Starting /dee2/code/volunteer_pipeline.sh SRR7804109 current disk space = 1523680894976 free memory = 1598124840 SRR7804109 SRAfilesize 177937eb8b435ad9754ef110de1e0000 SRR7804109.sra SRR7804109.sra file validated SRR7804109 is paired end SRR7804109 is conventional basespace SRR7804109 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804109_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2745 37.0 37.0 37.0 37.0 37.0 2 36.141 37.0 37.0 37.0 37.0 37.0 3 36.397 37.0 37.0 37.0 37.0 37.0 4 36.3915 37.0 37.0 37.0 37.0 37.0 5 36.468 37.0 37.0 37.0 37.0 37.0 6 36.5225 37.0 37.0 37.0 37.0 37.0 7 36.438 37.0 37.0 37.0 37.0 37.0 8 36.415 37.0 37.0 37.0 37.0 37.0 9 36.4975 37.0 37.0 37.0 37.0 37.0 10-14 36.4822 37.0 37.0 37.0 37.0 37.0 15-19 36.443799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4401 37.0 37.0 37.0 37.0 37.0 25-29 36.4114 37.0 37.0 37.0 37.0 37.0 30-34 36.4301 37.0 37.0 37.0 37.0 37.0 35-39 36.3752 37.0 37.0 37.0 37.0 37.0 40-44 36.373900000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.362700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.352700000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3156 37.0 37.0 37.0 37.0 37.0 60-64 36.30030000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2844 37.0 37.0 37.0 37.0 37.0 70-74 36.2161 37.0 37.0 37.0 37.0 37.0 75-79 36.244 37.0 37.0 37.0 37.0 37.0 80-84 36.1974 37.0 37.0 37.0 37.0 37.0 85-89 36.174899999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.14110000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1165 37.0 37.0 37.0 37.0 37.0 100-104 36.130399999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.0381 37.0 37.0 37.0 37.0 37.0 110-114 36.092200000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.0887 37.0 37.0 37.0 37.0 37.0 120-124 35.9708 37.0 37.0 37.0 37.0 37.0 125-129 35.938399999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.838499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.8226 37.0 37.0 37.0 37.0 37.0 140-144 35.7739 37.0 37.0 37.0 37.0 37.0 145-149 35.704499999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.210750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 1.0 25 3.0 26 6.0 27 8.0 28 17.0 29 26.0 30 39.0 31 49.0 32 50.0 33 80.0 34 146.0 35 312.0 36 2816.0 37 445.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.925 12.675 7.9 33.5 2 26.151151151151154 14.264264264264265 31.356356356356358 28.22822822822823 3 21.7 18.6 24.5 35.199999999999996 4 27.400000000000002 23.375 22.05 27.175 5 26.1 27.975 22.775000000000002 23.150000000000002 6 25.724999999999998 28.775000000000002 21.55 23.95 7 19.55 23.375 35.0 22.075 8 22.1 21.75 27.450000000000003 28.7 9 21.425 19.675 31.624999999999996 27.275 10-14 24.675 23.915 24.21 27.200000000000003 15-19 25.019999999999996 24.44 23.595 26.945000000000004 20-24 24.855 23.885 24.51 26.75 25-29 24.685000000000002 23.945 24.315 27.055 30-34 24.529999999999998 23.849999999999998 24.060000000000002 27.560000000000002 35-39 25.36 23.674999999999997 23.955000000000002 27.01 40-44 25.535000000000004 24.295 23.385 26.784999999999997 45-49 24.84 23.65 24.23 27.279999999999998 50-54 24.95 23.02 24.395 27.634999999999998 55-59 25.855 23.665 23.87 26.61 60-64 25.25 23.56 23.52 27.67 65-69 24.88 23.95 23.505000000000003 27.665 70-74 25.88 23.369999999999997 24.005000000000003 26.745 75-79 24.915000000000003 23.46 24.0 27.625 80-84 25.605 22.835 24.695 26.865 85-89 25.4 23.255 23.365 27.98 90-94 26.43 22.919999999999998 23.145 27.505000000000003 95-99 25.419999999999998 23.595 23.445 27.54 100-104 25.995 22.86 23.44 27.705000000000002 105-109 25.735000000000003 23.135 23.615 27.515 110-114 25.81 23.189999999999998 23.18 27.82 115-119 25.740000000000002 23.599999999999998 22.74 27.92 120-124 26.169999999999998 22.795 23.425 27.61 125-129 26.224999999999998 22.3 23.799999999999997 27.675 130-134 26.605 23.07 22.955000000000002 27.37 135-139 26.045 23.235 22.91 27.810000000000002 140-144 26.1 22.84 23.150000000000002 27.91 145-149 25.705 23.05 23.865 27.38 150-151 27.55 23.150000000000002 21.65 27.650000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 0.5 25 0.0 26 0.5 27 2.5 28 3.5 29 3.0 30 3.0 31 7.0 32 14.0 33 18.5 34 21.5 35 22.5 36 37.0 37 56.0 38 62.0 39 67.0 40 79.0 41 97.5 42 117.5 43 130.5 44 141.0 45 148.0 46 139.5 47 144.0 48 160.5 49 151.0 50 137.0 51 130.5 52 132.0 53 130.5 54 122.0 55 126.0 56 137.5 57 127.0 58 107.0 59 111.5 60 115.0 61 93.0 62 71.5 63 84.0 64 94.5 65 81.0 66 69.5 67 76.0 68 74.0 69 63.0 70 59.0 71 52.0 72 42.0 73 31.0 74 25.0 75 25.0 76 19.0 77 9.5 78 9.5 79 8.5 80 3.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 92.43697478991596 85.25 2 6.776904310111141 12.5 3 0.7319056654920032 2.025 4 0.02710761724044456 0.1 5 0.02710761724044456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGAAGTTACGGGGCTATTTTGCCGAGTTCCTTAGAGAGAGTTGTCTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.23750000000000002 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.8500000000000001 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.05 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.65 0.0 0.0 0.0 0.0 136-137 1.8375 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804109 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804109_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.176 37.0 37.0 37.0 37.0 37.0 2 35.7815 37.0 37.0 37.0 37.0 37.0 3 35.6925 37.0 37.0 37.0 37.0 37.0 4 35.998 37.0 37.0 37.0 37.0 37.0 5 35.994 37.0 37.0 37.0 37.0 37.0 6 35.88 37.0 37.0 37.0 37.0 37.0 7 35.7715 37.0 37.0 37.0 37.0 37.0 8 36.0025 37.0 37.0 37.0 37.0 37.0 9 35.7145 37.0 37.0 37.0 37.0 37.0 10-14 35.9322 37.0 37.0 37.0 37.0 37.0 15-19 35.82860000000001 37.0 37.0 37.0 37.0 37.0 20-24 35.7621 37.0 37.0 37.0 37.0 37.0 25-29 35.7097 37.0 37.0 37.0 37.0 37.0 30-34 35.6983 37.0 37.0 37.0 37.0 37.0 35-39 35.712399999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.6299 37.0 37.0 37.0 37.0 37.0 45-49 35.580499999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.6028 37.0 37.0 37.0 37.0 37.0 55-59 35.4936 37.0 37.0 37.0 37.0 37.0 60-64 35.5295 37.0 37.0 37.0 37.0 37.0 65-69 35.4491 37.0 37.0 37.0 37.0 37.0 70-74 35.4495 37.0 37.0 37.0 37.0 37.0 75-79 35.402100000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.3834 37.0 37.0 37.0 37.0 37.0 85-89 35.424299999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.3608 37.0 37.0 37.0 37.0 37.0 95-99 35.206599999999995 37.0 37.0 37.0 32.2 37.0 100-104 35.318 37.0 37.0 37.0 34.6 37.0 105-109 35.284800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.127300000000005 37.0 37.0 37.0 29.8 37.0 115-119 35.1374 37.0 37.0 37.0 29.8 37.0 120-124 35.1294 37.0 37.0 37.0 32.2 37.0 125-129 34.9147 37.0 37.0 37.0 25.0 37.0 130-134 35.0429 37.0 37.0 37.0 27.4 37.0 135-139 34.9436 37.0 37.0 37.0 25.0 37.0 140-144 34.9279 37.0 37.0 37.0 25.0 37.0 145-149 34.712700000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.366 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 9.0 14 9.0 15 3.0 16 7.0 17 4.0 18 2.0 19 3.0 20 8.0 21 10.0 22 17.0 23 10.0 24 12.0 25 17.0 26 18.0 27 14.0 28 20.0 29 23.0 30 42.0 31 38.0 32 81.0 33 108.0 34 252.0 35 650.0 36 2469.0 37 170.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.55 18.45 8.75 29.25 2 32.35 21.95 23.125 22.575 3 26.0 24.525 25.1 24.375 4 28.275 30.85 18.224999999999998 22.650000000000002 5 28.775000000000002 30.9 17.875 22.45 6 26.150000000000002 32.574999999999996 18.675 22.6 7 23.125 19.55 31.324999999999996 26.0 8 26.525 21.0 21.3 31.175000000000004 9 27.150000000000002 21.224999999999998 24.349999999999998 27.275 10-14 28.299999999999997 24.145 20.990000000000002 26.565 15-19 27.88 23.935000000000002 21.66 26.525 20-24 27.785 23.775 22.025 26.415 25-29 28.405 23.625 21.395 26.575 30-34 28.015 24.205 22.0 25.779999999999998 35-39 27.58 23.72 21.82 26.88 40-44 28.78 24.035 21.34 25.845000000000002 45-49 27.939999999999998 23.665 22.25 26.145000000000003 50-54 27.99 24.16 22.105 25.745 55-59 28.044999999999998 23.84 21.759999999999998 26.355 60-64 28.189999999999998 23.54 21.755 26.515 65-69 27.584999999999997 24.11 22.025 26.279999999999998 70-74 28.475 23.385 21.759999999999998 26.38 75-79 27.72 23.525 22.275 26.479999999999997 80-84 28.28 23.59 21.8 26.33 85-89 28.485 23.585 21.37 26.56 90-94 27.76 24.37 21.995 25.874999999999996 95-99 28.04 24.335 21.705 25.919999999999998 100-104 27.415 23.5 22.57 26.515 105-109 28.050000000000004 23.45 22.05 26.450000000000003 110-114 27.305 23.89 22.14 26.665 115-119 27.715 24.240000000000002 22.235 25.81 120-124 28.03 24.33 21.62 26.02 125-129 27.83 24.595 21.985 25.590000000000003 130-134 28.18 24.36 22.105 25.355 135-139 28.1 24.6 22.005 25.295 140-144 28.225 24.325 22.105 25.345000000000002 145-149 28.110000000000003 24.3 22.49 25.1 150-151 28.425 23.962500000000002 22.15 25.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.5 11 1.5 12 0.5 13 0.5 14 2.5 15 2.0 16 0.5 17 0.5 18 1.5 19 1.5 20 0.0 21 1.0 22 1.0 23 1.0 24 1.0 25 1.0 26 2.0 27 3.0 28 3.5 29 4.0 30 6.0 31 5.5 32 9.5 33 10.5 34 9.5 35 15.5 36 26.5 37 38.5 38 49.0 39 63.5 40 77.0 41 89.5 42 95.5 43 99.0 44 126.0 45 127.5 46 117.0 47 131.5 48 137.0 49 133.5 50 126.0 51 129.5 52 126.0 53 119.5 54 129.5 55 133.0 56 125.0 57 112.0 58 107.5 59 116.0 60 115.5 61 106.5 62 107.5 63 107.0 64 93.0 65 91.5 66 91.0 67 91.5 68 93.0 69 78.5 70 71.0 71 64.5 72 49.5 73 44.5 74 34.5 75 27.0 76 22.0 77 16.0 78 17.0 79 10.5 80 8.0 81 5.0 82 1.5 83 2.5 84 2.0 85 1.0 86 1.0 87 1.0 88 1.0 89 1.0 90 0.5 91 0.5 92 1.0 93 0.5 94 1.0 95 1.5 96 1.0 97 1.0 98 2.0 99 2.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.60266521620886 85.125 2 6.499864019581181 11.95 3 0.7070981778623878 1.95 4 0.16317650258362795 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027196083763937992 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.23750000000000002 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.8500000000000001 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.525 0.0 0.0 0.0 0.0 134-135 1.65 0.0 0.0 0.0 0.0 136-137 1.8375 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354364 spots for SRR7804109.sra Written 1354364 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra Read 1354360 spots for SRR7804109.sra Written 1354360 spots for SRR7804109.sra SRR ids: ['SRR7804109.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m4zmdkjq SRR7804109.sra spots: 27087204 blocks: [[1, 1354360], [1354361, 2708720], [2708721, 4063080], [4063081, 5417440], [5417441, 6771800], [6771801, 8126160], [8126161, 9480520], [9480521, 10834880], [10834881, 12189240], [12189241, 13543600], [13543601, 14897960], [14897961, 16252320], [16252321, 17606680], [17606681, 18961040], [18961041, 20315400], [20315401, 21669760], [21669761, 23024120], [23024121, 24378480], [24378481, 25732840], [25732841, 27087204]] SRR7804109 file size 9157264 SRR7804109 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804109 SRR7804109_1.fastq SRR7804109_2.fastq Input file: SRR7804109_1.fastq Paired file: SRR7804109_2.fastq trimmed: SRR7804109-trimmed-pair1.fastq, SRR7804109-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:58:30 2024 >> started Tue Dec 10 01:59:01 2024 >> done (30.602s) 27087204 read pairs processed; of these: 100 ( 0.00%) short read pairs filtered out after trimming by size control 835 ( 0.00%) empty read pairs filtered out after trimming by size control 27086269 (100.00%) read pairs available; of these: 1081324 ( 3.99%) trimmed read pairs available after processing 26004945 (96.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 18 0.00% 20 12 0.00% 21 13 0.00% 22 13 0.00% 23 10 0.00% 24 14 0.00% 25 19 0.00% 26 23 0.00% 27 14 0.00% 28 25 0.00% 29 13 0.00% 30 17 0.00% 31 26 0.00% 32 17 0.00% 33 23 0.00% 34 22 0.00% 35 33 0.00% 36 28 0.00% 37 25 0.00% 38 31 0.00% 39 22 0.00% 40 32 0.00% 41 34 0.00% 42 27 0.00% 43 32 0.00% 44 28 0.00% 45 31 0.00% 46 26 0.00% 47 24 0.00% 48 39 0.00% 49 42 0.00% 50 46 0.00% 51 30 0.00% 52 43 0.00% 53 46 0.00% 54 40 0.00% 55 43 0.00% 56 56 0.00% 57 46 0.00% 58 51 0.00% 59 55 0.00% 60 50 0.00% 61 79 0.00% 62 75 0.00% 63 62 0.00% 64 68 0.00% 65 69 0.00% 66 97 0.00% 67 103 0.00% 68 94 0.00% 69 113 0.00% 70 107 0.00% 71 125 0.00% 72 144 0.00% 73 163 0.00% 74 189 0.00% 75 200 0.00% 76 223 0.00% 77 238 0.00% 78 314 0.00% 79 306 0.00% 80 372 0.00% 81 415 0.00% 82 458 0.00% 83 541 0.00% 84 656 0.00% 85 687 0.00% 86 769 0.00% 87 852 0.00% 88 896 0.00% 89 1077 0.00% 90 1199 0.00% 91 1380 0.01% 92 1604 0.01% 93 1765 0.01% 94 1985 0.01% 95 2189 0.01% 96 2403 0.01% 97 2498 0.01% 98 2766 0.01% 99 3063 0.01% 100 3280 0.01% 101 3656 0.01% 102 4035 0.01% 103 4379 0.02% 104 4802 0.02% 105 5054 0.02% 106 5502 0.02% 107 5933 0.02% 108 6213 0.02% 109 6743 0.02% 110 7066 0.03% 111 7821 0.03% 112 8340 0.03% 113 8896 0.03% 114 9786 0.04% 115 10565 0.04% 116 10948 0.04% 117 11425 0.04% 118 12098 0.04% 119 12398 0.05% 120 13134 0.05% 121 14056 0.05% 122 14761 0.05% 123 16201 0.06% 124 17107 0.06% 125 18138 0.07% 126 19258 0.07% 127 20011 0.07% 128 20617 0.08% 129 21507 0.08% 130 22095 0.08% 131 22850 0.08% 132 23978 0.09% 133 25918 0.10% 134 27382 0.10% 135 29132 0.11% 136 29967 0.11% 137 30293 0.11% 138 31557 0.12% 139 32568 0.12% 140 33055 0.12% 141 34443 0.13% 142 36384 0.13% 143 37475 0.14% 144 39873 0.15% 145 42120 0.16% 146 43044 0.16% 147 44803 0.17% 148 45598 0.17% 149 45923 0.17% 150 47543 0.18% 151 26004945 96.01% 27086269 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.86 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=46.13 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=3.4 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=22 prefix-density=0.77 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=25.57 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.2 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804109 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:59:56 Started mapping on | Dec 10 01:59:56 Finished on | Dec 10 02:04:54 Mapping speed, Million of reads per hour | 327.22 Number of input reads | 27086269 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 23017859 Uniquely mapped reads % | 84.98% Average mapped length | 299.28 Number of splices: Total | 21335398 Number of splices: Annotated (sjdb) | 20193718 Number of splices: GT/AG | 21025130 Number of splices: GC/AG | 248683 Number of splices: AT/AC | 7807 Number of splices: Non-canonical | 53778 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1077219 % of reads mapped to multiple loci | 3.98% Number of reads mapped to too many loci | 129553 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.85% % of reads unmapped: other | 3.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2991191 2991191 2991191 N_multimapping 1077219 1077219 1077219 N_noFeature 1534470 22306815 1695432 N_ambiguous 674214 3966 124745 UnstrandedReadsAssigned:20809175 PositiveStrandReadsAssigned:707078 NegativeStrandReadsAssigned:21197682 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804109 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804109-trimmed-pair1.fastq SRR7804109-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,086,269 reads, 21,737,480 reads pseudoaligned [quant] estimated average fragment length: 283.898 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52973 SRR7804109.ke.tsv 35125 SRR7804109.se.tsv 88098 total ==> SRR7804109.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 653.586 28.1158 2.25225 PNS24247 1044 761.102 66.2864 4.55986 PNS24249 1928 1645.1 153.648 4.88994 PNS24246 1044 761.102 66.2864 4.55986 PNS24248 1044 761.102 66.2864 4.55986 PNS24244 1471 1188.1 147.377 6.49451 PNS24243 293 79.9504 0 0 KQK14069 1603 1320.1 7122.09 282.468 KQK14071 474 213.74 75.0261 18.3779 ==> SRR7804109.se.tsv <== BRADI_1g14170v3 7261 BRADI_1g53295v3 801 BRADI_1g59795v3 480 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 176 BRADI_1g74790v3 539 BRADI_1g09890v3 0 BRADI_1g77505v3 528 BRADI_1g48960v3 1 SRR7804109 completed mapping pipeline successfully