Starting /dee2/code/volunteer_pipeline.sh SRR7804113 current disk space = 1525023461376 free memory = 1567293376 SRR7804113 SRAfilesize a2440fbffebca70c8ee91d6c23ba2d48 SRR7804113.sra SRR7804113.sra file validated SRR7804113 is paired end SRR7804113 is conventional basespace SRR7804113 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804113_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1185 37.0 37.0 37.0 37.0 37.0 2 36.25325 37.0 37.0 37.0 37.0 37.0 3 36.328 37.0 37.0 37.0 37.0 37.0 4 36.396 37.0 37.0 37.0 37.0 37.0 5 36.4615 37.0 37.0 37.0 37.0 37.0 6 36.452 37.0 37.0 37.0 37.0 37.0 7 36.437 37.0 37.0 37.0 37.0 37.0 8 36.396 37.0 37.0 37.0 37.0 37.0 9 36.47 37.0 37.0 37.0 37.0 37.0 10-14 36.43769999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4616 37.0 37.0 37.0 37.0 37.0 20-24 36.4504 37.0 37.0 37.0 37.0 37.0 25-29 36.3947 37.0 37.0 37.0 37.0 37.0 30-34 36.361 37.0 37.0 37.0 37.0 37.0 35-39 36.3492 37.0 37.0 37.0 37.0 37.0 40-44 36.3849 37.0 37.0 37.0 37.0 37.0 45-49 36.347300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.313900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.327200000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.2737 37.0 37.0 37.0 37.0 37.0 65-69 36.2345 37.0 37.0 37.0 37.0 37.0 70-74 36.2016 37.0 37.0 37.0 37.0 37.0 75-79 36.202200000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.125600000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.1164 37.0 37.0 37.0 37.0 37.0 90-94 36.096000000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.0827 37.0 37.0 37.0 37.0 37.0 100-104 36.0915 37.0 37.0 37.0 37.0 37.0 105-109 35.962999999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.022000000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.919399999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.9222 37.0 37.0 37.0 37.0 37.0 125-129 35.8962 37.0 37.0 37.0 37.0 37.0 130-134 35.828700000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.7875 37.0 37.0 37.0 37.0 37.0 140-144 35.7337 37.0 37.0 37.0 37.0 37.0 145-149 35.699999999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.19125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 0.0 25 3.0 26 3.0 27 16.0 28 17.0 29 26.0 30 41.0 31 42.0 32 62.0 33 84.0 34 152.0 35 314.0 36 2816.0 37 422.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.300000000000004 12.7 9.0 33.0 2 27.85696424106027 13.753438359589898 29.68242060515129 28.707176794198553 3 23.45 18.475 24.099999999999998 33.975 4 26.575 23.974999999999998 21.125 28.325 5 27.474999999999998 28.199999999999996 21.975 22.35 6 27.05 28.725 21.475 22.75 7 20.925 22.5 35.025 21.55 8 23.925 21.95 26.700000000000003 27.425 9 22.55 20.424999999999997 29.925 27.1 10-14 25.56 23.73 23.955000000000002 26.755000000000003 15-19 25.305 23.635 23.7 27.36 20-24 25.515 23.685000000000002 23.97 26.83 25-29 25.169999999999998 23.97 23.369999999999997 27.49 30-34 25.624999999999996 23.62 23.21 27.544999999999998 35-39 25.705 22.994999999999997 24.37 26.93 40-44 25.064999999999998 23.215 24.16 27.560000000000002 45-49 25.624999999999996 23.235 23.815 27.325 50-54 25.230000000000004 23.150000000000002 23.575 28.044999999999998 55-59 25.695 23.125 23.91 27.27 60-64 25.765 23.23 23.580000000000002 27.425 65-69 25.424999999999997 22.79 23.77 28.015 70-74 25.619999999999997 22.71 23.845 27.825 75-79 26.545 23.05 23.09 27.315 80-84 25.655 23.515 23.535 27.295 85-89 26.314999999999998 23.21 23.115 27.36 90-94 26.755000000000003 22.555 23.27 27.42 95-99 26.400000000000002 22.665 23.095 27.839999999999996 100-104 26.724999999999998 22.37 23.395 27.51 105-109 26.44 22.37 23.705000000000002 27.485 110-114 26.400000000000002 22.67 22.91 28.02 115-119 26.674999999999997 22.58 23.05 27.694999999999997 120-124 26.16 22.689999999999998 23.77 27.38 125-129 26.779999999999998 23.145 22.525000000000002 27.55 130-134 26.605 23.25 22.725 27.42 135-139 26.474999999999998 22.595000000000002 22.74 28.189999999999998 140-144 26.93 22.515 23.62 26.935 145-149 26.534999999999997 21.955 23.405 28.105000000000004 150-151 26.7125 22.537499999999998 23.075000000000003 27.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 1.5 29 3.5 30 8.5 31 6.5 32 7.0 33 18.0 34 19.0 35 22.0 36 29.5 37 41.5 38 55.0 39 62.5 40 83.0 41 98.5 42 120.5 43 141.5 44 140.0 45 153.5 46 154.5 47 137.0 48 153.0 49 159.0 50 139.5 51 136.5 52 125.0 53 103.5 54 106.5 55 103.5 56 100.0 57 110.0 58 111.5 59 105.0 60 100.0 61 93.5 62 84.5 63 92.5 64 98.0 65 95.5 66 99.0 67 77.0 68 61.0 69 68.5 70 66.0 71 63.5 72 54.5 73 50.0 74 42.5 75 28.0 76 20.5 77 14.0 78 8.5 79 5.5 80 9.0 81 7.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 93.76498800959233 87.97500000000001 2 5.915267785771383 11.1 3 0.29309885424993337 0.8250000000000001 4 0.02664535038635758 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2625000000000002 0.0 0.0 0.0 0.0 130-131 1.3875 0.0 0.0 0.0 0.0 132-133 1.5125000000000002 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.825 0.0 0.0 0.0 0.0 138-139 1.9874999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804113 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804113_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.34575 37.0 37.0 37.0 37.0 37.0 2 36.008 37.0 37.0 37.0 37.0 37.0 3 36.0805 37.0 37.0 37.0 37.0 37.0 4 36.17 37.0 37.0 37.0 37.0 37.0 5 36.1085 37.0 37.0 37.0 37.0 37.0 6 36.1475 37.0 37.0 37.0 37.0 37.0 7 36.032 37.0 37.0 37.0 37.0 37.0 8 36.1655 37.0 37.0 37.0 37.0 37.0 9 36.004 37.0 37.0 37.0 37.0 37.0 10-14 36.11919999999999 37.0 37.0 37.0 37.0 37.0 15-19 35.99490000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.011700000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.9165 37.0 37.0 37.0 37.0 37.0 30-34 35.934999999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.8809 37.0 37.0 37.0 37.0 37.0 40-44 35.7923 37.0 37.0 37.0 37.0 37.0 45-49 35.7807 37.0 37.0 37.0 37.0 37.0 50-54 35.7761 37.0 37.0 37.0 37.0 37.0 55-59 35.7245 37.0 37.0 37.0 37.0 37.0 60-64 35.7228 37.0 37.0 37.0 37.0 37.0 65-69 35.650099999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.616200000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.5424 37.0 37.0 37.0 37.0 37.0 80-84 35.5751 37.0 37.0 37.0 37.0 37.0 85-89 35.5774 37.0 37.0 37.0 37.0 37.0 90-94 35.585499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.5362 37.0 37.0 37.0 37.0 37.0 100-104 35.5393 37.0 37.0 37.0 37.0 37.0 105-109 35.4285 37.0 37.0 37.0 37.0 37.0 110-114 35.3566 37.0 37.0 37.0 37.0 37.0 115-119 35.335499999999996 37.0 37.0 37.0 34.6 37.0 120-124 35.3883 37.0 37.0 37.0 37.0 37.0 125-129 35.25 37.0 37.0 37.0 34.6 37.0 130-134 35.2899 37.0 37.0 37.0 37.0 37.0 135-139 35.192099999999996 37.0 37.0 37.0 32.2 37.0 140-144 35.1384 37.0 37.0 37.0 27.4 37.0 145-149 34.9993 37.0 37.0 37.0 25.0 37.0 150-151 34.5605 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 7.0 14 14.0 15 5.0 16 6.0 17 5.0 18 1.0 19 2.0 20 10.0 21 5.0 22 13.0 23 12.0 24 8.0 25 5.0 26 18.0 27 10.0 28 16.0 29 39.0 30 25.0 31 50.0 32 58.0 33 81.0 34 182.0 35 537.0 36 2621.0 37 270.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.30447835876908 18.21366024518389 10.557918438829123 31.923942957217914 2 32.725 20.125 23.325000000000003 23.825 3 25.5 23.35 25.374999999999996 25.775 4 27.425 29.525000000000002 17.5 25.55 5 28.9 29.375 18.275 23.45 6 25.55 32.875 17.474999999999998 24.099999999999998 7 25.275 18.775 29.549999999999997 26.400000000000002 8 26.200000000000003 21.75 20.625 31.424999999999997 9 26.924999999999997 21.224999999999998 23.25 28.599999999999998 10-14 28.21 23.76 20.294999999999998 27.735 15-19 26.979999999999997 23.465 22.18 27.375 20-24 27.944999999999997 23.94 21.12 26.995 25-29 28.025 23.75 21.005 27.22 30-34 27.755000000000003 23.345 21.63 27.27 35-39 27.29 23.625 21.64 27.445000000000004 40-44 27.639999999999997 23.244999999999997 21.36 27.755000000000003 45-49 27.800000000000004 23.48 21.375 27.345000000000002 50-54 28.349999999999998 22.825 21.745 27.08 55-59 28.225 23.145 21.224999999999998 27.405 60-64 27.500000000000004 23.125 21.195 28.18 65-69 28.075 22.675 21.634999999999998 27.615000000000002 70-74 27.32 22.735 22.005 27.939999999999998 75-79 28.015 23.275000000000002 21.65 27.060000000000002 80-84 27.61 23.595 21.995 26.8 85-89 27.815 23.855 20.560000000000002 27.77 90-94 27.715 23.330000000000002 21.855 27.1 95-99 27.52 23.68 21.545 27.255000000000003 100-104 28.01 23.365 21.07 27.555000000000003 105-109 27.529999999999998 23.76 21.634999999999998 27.075 110-114 27.855 23.72 21.01 27.415 115-119 27.894999999999996 23.43 21.205 27.47 120-124 27.37 23.599999999999998 21.75 27.279999999999998 125-129 28.52 23.405 21.634999999999998 26.44 130-134 27.82 23.555 21.73 26.895000000000003 135-139 28.205000000000002 23.82 21.84 26.135 140-144 28.505000000000003 23.580000000000002 22.040000000000003 25.874999999999996 145-149 28.694999999999997 23.87 21.285 26.150000000000002 150-151 27.250000000000004 24.099999999999998 22.400000000000002 26.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.5 13 1.5 14 1.0 15 2.0 16 2.0 17 3.0 18 2.0 19 1.0 20 2.0 21 1.5 22 0.5 23 0.5 24 1.0 25 0.5 26 0.5 27 1.0 28 2.0 29 3.0 30 3.5 31 5.0 32 5.0 33 7.0 34 14.0 35 19.0 36 25.0 37 35.5 38 45.5 39 54.0 40 72.5 41 88.5 42 105.5 43 117.0 44 114.0 45 119.0 46 120.0 47 124.5 48 121.0 49 109.0 50 116.5 51 115.5 52 109.0 53 106.0 54 103.5 55 111.0 56 109.5 57 108.0 58 105.5 59 110.0 60 125.5 61 120.0 62 118.0 63 115.5 64 109.5 65 107.0 66 96.0 67 95.5 68 99.0 69 88.0 70 77.0 71 80.5 72 71.5 73 63.5 74 58.5 75 35.0 76 19.5 77 18.0 78 17.0 79 9.5 80 3.5 81 7.0 82 7.0 83 2.0 84 1.0 85 1.5 86 0.5 87 1.0 88 2.0 89 1.5 90 0.5 91 1.0 92 1.5 93 0.5 94 0.0 95 0.0 96 0.5 97 1.5 98 1.5 99 1.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.45895020188425 86.8 2 5.895020188425303 10.95 3 0.48452220726783307 1.35 4 0.10767160161507401 0.4 5 0.026917900403768503 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026917900403768503 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit CGTCGAGAACCTCTTCGACCACGTCGCTGACCCAGTCAACAACAATGCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.2625000000000002 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.7125 0.0 0.0 0.0 0.0 136-137 1.85 0.0 0.0 0.0 0.0 138-139 2.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105258 spots for SRR7804113.sra Written 1105258 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra Read 1105241 spots for SRR7804113.sra Written 1105241 spots for SRR7804113.sra SRR ids: ['SRR7804113.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0b3ldlwi SRR7804113.sra spots: 22104837 blocks: [[1, 1105241], [1105242, 2210482], [2210483, 3315723], [3315724, 4420964], [4420965, 5526205], [5526206, 6631446], [6631447, 7736687], [7736688, 8841928], [8841929, 9947169], [9947170, 11052410], [11052411, 12157651], [12157652, 13262892], [13262893, 14368133], [14368134, 15473374], [15473375, 16578615], [16578616, 17683856], [17683857, 18789097], [18789098, 19894338], [19894339, 20999579], [20999580, 22104837]] SRR7804113 file size 7468903 SRR7804113 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804113 SRR7804113_1.fastq SRR7804113_2.fastq Input file: SRR7804113_1.fastq Paired file: SRR7804113_2.fastq trimmed: SRR7804113-trimmed-pair1.fastq, SRR7804113-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:59:48 2024 >> started Tue Dec 10 02:00:15 2024 >> done (26.354s) 22104837 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 619 ( 0.00%) empty read pairs filtered out after trimming by size control 22104138 (100.00%) read pairs available; of these: 728941 ( 3.30%) trimmed read pairs available after processing 21375197 (96.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 11 0.00% 21 4 0.00% 22 7 0.00% 23 4 0.00% 24 7 0.00% 25 15 0.00% 26 13 0.00% 27 18 0.00% 28 16 0.00% 29 17 0.00% 30 19 0.00% 31 17 0.00% 32 17 0.00% 33 21 0.00% 34 20 0.00% 35 18 0.00% 36 32 0.00% 37 23 0.00% 38 35 0.00% 39 29 0.00% 40 32 0.00% 41 32 0.00% 42 23 0.00% 43 24 0.00% 44 32 0.00% 45 36 0.00% 46 37 0.00% 47 26 0.00% 48 37 0.00% 49 33 0.00% 50 37 0.00% 51 32 0.00% 52 44 0.00% 53 47 0.00% 54 41 0.00% 55 56 0.00% 56 42 0.00% 57 43 0.00% 58 52 0.00% 59 44 0.00% 60 47 0.00% 61 52 0.00% 62 63 0.00% 63 78 0.00% 64 78 0.00% 65 85 0.00% 66 70 0.00% 67 76 0.00% 68 78 0.00% 69 110 0.00% 70 102 0.00% 71 124 0.00% 72 149 0.00% 73 140 0.00% 74 182 0.00% 75 182 0.00% 76 205 0.00% 77 205 0.00% 78 225 0.00% 79 289 0.00% 80 305 0.00% 81 330 0.00% 82 416 0.00% 83 465 0.00% 84 496 0.00% 85 630 0.00% 86 580 0.00% 87 718 0.00% 88 800 0.00% 89 877 0.00% 90 997 0.00% 91 1061 0.00% 92 1262 0.01% 93 1490 0.01% 94 1573 0.01% 95 1712 0.01% 96 1908 0.01% 97 2054 0.01% 98 2110 0.01% 99 2244 0.01% 100 2492 0.01% 101 2812 0.01% 102 3135 0.01% 103 3346 0.02% 104 3731 0.02% 105 3949 0.02% 106 4099 0.02% 107 4425 0.02% 108 4605 0.02% 109 4937 0.02% 110 5154 0.02% 111 5599 0.03% 112 6111 0.03% 113 6531 0.03% 114 7054 0.03% 115 7465 0.03% 116 7926 0.04% 117 8207 0.04% 118 8402 0.04% 119 8705 0.04% 120 9359 0.04% 121 9693 0.04% 122 10399 0.05% 123 10992 0.05% 124 11880 0.05% 125 12477 0.06% 126 12954 0.06% 127 13390 0.06% 128 13989 0.06% 129 14438 0.07% 130 14753 0.07% 131 15362 0.07% 132 16368 0.07% 133 17477 0.08% 134 18184 0.08% 135 18975 0.09% 136 19913 0.09% 137 20435 0.09% 138 20382 0.09% 139 20956 0.09% 140 21687 0.10% 141 22807 0.10% 142 23578 0.11% 143 24548 0.11% 144 25766 0.12% 145 26896 0.12% 146 27858 0.13% 147 28792 0.13% 148 29454 0.13% 149 29850 0.14% 150 30967 0.14% 151 21375197 96.70% 22104138 reads passed initial QC criterion=sequence-density sequence-density=1.24 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=25 prefix-density=1.27 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.32 sequence-density-rank=31 fanout-score=12.18 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=9 prefix-density=1.08 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=30.03 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.3 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804113 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:01:04 Started mapping on | Dec 10 02:01:04 Finished on | Dec 10 02:04:45 Mapping speed, Million of reads per hour | 360.07 Number of input reads | 22104138 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20073651 Uniquely mapped reads % | 90.81% Average mapped length | 299.55 Number of splices: Total | 18495852 Number of splices: Annotated (sjdb) | 17525124 Number of splices: GT/AG | 18241836 Number of splices: GC/AG | 205947 Number of splices: AT/AC | 5555 Number of splices: Non-canonical | 42514 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305576 % of reads mapped to multiple loci | 1.38% Number of reads mapped to too many loci | 25919 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.77% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1724911 1724911 1724911 N_multimapping 305576 305576 305576 N_noFeature 533767 19502435 697366 N_ambiguous 532225 3178 125293 UnstrandedReadsAssigned:19007659 PositiveStrandReadsAssigned:568038 NegativeStrandReadsAssigned:19250992 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804113 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804113-trimmed-pair1.fastq SRR7804113-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,104,138 reads, 19,575,365 reads pseudoaligned [quant] estimated average fragment length: 297.561 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52973 SRR7804113.ke.tsv 35125 SRR7804113.se.tsv 88098 total ==> SRR7804113.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 640.001 0 0 PNS24247 1044 747.439 52.2099 4.42376 PNS24249 1928 1631.44 126.059 4.89349 PNS24246 1044 747.439 52.2099 4.42376 PNS24248 1044 747.439 52.2099 4.42376 PNS24244 1471 1174.44 55.311 2.9826 PNS24243 293 76.164 0 0 KQK14069 1603 1306.44 4388.57 212.74 KQK14071 474 204.185 63.7819 19.7828 ==> SRR7804113.se.tsv <== BRADI_1g14170v3 4568 BRADI_1g53295v3 479 BRADI_1g59795v3 292 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 228 BRADI_1g74790v3 611 BRADI_1g09890v3 1 BRADI_1g77505v3 192 BRADI_1g48960v3 0 SRR7804113 completed mapping pipeline successfully