Starting /dee2/code/volunteer_pipeline.sh SRR7804111 current disk space = 1523788496896 free memory = 1407796516 SRR7804111 SRAfilesize 1bb9d0cdf520f91588f0d02180141767 SRR7804111.sra SRR7804111.sra file validated SRR7804111 is paired end SRR7804111 is conventional basespace SRR7804111 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804111_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.233 37.0 37.0 37.0 37.0 37.0 2 36.287 37.0 37.0 37.0 37.0 37.0 3 36.371 37.0 37.0 37.0 37.0 37.0 4 36.4465 37.0 37.0 37.0 37.0 37.0 5 36.502 37.0 37.0 37.0 37.0 37.0 6 36.529 37.0 37.0 37.0 37.0 37.0 7 36.3485 37.0 37.0 37.0 37.0 37.0 8 36.4475 37.0 37.0 37.0 37.0 37.0 9 36.5275 37.0 37.0 37.0 37.0 37.0 10-14 36.480900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.4488 37.0 37.0 37.0 37.0 37.0 20-24 36.4388 37.0 37.0 37.0 37.0 37.0 25-29 36.4017 37.0 37.0 37.0 37.0 37.0 30-34 36.404 37.0 37.0 37.0 37.0 37.0 35-39 36.3816 37.0 37.0 37.0 37.0 37.0 40-44 36.3849 37.0 37.0 37.0 37.0 37.0 45-49 36.3342 37.0 37.0 37.0 37.0 37.0 50-54 36.3405 37.0 37.0 37.0 37.0 37.0 55-59 36.31569999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.2804 37.0 37.0 37.0 37.0 37.0 65-69 36.2918 37.0 37.0 37.0 37.0 37.0 70-74 36.2197 37.0 37.0 37.0 37.0 37.0 75-79 36.274800000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.1977 37.0 37.0 37.0 37.0 37.0 85-89 36.1463 37.0 37.0 37.0 37.0 37.0 90-94 36.0756 37.0 37.0 37.0 37.0 37.0 95-99 36.098699999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1666 37.0 37.0 37.0 37.0 37.0 105-109 36.0195 37.0 37.0 37.0 37.0 37.0 110-114 36.042 37.0 37.0 37.0 37.0 37.0 115-119 36.003 37.0 37.0 37.0 37.0 37.0 120-124 35.8925 37.0 37.0 37.0 37.0 37.0 125-129 35.8782 37.0 37.0 37.0 37.0 37.0 130-134 35.8165 37.0 37.0 37.0 37.0 37.0 135-139 35.8667 37.0 37.0 37.0 37.0 37.0 140-144 35.7033 37.0 37.0 37.0 37.0 37.0 145-149 35.7298 37.0 37.0 37.0 37.0 37.0 150-151 35.26875 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 0.0 26 10.0 27 13.0 28 16.0 29 18.0 30 29.0 31 61.0 32 59.0 33 81.0 34 113.0 35 310.0 36 2917.0 37 368.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.1 14.099999999999998 11.200000000000001 31.6 2 26.276276276276278 14.589589589589588 30.48048048048048 28.653653653653656 3 21.975 21.9 26.05 30.075000000000003 4 23.375 25.05 23.400000000000002 28.175 5 25.4 29.099999999999998 22.85 22.650000000000002 6 24.6 30.7 22.75 21.95 7 17.775 23.25 38.525 20.45 8 22.225 22.725 26.924999999999997 28.125 9 21.025 22.75 31.125000000000004 25.1 10-14 23.244999999999997 25.485000000000003 26.029999999999998 25.240000000000002 15-19 23.365 25.465 25.525 25.645 20-24 23.57 24.675 25.855 25.900000000000002 25-29 23.345 25.305 25.82 25.53 30-34 23.375 25.724999999999998 25.180000000000003 25.72 35-39 23.31 25.16 25.424999999999997 26.105 40-44 23.04 25.995 25.009999999999998 25.955000000000002 45-49 23.98 24.560000000000002 25.415 26.045 50-54 23.705000000000002 24.654999999999998 24.95 26.69 55-59 23.76 25.095 25.290000000000003 25.855 60-64 23.875 25.585 25.435000000000002 25.105 65-69 24.065 24.395 25.085 26.455000000000002 70-74 23.165 25.145 25.295 26.395000000000003 75-79 23.494999999999997 24.995 25.31 26.200000000000003 80-84 23.7 25.165 24.68 26.455000000000002 85-89 24.085 24.725 25.03 26.16 90-94 23.915 25.305 25.840000000000003 24.94 95-99 24.104999999999997 23.919999999999998 25.245 26.729999999999997 100-104 24.295 24.75 24.95 26.005 105-109 24.515 24.395 25.215 25.874999999999996 110-114 24.2 23.9 25.34 26.56 115-119 24.33 24.455 25.014999999999997 26.200000000000003 120-124 24.34 24.19 25.185000000000002 26.284999999999997 125-129 24.25 24.715 24.635 26.400000000000002 130-134 24.455 24.44 24.87 26.235000000000003 135-139 24.645 24.47 24.959999999999997 25.924999999999997 140-144 24.295 24.759999999999998 24.654999999999998 26.290000000000003 145-149 24.959999999999997 24.73 24.215 26.095000000000002 150-151 25.2625 24.05 24.0625 26.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 3.5 28 4.5 29 5.5 30 8.5 31 13.0 32 18.0 33 27.5 34 31.5 35 41.5 36 52.5 37 61.0 38 81.0 39 101.0 40 120.0 41 149.5 42 161.0 43 164.5 44 182.5 45 199.5 46 200.5 47 175.5 48 162.0 49 178.5 50 162.5 51 133.5 52 124.0 53 115.5 54 108.0 55 104.5 56 111.0 57 93.0 58 80.0 59 80.0 60 73.5 61 68.0 62 60.0 63 56.0 64 60.0 65 55.0 66 42.0 67 38.0 68 39.0 69 45.5 70 46.0 71 33.5 72 30.5 73 27.0 74 17.0 75 12.0 76 11.0 77 8.5 78 5.0 79 4.0 80 2.5 81 1.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 94.03938265034593 88.35 2 5.508249068653539 10.35 3 0.4257583821181479 1.2 4 0.026609898882384245 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.0750000000000002 0.0 0.0 0.0 0.0 130-131 1.175 0.0 0.0 0.0 0.0 132-133 1.3125 0.0 0.0 0.0 0.0 134-135 1.5125000000000002 0.0 0.0 0.0 0.0 136-137 1.7125 0.0 0.0 0.0 0.0 138-139 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGATCC 10 0.006830828 145.0 3 GTGGATC 10 0.006830828 145.0 2 >>END_MODULE SRR7804111 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804111_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3715 37.0 37.0 37.0 37.0 37.0 2 36.074 37.0 37.0 37.0 37.0 37.0 3 35.9765 37.0 37.0 37.0 37.0 37.0 4 36.1195 37.0 37.0 37.0 37.0 37.0 5 36.2275 37.0 37.0 37.0 37.0 37.0 6 36.1495 37.0 37.0 37.0 37.0 37.0 7 36.046 37.0 37.0 37.0 37.0 37.0 8 36.153 37.0 37.0 37.0 37.0 37.0 9 36.0445 37.0 37.0 37.0 37.0 37.0 10-14 36.0364 37.0 37.0 37.0 37.0 37.0 15-19 35.87 37.0 37.0 37.0 37.0 37.0 20-24 35.8809 37.0 37.0 37.0 37.0 37.0 25-29 35.8375 37.0 37.0 37.0 37.0 37.0 30-34 35.7567 37.0 37.0 37.0 37.0 37.0 35-39 35.7639 37.0 37.0 37.0 37.0 37.0 40-44 35.7171 37.0 37.0 37.0 37.0 37.0 45-49 35.703599999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.618700000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.5835 37.0 37.0 37.0 37.0 37.0 60-64 35.6015 37.0 37.0 37.0 37.0 37.0 65-69 35.5185 37.0 37.0 37.0 37.0 37.0 70-74 35.484899999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.5047 37.0 37.0 37.0 37.0 37.0 80-84 35.478899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.490300000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.5004 37.0 37.0 37.0 37.0 37.0 95-99 35.4182 37.0 37.0 37.0 37.0 37.0 100-104 35.39489999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.310300000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.214600000000004 37.0 37.0 37.0 32.2 37.0 115-119 35.226600000000005 37.0 37.0 37.0 34.6 37.0 120-124 35.230900000000005 37.0 37.0 37.0 32.2 37.0 125-129 35.0695 37.0 37.0 37.0 27.4 37.0 130-134 35.228 37.0 37.0 37.0 34.6 37.0 135-139 35.074400000000004 37.0 37.0 37.0 29.8 37.0 140-144 35.071000000000005 37.0 37.0 37.0 27.4 37.0 145-149 34.9514 37.0 37.0 37.0 25.0 37.0 150-151 34.4545 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 22.0 15 9.0 16 7.0 17 6.0 18 8.0 19 8.0 20 4.0 21 15.0 22 11.0 23 15.0 24 14.0 25 7.0 26 15.0 27 10.0 28 19.0 29 14.0 30 35.0 31 45.0 32 55.0 33 77.0 34 159.0 35 503.0 36 2701.0 37 236.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.825 18.525 12.425 28.225 2 31.874999999999996 22.975 24.4 20.75 3 27.800000000000004 24.3 25.724999999999998 22.175 4 27.975 32.0 18.475 21.55 5 29.525000000000002 31.3 17.974999999999998 21.2 6 26.25 32.875 18.95 21.925 7 25.825 18.55 31.724999999999998 23.9 8 25.900000000000002 23.25 21.85 28.999999999999996 9 25.825 21.575 24.5 28.1 10-14 27.67 25.430000000000003 21.73 25.169999999999998 15-19 26.845000000000002 25.115 23.425 24.615000000000002 20-24 26.884999999999998 25.515 22.805 24.795 25-29 27.305 26.200000000000003 22.3 24.195 30-34 27.08 25.759999999999998 22.57 24.59 35-39 27.49 25.245 22.91 24.355 40-44 26.36 25.335 23.18 25.124999999999996 45-49 25.995 25.419999999999998 23.18 25.405 50-54 26.805 26.424999999999997 22.770000000000003 24.0 55-59 26.450000000000003 25.095 23.32 25.135 60-64 25.979999999999997 25.569999999999997 23.445 25.005 65-69 26.810000000000002 25.080000000000002 22.95 25.16 70-74 26.695 25.88 22.6 24.825 75-79 26.979999999999997 25.619999999999997 22.895 24.505 80-84 27.295 25.195 22.665 24.845 85-89 27.089999999999996 25.82 22.64 24.45 90-94 26.75 25.495 23.189999999999998 24.565 95-99 26.150000000000002 25.259999999999998 23.64 24.95 100-104 26.775 25.64 23.095 24.490000000000002 105-109 26.224999999999998 25.695 23.415 24.665 110-114 26.415 25.4 23.25 24.935 115-119 26.765 25.88 23.18 24.175 120-124 26.334999999999997 25.615 23.625 24.425 125-129 26.834999999999997 26.005 23.369999999999997 23.79 130-134 26.36 25.97 23.580000000000002 24.09 135-139 26.240000000000002 26.08 23.75 23.93 140-144 26.484999999999996 25.729999999999997 23.925 23.86 145-149 26.845000000000002 26.5 22.905 23.75 150-151 26.375 25.6125 24.099999999999998 23.9125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 2.5 9 3.0 10 1.0 11 1.0 12 0.5 13 1.5 14 2.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 0.5 21 2.0 22 4.0 23 3.0 24 2.0 25 1.5 26 3.0 27 4.0 28 3.0 29 4.0 30 5.0 31 5.0 32 9.0 33 12.5 34 19.0 35 25.5 36 30.0 37 41.5 38 60.5 39 88.0 40 108.0 41 116.5 42 142.5 43 166.5 44 169.0 45 181.0 46 193.0 47 170.0 48 161.5 49 167.5 50 143.0 51 128.0 52 120.0 53 119.0 54 123.0 55 105.0 56 80.0 57 80.5 58 91.0 59 86.5 60 79.0 61 71.5 62 72.5 63 80.5 64 80.0 65 70.5 66 58.0 67 55.5 68 61.5 69 60.5 70 52.0 71 47.0 72 36.0 73 35.0 74 29.5 75 18.5 76 21.0 77 15.5 78 9.0 79 6.5 80 4.5 81 2.5 82 2.0 83 1.5 84 1.0 85 1.5 86 3.0 87 2.0 88 0.5 89 0.0 90 1.5 91 2.5 92 1.5 93 1.5 94 1.5 95 1.0 96 1.0 97 1.0 98 2.5 99 2.5 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.09248863940122 88.0 2 5.479818230419673 10.25 3 0.37423148890670943 1.05 4 0.02673082063619353 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02673082063619353 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 24 0.6 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 0.8999999999999999 0.0 0.0 0.0 0.0 128-129 1.1124999999999998 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.3625 0.0 0.0 0.0 0.0 134-135 1.5625 0.0 0.0 0.0 0.0 136-137 1.7625000000000002 0.0 0.0 0.0 0.0 138-139 1.9500000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATCAT 10 0.006830828 145.0 7 TACTTGA 10 0.006830828 145.0 3 >>END_MODULE Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309570 spots for SRR7804111.sra Written 1309570 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra Read 1309551 spots for SRR7804111.sra Written 1309551 spots for SRR7804111.sra SRR ids: ['SRR7804111.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hmjtc89b SRR7804111.sra spots: 26191039 blocks: [[1, 1309551], [1309552, 2619102], [2619103, 3928653], [3928654, 5238204], [5238205, 6547755], [6547756, 7857306], [7857307, 9166857], [9166858, 10476408], [10476409, 11785959], [11785960, 13095510], [13095511, 14405061], [14405062, 15714612], [15714613, 17024163], [17024164, 18333714], [18333715, 19643265], [19643266, 20952816], [20952817, 22262367], [22262368, 23571918], [23571919, 24881469], [24881470, 26191039]] SRR7804111 file size 8853583 SRR7804111 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804111 SRR7804111_1.fastq SRR7804111_2.fastq Input file: SRR7804111_1.fastq Paired file: SRR7804111_2.fastq trimmed: SRR7804111-trimmed-pair1.fastq, SRR7804111-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:50:19 2024 >> started Tue Dec 10 01:50:54 2024 >> done (35.538s) 26191039 read pairs processed; of these: 100 ( 0.00%) short read pairs filtered out after trimming by size control 1860 ( 0.01%) empty read pairs filtered out after trimming by size control 26189079 (99.99%) read pairs available; of these: 880211 ( 3.36%) trimmed read pairs available after processing 25308868 (96.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 13 0.00% 20 11 0.00% 21 13 0.00% 22 12 0.00% 23 15 0.00% 24 15 0.00% 25 24 0.00% 26 18 0.00% 27 12 0.00% 28 13 0.00% 29 19 0.00% 30 18 0.00% 31 24 0.00% 32 13 0.00% 33 25 0.00% 34 16 0.00% 35 23 0.00% 36 20 0.00% 37 23 0.00% 38 21 0.00% 39 26 0.00% 40 23 0.00% 41 31 0.00% 42 30 0.00% 43 33 0.00% 44 23 0.00% 45 44 0.00% 46 40 0.00% 47 39 0.00% 48 43 0.00% 49 36 0.00% 50 36 0.00% 51 55 0.00% 52 41 0.00% 53 52 0.00% 54 48 0.00% 55 45 0.00% 56 55 0.00% 57 62 0.00% 58 49 0.00% 59 66 0.00% 60 75 0.00% 61 75 0.00% 62 82 0.00% 63 70 0.00% 64 76 0.00% 65 74 0.00% 66 99 0.00% 67 103 0.00% 68 127 0.00% 69 114 0.00% 70 131 0.00% 71 165 0.00% 72 180 0.00% 73 216 0.00% 74 249 0.00% 75 272 0.00% 76 260 0.00% 77 306 0.00% 78 353 0.00% 79 402 0.00% 80 412 0.00% 81 460 0.00% 82 615 0.00% 83 717 0.00% 84 772 0.00% 85 795 0.00% 86 887 0.00% 87 969 0.00% 88 1048 0.00% 89 1260 0.00% 90 1342 0.01% 91 1535 0.01% 92 1586 0.01% 93 1938 0.01% 94 2083 0.01% 95 2321 0.01% 96 2498 0.01% 97 2675 0.01% 98 2798 0.01% 99 2951 0.01% 100 3289 0.01% 101 3646 0.01% 102 4074 0.02% 103 4522 0.02% 104 4838 0.02% 105 5072 0.02% 106 5396 0.02% 107 5661 0.02% 108 5879 0.02% 109 6282 0.02% 110 6551 0.03% 111 6867 0.03% 112 7894 0.03% 113 8363 0.03% 114 9017 0.03% 115 9664 0.04% 116 9648 0.04% 117 10194 0.04% 118 10683 0.04% 119 10889 0.04% 120 11311 0.04% 121 11999 0.05% 122 12825 0.05% 123 13708 0.05% 124 14598 0.06% 125 15703 0.06% 126 15918 0.06% 127 16048 0.06% 128 16716 0.06% 129 16985 0.06% 130 17633 0.07% 131 18230 0.07% 132 19209 0.07% 133 20522 0.08% 134 21675 0.08% 135 22893 0.09% 136 23682 0.09% 137 24045 0.09% 138 24695 0.09% 139 25246 0.10% 140 25680 0.10% 141 26361 0.10% 142 27974 0.11% 143 29021 0.11% 144 30671 0.12% 145 32144 0.12% 146 33063 0.13% 147 33854 0.13% 148 34526 0.13% 149 34412 0.13% 150 36111 0.14% 151 25308868 96.64% 26189079 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=23 prefix-density=0.51 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=33.05 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=13 prefix-density=0.47 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=117.96 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.1 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804111 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:52:03 Started mapping on | Dec 10 01:52:03 Finished on | Dec 10 01:57:40 Mapping speed, Million of reads per hour | 279.76 Number of input reads | 26189079 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 23273994 Uniquely mapped reads % | 88.87% Average mapped length | 299.39 Number of splices: Total | 24372988 Number of splices: Annotated (sjdb) | 22950653 Number of splices: GT/AG | 24002246 Number of splices: GC/AG | 297682 Number of splices: AT/AC | 12513 Number of splices: Non-canonical | 60547 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410258 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 39985 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.17% % of reads unmapped: other | 1.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2504827 2504827 2504827 N_multimapping 410258 410258 410258 N_noFeature 906911 22575126 1097975 N_ambiguous 624306 4457 116512 UnstrandedReadsAssigned:21742777 PositiveStrandReadsAssigned:694411 NegativeStrandReadsAssigned:22059507 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804111 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804111-trimmed-pair1.fastq SRR7804111-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,189,079 reads, 22,572,019 reads pseudoaligned [quant] estimated average fragment length: 302.026 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR7804111.ke.tsv 35125 SRR7804111.se.tsv 88098 total ==> SRR7804111.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 635.459 0 0 PNS24247 1044 742.974 106.216 8.43394 PNS24249 1928 1626.97 122.161 4.42964 PNS24246 1044 742.974 106.216 8.43394 PNS24248 1044 742.974 106.216 8.43394 PNS24244 1471 1169.97 166.192 8.38008 PNS24243 293 75.9093 1 0.777178 KQK14069 1603 1301.97 726.637 32.9253 KQK14071 474 201.001 17.0158 4.99425 ==> SRR7804111.se.tsv <== BRADI_1g14170v3 784 BRADI_1g53295v3 1705 BRADI_1g59795v3 845 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 1322 BRADI_1g74790v3 1022 BRADI_1g09890v3 2 BRADI_1g77505v3 503 BRADI_1g48960v3 0 SRR7804111 completed mapping pipeline successfully