Starting /dee2/code/volunteer_pipeline.sh SRR7804112 current disk space = 1524003250176 free memory = 1411002664 SRR7804112 SRAfilesize c69da34ac9ce5f0f13258c6d044e3e09 SRR7804112.sra SRR7804112.sra file validated SRR7804112 is paired end SRR7804112 is conventional basespace SRR7804112 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804112_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3075 37.0 37.0 37.0 37.0 37.0 2 36.25775 37.0 37.0 37.0 37.0 37.0 3 36.373 37.0 37.0 37.0 37.0 37.0 4 36.546 37.0 37.0 37.0 37.0 37.0 5 36.5005 37.0 37.0 37.0 37.0 37.0 6 36.4535 37.0 37.0 37.0 37.0 37.0 7 36.4205 37.0 37.0 37.0 37.0 37.0 8 36.4545 37.0 37.0 37.0 37.0 37.0 9 36.4935 37.0 37.0 37.0 37.0 37.0 10-14 36.5004 37.0 37.0 37.0 37.0 37.0 15-19 36.4682 37.0 37.0 37.0 37.0 37.0 20-24 36.480000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4495 37.0 37.0 37.0 37.0 37.0 30-34 36.409000000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4009 37.0 37.0 37.0 37.0 37.0 40-44 36.438100000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.37 37.0 37.0 37.0 37.0 37.0 50-54 36.3389 37.0 37.0 37.0 37.0 37.0 55-59 36.3409 37.0 37.0 37.0 37.0 37.0 60-64 36.2884 37.0 37.0 37.0 37.0 37.0 65-69 36.3566 37.0 37.0 37.0 37.0 37.0 70-74 36.2689 37.0 37.0 37.0 37.0 37.0 75-79 36.222 37.0 37.0 37.0 37.0 37.0 80-84 36.208299999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.1541 37.0 37.0 37.0 37.0 37.0 90-94 36.1628 37.0 37.0 37.0 37.0 37.0 95-99 36.1308 37.0 37.0 37.0 37.0 37.0 100-104 36.1062 37.0 37.0 37.0 37.0 37.0 105-109 36.0767 37.0 37.0 37.0 37.0 37.0 110-114 36.022999999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.057 37.0 37.0 37.0 37.0 37.0 120-124 35.9531 37.0 37.0 37.0 37.0 37.0 125-129 35.8521 37.0 37.0 37.0 37.0 37.0 130-134 35.8261 37.0 37.0 37.0 37.0 37.0 135-139 35.7915 37.0 37.0 37.0 37.0 37.0 140-144 35.7221 37.0 37.0 37.0 37.0 37.0 145-149 35.7143 37.0 37.0 37.0 37.0 37.0 150-151 35.14825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 2.0 26 5.0 27 11.0 28 15.0 29 21.0 30 33.0 31 39.0 32 58.0 33 77.0 34 139.0 35 324.0 36 2907.0 37 366.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.925 11.65 7.775 33.650000000000006 2 25.50688360450563 13.391739674593243 31.689612015018774 29.411764705882355 3 21.975 19.5 24.2 34.325 4 27.425 24.0 20.1 28.475 5 25.8 28.449999999999996 22.825 22.925 6 23.799999999999997 30.55 23.200000000000003 22.45 7 19.475 24.05 36.65 19.825 8 20.674999999999997 22.425 28.599999999999998 28.299999999999997 9 21.099999999999998 21.175 30.625000000000004 27.1 10-14 24.355 25.21 24.65 25.785000000000004 15-19 24.795 24.435000000000002 25.095 25.674999999999997 20-24 23.985 24.825 25.245 25.945 25-29 24.5 24.8 24.88 25.82 30-34 23.599999999999998 24.085 25.285000000000004 27.029999999999998 35-39 24.29 24.905 24.26 26.545 40-44 24.709999999999997 24.349999999999998 24.795 26.145000000000003 45-49 24.27 24.455 24.755 26.52 50-54 24.495 24.125 24.67 26.71 55-59 24.349999999999998 24.235 24.825 26.590000000000003 60-64 24.625 24.154999999999998 24.02 27.200000000000003 65-69 24.955 24.68 24.115000000000002 26.25 70-74 24.68 23.565 24.705 27.05 75-79 24.72 23.845 24.815 26.619999999999997 80-84 24.425 24.12 24.425 27.029999999999998 85-89 24.715 23.474999999999998 24.75 27.060000000000002 90-94 24.89 24.265 24.635 26.21 95-99 24.95 24.22 24.515 26.314999999999998 100-104 25.27 24.07 24.635 26.025 105-109 24.975 23.580000000000002 24.375 27.07 110-114 25.455 23.549999999999997 24.265 26.729999999999997 115-119 25.19 23.71 24.060000000000002 27.04 120-124 25.055 23.990000000000002 24.05 26.905 125-129 25.3 24.075 24.305 26.32 130-134 25.21 23.655 24.135 27.0 135-139 25.465 23.435 24.33 26.77 140-144 25.82 23.535 24.36 26.284999999999997 145-149 25.085 24.145 24.025 26.745 150-151 25.4375 24.3625 23.575 26.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.5 28 3.0 29 4.0 30 4.5 31 7.0 32 8.5 33 17.0 34 28.0 35 40.0 36 57.0 37 67.0 38 72.5 39 79.5 40 97.5 41 122.0 42 138.0 43 148.0 44 163.0 45 170.5 46 171.5 47 179.0 48 180.0 49 170.0 50 156.0 51 142.0 52 135.0 53 128.0 54 106.0 55 93.0 56 97.5 57 84.0 58 81.0 59 86.0 60 86.5 61 89.5 62 78.0 63 65.0 64 68.5 65 80.0 66 66.5 67 55.0 68 59.5 69 57.5 70 48.0 71 35.5 72 35.0 73 32.0 74 24.5 75 20.0 76 15.0 77 12.0 78 7.5 79 5.5 80 4.0 81 4.5 82 4.0 83 2.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.75 #Duplication Level Percentage of deduplicated Percentage of total 1 92.8032345013477 86.075 2 6.657681940700809 12.35 3 0.48517520215633425 1.35 4 0.026954177897574125 0.1 5 0.026954177897574125 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAGTTAAGCTCGCCTAAGACAACAAGCTGGATTAGTAGTCCGTTCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.8999999999999999 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138-139 1.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804112 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804112_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3365 37.0 37.0 37.0 37.0 37.0 2 36.043 37.0 37.0 37.0 37.0 37.0 3 36.218 37.0 37.0 37.0 37.0 37.0 4 36.313 37.0 37.0 37.0 37.0 37.0 5 36.186 37.0 37.0 37.0 37.0 37.0 6 36.241 37.0 37.0 37.0 37.0 37.0 7 36.082 37.0 37.0 37.0 37.0 37.0 8 36.3495 37.0 37.0 37.0 37.0 37.0 9 36.096 37.0 37.0 37.0 37.0 37.0 10-14 36.2449 37.0 37.0 37.0 37.0 37.0 15-19 36.1984 37.0 37.0 37.0 37.0 37.0 20-24 36.162400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1572 37.0 37.0 37.0 37.0 37.0 30-34 36.153499999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.058800000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.0125 37.0 37.0 37.0 37.0 37.0 45-49 35.9861 37.0 37.0 37.0 37.0 37.0 50-54 36.0029 37.0 37.0 37.0 37.0 37.0 55-59 35.9282 37.0 37.0 37.0 37.0 37.0 60-64 35.895599999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.826800000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.848 37.0 37.0 37.0 37.0 37.0 75-79 35.811099999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.8579 37.0 37.0 37.0 37.0 37.0 85-89 35.7771 37.0 37.0 37.0 37.0 37.0 90-94 35.7986 37.0 37.0 37.0 37.0 37.0 95-99 35.708000000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.705200000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.707499999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.579100000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.518100000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5156 37.0 37.0 37.0 37.0 37.0 125-129 35.4919 37.0 37.0 37.0 37.0 37.0 130-134 35.5569 37.0 37.0 37.0 37.0 37.0 135-139 35.3273 37.0 37.0 37.0 34.6 37.0 140-144 35.3891 37.0 37.0 37.0 37.0 37.0 145-149 35.2091 37.0 37.0 37.0 27.4 37.0 150-151 34.7725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 3.0 15 2.0 16 5.0 17 1.0 18 0.0 19 5.0 20 3.0 21 4.0 22 4.0 23 5.0 24 7.0 25 11.0 26 7.0 27 19.0 28 14.0 29 25.0 30 24.0 31 45.0 32 62.0 33 75.0 34 196.0 35 528.0 36 2716.0 37 233.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.5 19.55 9.225 30.725 2 33.775 21.9 23.125 21.2 3 24.025 25.900000000000002 25.275 24.8 4 27.6 30.425 17.95 24.025 5 28.249999999999996 30.775000000000002 19.05 21.925 6 24.875 34.8 16.5 23.825 7 24.425 19.85 30.325000000000003 25.4 8 24.099999999999998 22.575 21.7 31.624999999999996 9 25.0 22.15 25.275 27.575 10-14 26.395000000000003 24.62 22.14 26.845000000000002 15-19 26.529999999999998 24.385 22.39 26.695 20-24 26.91 24.015 22.545 26.529999999999998 25-29 26.875 24.529999999999998 22.58 26.015 30-34 26.634999999999998 24.990000000000002 22.215 26.16 35-39 26.6 24.385 22.46 26.555 40-44 26.705000000000002 24.709999999999997 21.94 26.645000000000003 45-49 26.6 24.505 22.325 26.57 50-54 26.875 24.365000000000002 22.869999999999997 25.89 55-59 27.495000000000005 24.185000000000002 22.235 26.085 60-64 27.22 24.14 22.52 26.119999999999997 65-69 26.674999999999997 24.68 22.400000000000002 26.245 70-74 26.935 23.705000000000002 22.605 26.755000000000003 75-79 27.255000000000003 24.01 22.37 26.365 80-84 26.655 24.02 22.835 26.490000000000002 85-89 26.68 24.255 22.825 26.240000000000002 90-94 26.55 23.995 23.26 26.195 95-99 27.435 24.075 23.055 25.435000000000002 100-104 27.79 23.435 22.555 26.22 105-109 26.83 24.3 22.650000000000002 26.22 110-114 27.125 24.34 22.515 26.02 115-119 27.165 24.385 22.395 26.055 120-124 27.065 24.115000000000002 23.215 25.605 125-129 27.145000000000003 23.91 22.650000000000002 26.295 130-134 26.865 24.755 22.6 25.779999999999998 135-139 26.57 24.58 23.23 25.619999999999997 140-144 26.97 24.575 22.99 25.465 145-149 27.615000000000002 24.485 22.5 25.4 150-151 26.875 24.675 22.4875 25.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 1.0 27 2.0 28 1.0 29 1.5 30 4.5 31 6.0 32 7.0 33 9.5 34 16.0 35 24.0 36 22.5 37 31.5 38 54.5 39 75.5 40 100.5 41 111.5 42 125.0 43 146.5 44 162.0 45 165.0 46 163.0 47 156.5 48 144.5 49 148.5 50 128.5 51 118.5 52 127.0 53 119.0 54 112.5 55 103.5 56 84.0 57 67.5 58 80.5 59 96.0 60 94.5 61 94.0 62 88.5 63 92.5 64 103.5 65 87.0 66 87.0 67 93.0 68 88.5 69 80.5 70 70.5 71 62.5 72 44.0 73 39.0 74 35.5 75 25.5 76 22.5 77 17.0 78 11.5 79 10.0 80 4.5 81 3.5 82 4.5 83 2.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.5 89 0.5 90 1.0 91 1.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.82438629619638 86.02499999999999 2 6.6360938764499595 12.3 3 0.43161586188292417 1.2 4 0.08092797410304828 0.3 5 0.0 0.0 6 0.0 0.0 7 0.02697599136768276 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.8999999999999999 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138-139 1.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATGT 10 0.006830828 145.0 3 TGATGTC 10 0.006830828 145.0 4 >>END_MODULE Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322488 spots for SRR7804112.sra Written 2322488 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra Read 2322481 spots for SRR7804112.sra Written 2322481 spots for SRR7804112.sra SRR ids: ['SRR7804112.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__ha665oj SRR7804112.sra spots: 46449627 blocks: [[1, 2322481], [2322482, 4644962], [4644963, 6967443], [6967444, 9289924], [9289925, 11612405], [11612406, 13934886], [13934887, 16257367], [16257368, 18579848], [18579849, 20902329], [20902330, 23224810], [23224811, 25547291], [25547292, 27869772], [27869773, 30192253], [30192254, 32514734], [32514735, 34837215], [34837216, 37159696], [37159697, 39482177], [39482178, 41804658], [41804659, 44127139], [44127140, 46449627]] SRR7804112 file size 15718554 SRR7804112 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804112 SRR7804112_1.fastq SRR7804112_2.fastq Input file: SRR7804112_1.fastq Paired file: SRR7804112_2.fastq trimmed: SRR7804112-trimmed-pair1.fastq, SRR7804112-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:55:15 2024 >> started Tue Dec 10 01:57:00 2024 >> done (105.519s) 46449627 read pairs processed; of these: 123 ( 0.00%) short read pairs filtered out after trimming by size control 731 ( 0.00%) empty read pairs filtered out after trimming by size control 46448773 (100.00%) read pairs available; of these: 1308841 ( 2.82%) trimmed read pairs available after processing 45139932 (97.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 13 0.00% 20 17 0.00% 21 11 0.00% 22 12 0.00% 23 27 0.00% 24 26 0.00% 25 23 0.00% 26 25 0.00% 27 30 0.00% 28 23 0.00% 29 27 0.00% 30 22 0.00% 31 32 0.00% 32 28 0.00% 33 33 0.00% 34 39 0.00% 35 33 0.00% 36 41 0.00% 37 39 0.00% 38 54 0.00% 39 48 0.00% 40 46 0.00% 41 34 0.00% 42 70 0.00% 43 53 0.00% 44 55 0.00% 45 51 0.00% 46 56 0.00% 47 48 0.00% 48 70 0.00% 49 83 0.00% 50 52 0.00% 51 66 0.00% 52 55 0.00% 53 86 0.00% 54 77 0.00% 55 74 0.00% 56 85 0.00% 57 81 0.00% 58 88 0.00% 59 91 0.00% 60 96 0.00% 61 96 0.00% 62 123 0.00% 63 101 0.00% 64 103 0.00% 65 109 0.00% 66 153 0.00% 67 138 0.00% 68 162 0.00% 69 154 0.00% 70 195 0.00% 71 210 0.00% 72 275 0.00% 73 272 0.00% 74 312 0.00% 75 335 0.00% 76 334 0.00% 77 381 0.00% 78 445 0.00% 79 504 0.00% 80 528 0.00% 81 613 0.00% 82 717 0.00% 83 843 0.00% 84 896 0.00% 85 1000 0.00% 86 1092 0.00% 87 1274 0.00% 88 1336 0.00% 89 1476 0.00% 90 1703 0.00% 91 1987 0.00% 92 2300 0.00% 93 2429 0.01% 94 2637 0.01% 95 2913 0.01% 96 3067 0.01% 97 3450 0.01% 98 3822 0.01% 99 3993 0.01% 100 4325 0.01% 101 4720 0.01% 102 5244 0.01% 103 5735 0.01% 104 6242 0.01% 105 6770 0.01% 106 7141 0.02% 107 7404 0.02% 108 8252 0.02% 109 8624 0.02% 110 9148 0.02% 111 9574 0.02% 112 10728 0.02% 113 11095 0.02% 114 12194 0.03% 115 12808 0.03% 116 13338 0.03% 117 14426 0.03% 118 15034 0.03% 119 15513 0.03% 120 16161 0.03% 121 17279 0.04% 122 18127 0.04% 123 19412 0.04% 124 20627 0.04% 125 21633 0.05% 126 22683 0.05% 127 23980 0.05% 128 24365 0.05% 129 25831 0.06% 130 26736 0.06% 131 27487 0.06% 132 29626 0.06% 133 30771 0.07% 134 32112 0.07% 135 33908 0.07% 136 35210 0.08% 137 36332 0.08% 138 37437 0.08% 139 38656 0.08% 140 39575 0.09% 141 41520 0.09% 142 43283 0.09% 143 45016 0.10% 144 47129 0.10% 145 50470 0.11% 146 50466 0.11% 147 52685 0.11% 148 54062 0.12% 149 55483 0.12% 150 57946 0.12% 151 45139932 97.18% 46448773 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=26 prefix-density=0.79 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=26.11 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=24 prefix-density=0.62 prefix-fanout=2.2 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=83.11 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804112 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:58:30 Started mapping on | Dec 10 01:58:30 Finished on | Dec 10 02:04:50 Mapping speed, Million of reads per hour | 440.04 Number of input reads | 46448773 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 42839849 Uniquely mapped reads % | 92.23% Average mapped length | 299.72 Number of splices: Total | 44588623 Number of splices: Annotated (sjdb) | 42051362 Number of splices: GT/AG | 43922511 Number of splices: GC/AG | 543720 Number of splices: AT/AC | 22544 Number of splices: Non-canonical | 99848 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 598053 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 52300 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.55% % of reads unmapped: other | 0.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3010871 3010871 3010871 N_multimapping 598053 598053 598053 N_noFeature 1315792 41654753 1613117 N_ambiguous 1110438 7463 224113 UnstrandedReadsAssigned:40413619 PositiveStrandReadsAssigned:1177633 NegativeStrandReadsAssigned:41002619 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804112 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804112-trimmed-pair1.fastq SRR7804112-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,448,773 reads, 41,429,902 reads pseudoaligned [quant] estimated average fragment length: 301.112 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52973 SRR7804112.ke.tsv 35125 SRR7804112.se.tsv 88098 total ==> SRR7804112.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 636.421 0 0 PNS24247 1044 743.888 145.008 6.17881 PNS24249 1928 1627.89 332.288 6.47009 PNS24246 1044 743.888 145.008 6.17881 PNS24248 1044 743.888 145.008 6.17881 PNS24244 1471 1170.89 226.689 6.1367 PNS24243 293 73.5953 0 0 KQK14069 1603 1302.89 1486.86 36.1729 KQK14071 474 200.809 35.427 5.59205 ==> SRR7804112.se.tsv <== BRADI_1g14170v3 1605 BRADI_1g53295v3 2066 BRADI_1g59795v3 1014 BRADI_1g07683v3 0 BRADI_1g00485v3 95 BRADI_1g20270v3 4665 BRADI_1g74790v3 891 BRADI_1g09890v3 8 BRADI_1g77505v3 783 BRADI_1g48960v3 0 SRR7804112 completed mapping pipeline successfully