapping 380001 380001 380001 N_noFeature 815505 26950698 1034609 N_ambiguous 712766 4468 157243 UnstrandedReadsAssigned:26198138 PositiveStrandReadsAssigned:771243 NegativeStrandReadsAssigned:26534557 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804108 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804108-trimmed-pair1.fastq SRR7804108-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,439,588 reads, 27,399,472 reads pseudoaligned [quant] estimated average fragment length: 300.383 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52973 SRR7804108.ke.tsv 35125 SRR7804108.se.tsv 88098 total ==> SRR7804108.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 637.393 0 0 PNS24247 1044 744.617 104.881 6.82335 PNS24249 1928 1628.62 169.848 5.05211 PNS24246 1044 744.617 104.881 6.82335 PNS24248 1044 744.617 104.881 6.82335 PNS24244 1471 1171.62 67.5078 2.79126 PNS24243 293 76.3997 0 0 KQK14069 1603 1303.62 4550.27 169.09 KQK14071 474 206.309 49.4923 11.6212 ==> SRR7804108.se.tsv <== BRADI_1g14170v3 4628 BRADI_1g53295v3 1098 BRADI_1g59795v3 664 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 872 BRADI_1g74790v3 892 BRADI_1g09890v3 9 BRADI_1g77505v3 242 BRADI_1g48960v3 0 SRR7804108 completed mapping pipeline successfully