Starting /dee2/code/volunteer_pipeline.sh SRR7804110 current disk space = 1523737694208 free memory = 1601579696 SRR7804110 SRAfilesize ff8d813d4f7e4706d4dcf0a109574a2d SRR7804110.sra SRR7804110.sra file validated SRR7804110 is paired end SRR7804110 is conventional basespace SRR7804110 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804110_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.263 37.0 37.0 37.0 37.0 37.0 2 36.23775 37.0 37.0 37.0 37.0 37.0 3 36.3335 37.0 37.0 37.0 37.0 37.0 4 36.4855 37.0 37.0 37.0 37.0 37.0 5 36.516 37.0 37.0 37.0 37.0 37.0 6 36.4005 37.0 37.0 37.0 37.0 37.0 7 36.509 37.0 37.0 37.0 37.0 37.0 8 36.5215 37.0 37.0 37.0 37.0 37.0 9 36.4905 37.0 37.0 37.0 37.0 37.0 10-14 36.5162 37.0 37.0 37.0 37.0 37.0 15-19 36.432100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4268 37.0 37.0 37.0 37.0 37.0 25-29 36.412299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4088 37.0 37.0 37.0 37.0 37.0 35-39 36.370799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3694 37.0 37.0 37.0 37.0 37.0 45-49 36.369099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3174 37.0 37.0 37.0 37.0 37.0 55-59 36.325300000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3019 37.0 37.0 37.0 37.0 37.0 65-69 36.2975 37.0 37.0 37.0 37.0 37.0 70-74 36.193299999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.180899999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.1826 37.0 37.0 37.0 37.0 37.0 85-89 36.1219 37.0 37.0 37.0 37.0 37.0 90-94 36.086800000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.119 37.0 37.0 37.0 37.0 37.0 100-104 36.1386 37.0 37.0 37.0 37.0 37.0 105-109 35.984 37.0 37.0 37.0 37.0 37.0 110-114 36.0201 37.0 37.0 37.0 37.0 37.0 115-119 36.01989999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.9269 37.0 37.0 37.0 37.0 37.0 125-129 35.8932 37.0 37.0 37.0 37.0 37.0 130-134 35.842299999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.8309 37.0 37.0 37.0 37.0 37.0 140-144 35.7115 37.0 37.0 37.0 37.0 37.0 145-149 35.7804 37.0 37.0 37.0 37.0 37.0 150-151 35.255250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 3.0 26 4.0 27 9.0 28 11.0 29 17.0 30 32.0 31 50.0 32 61.0 33 83.0 34 155.0 35 368.0 36 2867.0 37 338.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.5 12.125 8.674999999999999 33.7 2 27.070302727045288 14.16062046534901 29.97247935951964 28.796597448086064 3 21.925 19.400000000000002 24.7 33.975 4 26.3 26.0 20.8 26.900000000000002 5 28.299999999999997 28.349999999999998 21.8 21.55 6 23.150000000000002 31.35 21.45 24.05 7 18.65 24.474999999999998 36.449999999999996 20.424999999999997 8 22.675 24.425 26.575 26.325 9 21.825 21.15 31.474999999999998 25.55 10-14 23.945 25.45 24.725 25.88 15-19 24.195 24.66 25.074999999999996 26.07 20-24 23.995 24.465 25.4 26.14 25-29 24.315 24.95 24.565 26.169999999999998 30-34 23.785 25.119999999999997 25.205 25.89 35-39 24.08 24.25 25.290000000000003 26.38 40-44 24.099999999999998 24.585 24.355 26.96 45-49 24.16 24.725 24.68 26.435 50-54 24.29 24.63 24.65 26.43 55-59 24.41 24.51 24.865000000000002 26.215 60-64 24.44 24.54 24.32 26.700000000000003 65-69 24.68 24.795 24.175 26.35 70-74 24.195 24.685000000000002 24.279999999999998 26.840000000000003 75-79 24.69 24.725 23.965 26.619999999999997 80-84 24.27 24.6 24.490000000000002 26.640000000000004 85-89 24.81 23.845 24.959999999999997 26.384999999999998 90-94 24.485 24.16 24.515 26.840000000000003 95-99 24.05 24.48 24.15 27.32 100-104 24.62 24.175 24.345 26.86 105-109 24.8 24.39 24.445 26.365 110-114 24.365000000000002 24.525 24.26 26.85 115-119 24.81 23.799999999999997 24.375 27.015 120-124 25.240000000000002 23.98 24.315 26.465 125-129 24.59 24.2 24.279999999999998 26.93 130-134 25.305 24.515 24.02 26.16 135-139 25.009999999999998 23.799999999999997 23.885 27.305 140-144 25.205 23.375 23.94 27.48 145-149 25.330000000000002 23.735 23.465 27.47 150-151 24.9 22.8375 24.125 28.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 2.5 28 4.5 29 3.5 30 5.5 31 11.5 32 12.0 33 9.5 34 15.0 35 25.5 36 35.5 37 51.5 38 79.0 39 90.5 40 107.5 41 133.0 42 143.5 43 163.5 44 170.0 45 169.0 46 180.0 47 177.0 48 166.5 49 167.5 50 170.5 51 162.0 52 134.0 53 120.5 54 126.5 55 115.0 56 97.5 57 92.5 58 89.0 59 84.5 60 92.5 61 88.0 62 69.0 63 62.5 64 67.0 65 76.0 66 74.0 67 59.5 68 49.5 69 53.0 70 47.0 71 35.5 72 30.5 73 22.5 74 16.5 75 11.5 76 9.5 77 7.0 78 4.5 79 3.0 80 2.5 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.68477388279368 87.52499999999999 2 5.753278030505753 10.75 3 0.4013914905004014 1.125 4 0.16055659620016055 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.025 0.0 0.0 0.0 0.025 92-93 0.037500000000000006 0.0 0.0 0.0 0.025 94-95 0.05 0.0 0.0 0.0 0.025 96-97 0.0625 0.0 0.0 0.0 0.025 98-99 0.075 0.0 0.0 0.0 0.025 100-101 0.075 0.0 0.0 0.0 0.025 102-103 0.075 0.0 0.0 0.0 0.025 104-105 0.125 0.0 0.0 0.0 0.025 106-107 0.1875 0.0 0.0 0.0 0.025 108-109 0.2375 0.0 0.0 0.0 0.025 110-111 0.275 0.0 0.0 0.0 0.025 112-113 0.3375 0.0 0.0 0.0 0.025 114-115 0.4125 0.0 0.0 0.0 0.025 116-117 0.4625 0.0 0.0 0.0 0.025 118-119 0.5125 0.0 0.0 0.0 0.025 120-121 0.625 0.0 0.0 0.0 0.025 122-123 0.7 0.0 0.0 0.0 0.025 124-125 0.775 0.0 0.0 0.0 0.025 126-127 0.825 0.0 0.0 0.0 0.025 128-129 0.9750000000000001 0.0 0.0 0.0 0.025 130-131 1.075 0.0 0.0 0.0 0.025 132-133 1.1 0.0 0.0 0.0 0.025 134-135 1.1875 0.0 0.0 0.0 0.025 136-137 1.3624999999999998 0.0 0.0 0.0 0.025 138-139 1.4625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804110 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804110_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.328 37.0 37.0 37.0 37.0 37.0 2 36.0665 37.0 37.0 37.0 37.0 37.0 3 35.995 37.0 37.0 37.0 37.0 37.0 4 36.2045 37.0 37.0 37.0 37.0 37.0 5 36.124 37.0 37.0 37.0 37.0 37.0 6 36.183 37.0 37.0 37.0 37.0 37.0 7 36.116 37.0 37.0 37.0 37.0 37.0 8 36.2495 37.0 37.0 37.0 37.0 37.0 9 36.0995 37.0 37.0 37.0 37.0 37.0 10-14 36.1854 37.0 37.0 37.0 37.0 37.0 15-19 36.1048 37.0 37.0 37.0 37.0 37.0 20-24 36.072199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.0446 37.0 37.0 37.0 37.0 37.0 30-34 36.0801 37.0 37.0 37.0 37.0 37.0 35-39 35.9952 37.0 37.0 37.0 37.0 37.0 40-44 35.953700000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.8793 37.0 37.0 37.0 37.0 37.0 50-54 35.8898 37.0 37.0 37.0 37.0 37.0 55-59 35.8531 37.0 37.0 37.0 37.0 37.0 60-64 35.8634 37.0 37.0 37.0 37.0 37.0 65-69 35.8121 37.0 37.0 37.0 37.0 37.0 70-74 35.7525 37.0 37.0 37.0 37.0 37.0 75-79 35.7859 37.0 37.0 37.0 37.0 37.0 80-84 35.7786 37.0 37.0 37.0 37.0 37.0 85-89 35.8055 37.0 37.0 37.0 37.0 37.0 90-94 35.7739 37.0 37.0 37.0 37.0 37.0 95-99 35.6385 37.0 37.0 37.0 37.0 37.0 100-104 35.6805 37.0 37.0 37.0 37.0 37.0 105-109 35.567699999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.4298 37.0 37.0 37.0 37.0 37.0 115-119 35.497299999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.44350000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.357499999999995 37.0 37.0 37.0 34.6 37.0 130-134 35.4199 37.0 37.0 37.0 37.0 37.0 135-139 35.2834 37.0 37.0 37.0 34.6 37.0 140-144 35.3446 37.0 37.0 37.0 34.6 37.0 145-149 35.065 37.0 37.0 37.0 27.4 37.0 150-151 34.684 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 8.0 15 2.0 16 4.0 17 0.0 18 2.0 19 1.0 20 2.0 21 5.0 22 8.0 23 7.0 24 4.0 25 6.0 26 8.0 27 13.0 28 19.0 29 21.0 30 36.0 31 41.0 32 75.0 33 102.0 34 178.0 35 626.0 36 2601.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.91995997999 19.759879939969984 10.355177588794398 29.964982491245625 2 31.275 22.075 24.2 22.45 3 23.9 24.525 27.250000000000004 24.325 4 26.75 30.349999999999998 19.7 23.200000000000003 5 29.099999999999998 30.65 18.2 22.05 6 25.174999999999997 32.625 18.625 23.575 7 22.875 19.125 32.625 25.374999999999996 8 24.15 22.5 22.900000000000002 30.45 9 22.775000000000002 22.5 27.275 27.450000000000003 10-14 26.66 24.825 21.535 26.979999999999997 15-19 26.810000000000002 24.285 23.145 25.759999999999998 20-24 26.57 24.245 22.795 26.39 25-29 27.205000000000002 24.035 22.465 26.295 30-34 26.090000000000003 25.165 22.97 25.775 35-39 27.27 24.44 22.57 25.72 40-44 27.175 24.88 22.105 25.840000000000003 45-49 27.33 23.82 22.81 26.040000000000003 50-54 26.775 24.355 23.0 25.869999999999997 55-59 27.169999999999998 24.645 22.465 25.72 60-64 27.02 24.64 22.48 25.86 65-69 26.674999999999997 24.759999999999998 22.884999999999998 25.679999999999996 70-74 26.424999999999997 24.44 23.165 25.97 75-79 26.93 24.12 22.89 26.06 80-84 27.115000000000002 24.48 22.63 25.775 85-89 26.775 24.52 22.7 26.005 90-94 26.640000000000004 24.19 22.814999999999998 26.355 95-99 27.155 24.42 22.564999999999998 25.86 100-104 26.784999999999997 24.645 22.825 25.745 105-109 26.72 24.455 23.18 25.645 110-114 26.735 24.745 22.655 25.865 115-119 26.57 24.07 23.275000000000002 26.085 120-124 26.939999999999998 24.959999999999997 22.79 25.31 125-129 26.729999999999997 25.019999999999996 22.59 25.66 130-134 27.279999999999998 24.65 23.169999999999998 24.9 135-139 27.339999999999996 24.47 23.56 24.63 140-144 26.974999999999998 24.875 22.939999999999998 25.21 145-149 27.200000000000003 24.52 23.015 25.264999999999997 150-151 27.700000000000003 24.637500000000003 23.6125 24.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 2.5 20 1.5 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.5 28 2.5 29 1.5 30 3.0 31 5.5 32 8.0 33 9.5 34 11.0 35 16.0 36 26.5 37 38.0 38 57.0 39 76.0 40 86.0 41 103.5 42 107.5 43 129.5 44 152.0 45 153.5 46 163.0 47 165.5 48 160.5 49 160.5 50 153.5 51 148.0 52 145.0 53 130.5 54 120.5 55 109.5 56 98.0 57 95.5 58 95.5 59 99.5 60 89.0 61 84.0 62 90.5 63 89.0 64 92.0 65 89.0 66 84.5 67 81.0 68 81.0 69 75.0 70 58.5 71 53.0 72 46.5 73 33.0 74 28.0 75 18.5 76 20.0 77 21.0 78 8.5 79 4.0 80 3.5 81 1.5 82 0.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.79513238833913 87.675 2 5.6432201123295 10.549999999999999 3 0.4011767852366943 1.125 4 0.1337255950788981 0.5 5 0.0 0.0 6 0.02674511901577962 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.2374999999999998 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.5125000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCCG 10 0.006830828 145.0 6 >>END_MODULE Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456258 spots for SRR7804110.sra Written 1456258 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra Read 1456242 spots for SRR7804110.sra Written 1456242 spots for SRR7804110.sra SRR ids: ['SRR7804110.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mgw6nbpr SRR7804110.sra spots: 29124856 blocks: [[1, 1456242], [1456243, 2912484], [2912485, 4368726], [4368727, 5824968], [5824969, 7281210], [7281211, 8737452], [8737453, 10193694], [10193695, 11649936], [11649937, 13106178], [13106179, 14562420], [14562421, 16018662], [16018663, 17474904], [17474905, 18931146], [18931147, 20387388], [20387389, 21843630], [21843631, 23299872], [23299873, 24756114], [24756115, 26212356], [26212357, 27668598], [27668599, 29124856]] SRR7804110 file size 9847757 SRR7804110 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804110 SRR7804110_1.fastq SRR7804110_2.fastq Input file: SRR7804110_1.fastq Paired file: SRR7804110_2.fastq trimmed: SRR7804110-trimmed-pair1.fastq, SRR7804110-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:52:15 2024 >> started Tue Dec 10 01:52:49 2024 >> done (34.442s) 29124856 read pairs processed; of these: 68 ( 0.00%) short read pairs filtered out after trimming by size control 278 ( 0.00%) empty read pairs filtered out after trimming by size control 29124510 (100.00%) read pairs available; of these: 646270 ( 2.22%) trimmed read pairs available after processing 28478240 (97.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 13 0.00% 20 14 0.00% 21 10 0.00% 22 15 0.00% 23 16 0.00% 24 15 0.00% 25 23 0.00% 26 21 0.00% 27 25 0.00% 28 16 0.00% 29 21 0.00% 30 32 0.00% 31 26 0.00% 32 22 0.00% 33 26 0.00% 34 27 0.00% 35 25 0.00% 36 26 0.00% 37 33 0.00% 38 37 0.00% 39 27 0.00% 40 40 0.00% 41 23 0.00% 42 39 0.00% 43 37 0.00% 44 29 0.00% 45 43 0.00% 46 46 0.00% 47 32 0.00% 48 42 0.00% 49 41 0.00% 50 42 0.00% 51 30 0.00% 52 43 0.00% 53 51 0.00% 54 46 0.00% 55 60 0.00% 56 53 0.00% 57 43 0.00% 58 62 0.00% 59 53 0.00% 60 70 0.00% 61 57 0.00% 62 65 0.00% 63 90 0.00% 64 57 0.00% 65 68 0.00% 66 78 0.00% 67 77 0.00% 68 98 0.00% 69 87 0.00% 70 89 0.00% 71 108 0.00% 72 124 0.00% 73 141 0.00% 74 134 0.00% 75 155 0.00% 76 179 0.00% 77 177 0.00% 78 233 0.00% 79 204 0.00% 80 235 0.00% 81 238 0.00% 82 331 0.00% 83 367 0.00% 84 443 0.00% 85 439 0.00% 86 476 0.00% 87 528 0.00% 88 612 0.00% 89 664 0.00% 90 702 0.00% 91 800 0.00% 92 942 0.00% 93 1078 0.00% 94 1143 0.00% 95 1201 0.00% 96 1340 0.00% 97 1529 0.01% 98 1559 0.01% 99 1716 0.01% 100 1877 0.01% 101 2085 0.01% 102 2293 0.01% 103 2498 0.01% 104 2725 0.01% 105 3030 0.01% 106 3187 0.01% 107 3466 0.01% 108 3617 0.01% 109 4019 0.01% 110 4139 0.01% 111 4520 0.02% 112 4867 0.02% 113 5036 0.02% 114 5574 0.02% 115 5979 0.02% 116 6305 0.02% 117 6741 0.02% 118 6982 0.02% 119 7296 0.03% 120 7621 0.03% 121 8115 0.03% 122 8620 0.03% 123 9415 0.03% 124 10010 0.03% 125 10536 0.04% 126 10961 0.04% 127 11477 0.04% 128 11810 0.04% 129 12522 0.04% 130 12851 0.04% 131 13503 0.05% 132 14313 0.05% 133 14870 0.05% 134 15770 0.05% 135 16940 0.06% 136 17299 0.06% 137 17958 0.06% 138 18558 0.06% 139 19592 0.07% 140 20216 0.07% 141 20706 0.07% 142 21738 0.07% 143 23490 0.08% 144 24095 0.08% 145 25739 0.09% 146 26766 0.09% 147 27619 0.09% 148 28152 0.10% 149 29114 0.10% 150 29688 0.10% 151 28478240 97.78% 29124510 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=29 prefix-density=0.49 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.21 sequence-density-rank=16 fanout-score=15.58 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=7.5 sequence=CCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=14 prefix-density=0.58 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=116.40 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=9.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804110 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:53:41 Started mapping on | Dec 10 01:53:41 Finished on | Dec 10 01:58:19 Mapping speed, Million of reads per hour | 377.15 Number of input reads | 29124510 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 26564846 Uniquely mapped reads % | 91.21% Average mapped length | 299.91 Number of splices: Total | 28205743 Number of splices: Annotated (sjdb) | 26628531 Number of splices: GT/AG | 27790609 Number of splices: GC/AG | 339411 Number of splices: AT/AC | 15764 Number of splices: Non-canonical | 59959 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403348 % of reads mapped to multiple loci | 1.38% Number of reads mapped to too many loci | 24770 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.67% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2156316 2156316 2156316 N_multimapping 403348 403348 403348 N_noFeature 715304 25812025 893142 N_ambiguous 693963 4760 119323 UnstrandedReadsAssigned:25155579 PositiveStrandReadsAssigned:748061 NegativeStrandReadsAssigned:25552381 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804110 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804110-trimmed-pair1.fastq SRR7804110-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,124,510 reads, 25,843,894 reads pseudoaligned [quant] estimated average fragment length: 304.673 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52973 SRR7804110.ke.tsv 35125 SRR7804110.se.tsv 88098 total ==> SRR7804110.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 632.801 2.45201e-05 1.90719e-06 PNS24247 1044 740.327 111.532 7.41506 PNS24249 1928 1624.33 204.306 6.1908 PNS24246 1044 740.327 111.532 7.41506 PNS24248 1044 740.327 111.532 7.41506 PNS24244 1471 1167.33 151.099 6.371 PNS24243 293 70.6244 0 0 KQK14069 1603 1299.33 814.581 30.8571 KQK14071 474 196.123 9.50951 2.38654 ==> SRR7804110.se.tsv <== BRADI_1g14170v3 843 BRADI_1g53295v3 1026 BRADI_1g59795v3 422 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 2533 BRADI_1g74790v3 606 BRADI_1g09890v3 9 BRADI_1g77505v3 625 BRADI_1g48960v3 1 SRR7804110 completed mapping pipeline successfully