Starting /dee2/code/volunteer_pipeline.sh SRR7804115 current disk space = 1525023461376 free memory = 1567289580 SRR7804115 SRAfilesize 7b0fae78610198bb0d2aedd329b3d930 SRR7804115.sra SRR7804115.sra file validated SRR7804115 is paired end SRR7804115 is conventional basespace SRR7804115 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804115_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.322 37.0 37.0 37.0 37.0 37.0 2 36.27425 37.0 37.0 37.0 37.0 37.0 3 36.3495 37.0 37.0 37.0 37.0 37.0 4 36.3505 37.0 37.0 37.0 37.0 37.0 5 36.503 37.0 37.0 37.0 37.0 37.0 6 36.366 37.0 37.0 37.0 37.0 37.0 7 36.427 37.0 37.0 37.0 37.0 37.0 8 36.437 37.0 37.0 37.0 37.0 37.0 9 36.4035 37.0 37.0 37.0 37.0 37.0 10-14 36.4861 37.0 37.0 37.0 37.0 37.0 15-19 36.4446 37.0 37.0 37.0 37.0 37.0 20-24 36.393299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.377300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3918 37.0 37.0 37.0 37.0 37.0 35-39 36.370099999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.36390000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3377 37.0 37.0 37.0 37.0 37.0 50-54 36.3257 37.0 37.0 37.0 37.0 37.0 55-59 36.2803 37.0 37.0 37.0 37.0 37.0 60-64 36.3382 37.0 37.0 37.0 37.0 37.0 65-69 36.250099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.211 37.0 37.0 37.0 37.0 37.0 75-79 36.21419999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.175599999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.1371 37.0 37.0 37.0 37.0 37.0 90-94 36.1628 37.0 37.0 37.0 37.0 37.0 95-99 36.1371 37.0 37.0 37.0 37.0 37.0 100-104 36.0771 37.0 37.0 37.0 37.0 37.0 105-109 36.0045 37.0 37.0 37.0 37.0 37.0 110-114 35.9895 37.0 37.0 37.0 37.0 37.0 115-119 35.958800000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.9146 37.0 37.0 37.0 37.0 37.0 125-129 35.8428 37.0 37.0 37.0 37.0 37.0 130-134 35.8215 37.0 37.0 37.0 37.0 37.0 135-139 35.7875 37.0 37.0 37.0 37.0 37.0 140-144 35.791 37.0 37.0 37.0 37.0 37.0 145-149 35.7492 37.0 37.0 37.0 37.0 37.0 150-151 35.2205 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 3.0 26 6.0 27 14.0 28 8.0 29 27.0 30 32.0 31 42.0 32 50.0 33 101.0 34 152.0 35 351.0 36 2822.0 37 389.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.15 13.225000000000001 9.1 32.525 2 28.04603452589442 13.209907430572928 30.2727045283963 28.471353515136354 3 24.025 18.35 25.45 32.175 4 27.200000000000003 26.375 20.875 25.55 5 27.05 26.525 22.95 23.474999999999998 6 25.900000000000002 29.875 21.975 22.25 7 20.150000000000002 23.65 35.675000000000004 20.525 8 23.0 22.675 27.150000000000002 27.175 9 21.45 19.725 30.425 28.4 10-14 24.895 24.465 24.085 26.555 15-19 25.480000000000004 23.28 24.5 26.740000000000002 20-24 25.61 23.630000000000003 24.305 26.455000000000002 25-29 25.665 24.065 24.044999999999998 26.224999999999998 30-34 25.290000000000003 24.0 23.895 26.815 35-39 25.09 23.555 24.26 27.095000000000002 40-44 25.83 23.974999999999998 23.275000000000002 26.919999999999998 45-49 25.374999999999996 23.724999999999998 23.419999999999998 27.48 50-54 25.555 23.695 23.695 27.055 55-59 24.94 23.855 23.95 27.255000000000003 60-64 25.235000000000003 23.549999999999997 23.799999999999997 27.415 65-69 25.869999999999997 23.335 23.585 27.21 70-74 25.580000000000002 23.535 23.54 27.345000000000002 75-79 25.735000000000003 22.74 24.335 27.189999999999998 80-84 26.115 23.57 22.645 27.67 85-89 26.085 23.87 23.165 26.88 90-94 26.334999999999997 22.720000000000002 23.799999999999997 27.145000000000003 95-99 26.075 22.835 23.1 27.99 100-104 26.424999999999997 22.955000000000002 23.48 27.139999999999997 105-109 25.885 23.31 23.47 27.334999999999997 110-114 26.61 23.44 22.585 27.365000000000002 115-119 26.11 22.95 23.345 27.595 120-124 25.995 22.925 23.395 27.685 125-129 26.314999999999998 22.775000000000002 23.28 27.63 130-134 26.58 22.49 23.865 27.065 135-139 26.14 22.99 23.895 26.974999999999998 140-144 26.125 22.59 23.73 27.555000000000003 145-149 26.66 22.634999999999998 23.41 27.295 150-151 26.55 22.4375 23.7625 27.250000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.5 27 1.5 28 3.5 29 6.5 30 5.5 31 5.0 32 6.0 33 11.5 34 18.0 35 29.5 36 38.5 37 46.5 38 61.5 39 77.5 40 90.5 41 89.0 42 106.0 43 139.0 44 160.5 45 168.5 46 169.5 47 175.0 48 169.0 49 153.0 50 132.0 51 127.5 52 127.0 53 107.5 54 103.0 55 102.0 56 100.5 57 95.0 58 81.0 59 92.0 60 107.5 61 106.5 62 88.5 63 72.5 64 84.0 65 95.5 66 84.5 67 77.0 68 76.5 69 66.0 70 62.0 71 58.5 72 51.5 73 46.0 74 33.0 75 22.0 76 19.0 77 16.5 78 11.5 79 7.0 80 4.5 81 4.5 82 3.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.01436552274541 88.35 2 5.58659217877095 10.5 3 0.37243947858473 1.05 4 0.026602819898909287 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.42500000000000004 0.0 0.0 0.0 0.0 126-127 0.4875 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.625 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.825 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138-139 1.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCCTC 10 0.006830828 145.0 6 TCCAGGG 10 0.006830828 145.0 7 CTTGAGG 10 0.006830828 145.0 6 >>END_MODULE SRR7804115 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804115_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31425 37.0 37.0 37.0 37.0 37.0 2 36.0825 37.0 37.0 37.0 37.0 37.0 3 36.0885 37.0 37.0 37.0 37.0 37.0 4 36.2465 37.0 37.0 37.0 37.0 37.0 5 36.136 37.0 37.0 37.0 37.0 37.0 6 36.1915 37.0 37.0 37.0 37.0 37.0 7 36.141 37.0 37.0 37.0 37.0 37.0 8 36.2255 37.0 37.0 37.0 37.0 37.0 9 36.128 37.0 37.0 37.0 37.0 37.0 10-14 36.1314 37.0 37.0 37.0 37.0 37.0 15-19 36.0727 37.0 37.0 37.0 37.0 37.0 20-24 36.0373 37.0 37.0 37.0 37.0 37.0 25-29 36.0133 37.0 37.0 37.0 37.0 37.0 30-34 36.0376 37.0 37.0 37.0 37.0 37.0 35-39 35.9713 37.0 37.0 37.0 37.0 37.0 40-44 35.9311 37.0 37.0 37.0 37.0 37.0 45-49 35.884 37.0 37.0 37.0 37.0 37.0 50-54 35.806 37.0 37.0 37.0 37.0 37.0 55-59 35.8149 37.0 37.0 37.0 37.0 37.0 60-64 35.7589 37.0 37.0 37.0 37.0 37.0 65-69 35.73800000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.754000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.721500000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.672 37.0 37.0 37.0 37.0 37.0 85-89 35.6964 37.0 37.0 37.0 37.0 37.0 90-94 35.710499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.6048 37.0 37.0 37.0 37.0 37.0 100-104 35.6177 37.0 37.0 37.0 37.0 37.0 105-109 35.5515 37.0 37.0 37.0 37.0 37.0 110-114 35.402300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.3932 37.0 37.0 37.0 37.0 37.0 120-124 35.3688 37.0 37.0 37.0 37.0 37.0 125-129 35.3638 37.0 37.0 37.0 37.0 37.0 130-134 35.3621 37.0 37.0 37.0 37.0 37.0 135-139 35.221799999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.2445 37.0 37.0 37.0 34.6 37.0 145-149 35.1394 37.0 37.0 37.0 29.8 37.0 150-151 34.6035 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 8.0 15 6.0 16 4.0 17 3.0 18 4.0 19 4.0 20 8.0 21 8.0 22 16.0 23 7.0 24 9.0 25 8.0 26 12.0 27 11.0 28 15.0 29 24.0 30 21.0 31 37.0 32 60.0 33 105.0 34 184.0 35 517.0 36 2623.0 37 301.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.481110833124845 17.43807855891919 11.308481361020766 29.772329246935204 2 31.674999999999997 20.8 23.3 24.224999999999998 3 25.650000000000002 23.7 26.025 24.625 4 28.725 27.85 17.8 25.624999999999996 5 29.599999999999998 30.65 17.275 22.475 6 24.975 33.650000000000006 16.900000000000002 24.474999999999998 7 23.974999999999998 19.2 31.324999999999996 25.5 8 25.674999999999997 22.0 19.725 32.6 9 24.85 23.1 23.525 28.525 10-14 27.045 24.19 21.265 27.500000000000004 15-19 27.084999999999997 23.395 21.834999999999997 27.685 20-24 26.474999999999998 24.425 21.66 27.439999999999998 25-29 26.384999999999998 24.575 21.86 27.18 30-34 26.8 24.67 21.865000000000002 26.665 35-39 26.419999999999998 24.02 21.68 27.88 40-44 27.915 23.75 21.01 27.325 45-49 27.334999999999997 23.849999999999998 22.005 26.810000000000002 50-54 27.439999999999998 24.349999999999998 21.315 26.895000000000003 55-59 27.46 24.165 21.12 27.255000000000003 60-64 26.93 23.494999999999997 21.87 27.705000000000002 65-69 26.985 24.325 21.365000000000002 27.325 70-74 27.125 23.549999999999997 21.82 27.505000000000003 75-79 27.200000000000003 23.32 22.165000000000003 27.315 80-84 27.169999999999998 24.175 21.905 26.75 85-89 27.26 23.605 21.945 27.189999999999998 90-94 27.41 23.419999999999998 22.17 27.0 95-99 27.894999999999996 24.0 21.52 26.584999999999997 100-104 27.650000000000002 23.76 21.875 26.715 105-109 27.105 23.380000000000003 22.1 27.415 110-114 27.515 23.865 21.45 27.169999999999998 115-119 27.425 24.01 21.84 26.724999999999998 120-124 27.279999999999998 23.635 22.185 26.900000000000002 125-129 27.794999999999998 23.56 21.634999999999998 27.01 130-134 27.925 23.695 21.705 26.674999999999997 135-139 27.27 24.195 21.709999999999997 26.825 140-144 27.625 24.279999999999998 21.57 26.525 145-149 27.91 24.065 21.825 26.200000000000003 150-151 27.224999999999998 24.025 22.175 26.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.5 21 2.5 22 1.5 23 1.5 24 1.0 25 0.5 26 1.0 27 2.5 28 2.0 29 3.5 30 8.0 31 8.0 32 6.5 33 10.5 34 16.5 35 19.5 36 21.5 37 31.0 38 37.5 39 50.5 40 72.0 41 91.0 42 119.0 43 121.5 44 114.0 45 116.0 46 128.5 47 151.0 48 155.5 49 153.5 50 146.5 51 129.0 52 114.5 53 101.0 54 105.5 55 113.5 56 96.0 57 93.0 58 110.5 59 111.0 60 95.5 61 98.5 62 109.0 63 104.0 64 100.0 65 102.0 66 92.0 67 87.5 68 91.0 69 88.0 70 85.5 71 75.0 72 58.5 73 48.5 74 38.5 75 31.5 76 29.0 77 23.5 78 16.0 79 12.0 80 8.5 81 3.5 82 4.0 83 2.5 84 0.5 85 0.5 86 0.0 87 1.0 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 1.0 94 1.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.45 #Duplication Level Percentage of deduplicated Percentage of total 1 93.6864633493847 87.55 2 5.831995719636169 10.9 3 0.40128410914927765 1.125 4 0.05350454788657035 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026752273943285176 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4625 0.0 0.0 0.0 0.0 128-129 0.55 0.0 0.0 0.0 0.0 130-131 0.6 0.0 0.0 0.0 0.0 132-133 0.725 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.9624999999999999 0.0 0.0 0.0 0.0 138-139 1.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227068 spots for SRR7804115.sra Written 1227068 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra Read 1227052 spots for SRR7804115.sra Written 1227052 spots for SRR7804115.sra SRR ids: ['SRR7804115.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hrcl8eg2 SRR7804115.sra spots: 24541056 blocks: [[1, 1227052], [1227053, 2454104], [2454105, 3681156], [3681157, 4908208], [4908209, 6135260], [6135261, 7362312], [7362313, 8589364], [8589365, 9816416], [9816417, 11043468], [11043469, 12270520], [12270521, 13497572], [13497573, 14724624], [14724625, 15951676], [15951677, 17178728], [17178729, 18405780], [18405781, 19632832], [19632833, 20859884], [20859885, 22086936], [22086937, 23313988], [23313989, 24541056]] SRR7804115 file size 8294458 SRR7804115 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804115 SRR7804115_1.fastq SRR7804115_2.fastq Input file: SRR7804115_1.fastq Paired file: SRR7804115_2.fastq trimmed: SRR7804115-trimmed-pair1.fastq, SRR7804115-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:00:53 2024 >> started Tue Dec 10 02:01:22 2024 >> done (28.882s) 24541056 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 448 ( 0.00%) empty read pairs filtered out after trimming by size control 24540531 (100.00%) read pairs available; of these: 552648 ( 2.25%) trimmed read pairs available after processing 23987883 (97.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 16 0.00% 21 14 0.00% 22 15 0.00% 23 8 0.00% 24 14 0.00% 25 14 0.00% 26 14 0.00% 27 19 0.00% 28 14 0.00% 29 18 0.00% 30 27 0.00% 31 28 0.00% 32 22 0.00% 33 25 0.00% 34 16 0.00% 35 32 0.00% 36 28 0.00% 37 33 0.00% 38 33 0.00% 39 34 0.00% 40 36 0.00% 41 46 0.00% 42 42 0.00% 43 39 0.00% 44 38 0.00% 45 44 0.00% 46 35 0.00% 47 38 0.00% 48 40 0.00% 49 54 0.00% 50 40 0.00% 51 44 0.00% 52 50 0.00% 53 48 0.00% 54 48 0.00% 55 58 0.00% 56 58 0.00% 57 68 0.00% 58 61 0.00% 59 64 0.00% 60 61 0.00% 61 74 0.00% 62 62 0.00% 63 78 0.00% 64 90 0.00% 65 58 0.00% 66 91 0.00% 67 106 0.00% 68 88 0.00% 69 78 0.00% 70 113 0.00% 71 122 0.00% 72 112 0.00% 73 143 0.00% 74 130 0.00% 75 146 0.00% 76 144 0.00% 77 166 0.00% 78 168 0.00% 79 190 0.00% 80 210 0.00% 81 223 0.00% 82 278 0.00% 83 280 0.00% 84 345 0.00% 85 361 0.00% 86 402 0.00% 87 418 0.00% 88 490 0.00% 89 523 0.00% 90 534 0.00% 91 613 0.00% 92 741 0.00% 93 843 0.00% 94 953 0.00% 95 994 0.00% 96 1095 0.00% 97 1156 0.00% 98 1258 0.01% 99 1383 0.01% 100 1453 0.01% 101 1679 0.01% 102 1859 0.01% 103 2057 0.01% 104 2178 0.01% 105 2345 0.01% 106 2655 0.01% 107 2687 0.01% 108 2929 0.01% 109 3125 0.01% 110 3278 0.01% 111 3651 0.01% 112 3889 0.02% 113 4231 0.02% 114 4645 0.02% 115 4982 0.02% 116 5287 0.02% 117 5467 0.02% 118 5763 0.02% 119 5986 0.02% 120 6380 0.03% 121 6832 0.03% 122 7241 0.03% 123 7926 0.03% 124 8313 0.03% 125 8598 0.04% 126 9275 0.04% 127 9585 0.04% 128 9844 0.04% 129 10625 0.04% 130 10980 0.04% 131 11461 0.05% 132 12215 0.05% 133 12992 0.05% 134 13840 0.06% 135 14463 0.06% 136 15179 0.06% 137 15496 0.06% 138 16175 0.07% 139 16834 0.07% 140 17235 0.07% 141 17837 0.07% 142 19003 0.08% 143 19881 0.08% 144 20784 0.08% 145 22573 0.09% 146 23250 0.09% 147 24101 0.10% 148 24846 0.10% 149 25500 0.10% 150 26528 0.11% 151 23987883 97.75% 24540531 reads passed initial QC criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=24 prefix-density=1.16 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=25.11 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=17 prefix-density=0.97 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGACGGCAGGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=35.89 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804115 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:02:48 Started mapping on | Dec 10 02:02:48 Finished on | Dec 10 02:06:06 Mapping speed, Million of reads per hour | 446.19 Number of input reads | 24540531 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 21893989 Uniquely mapped reads % | 89.22% Average mapped length | 292.26 Number of splices: Total | 21476482 Number of splices: Annotated (sjdb) | 20297893 Number of splices: GT/AG | 21167237 Number of splices: GC/AG | 255538 Number of splices: AT/AC | 8061 Number of splices: Non-canonical | 45646 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 3.12 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311270 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 31578 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.69% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2335272 2335272 2335272 N_multimapping 311270 311270 311270 N_noFeature 618328 21314145 756153 N_ambiguous 571830 4155 129955 UnstrandedReadsAssigned:20703831 PositiveStrandReadsAssigned:575689 NegativeStrandReadsAssigned:21007881 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR7804115 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804115-trimmed-pair1.fastq SRR7804115-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,540,531 reads, 21,786,421 reads pseudoaligned [quant] estimated average fragment length: 294.342 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52973 SRR7804115.ke.tsv 35125 SRR7804115.se.tsv 88098 total ==> SRR7804115.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 643.263 0 0 PNS24247 1044 750.658 61.0823 4.66118 PNS24249 1928 1634.66 138.884 4.86685 PNS24246 1044 750.658 61.0823 4.66118 PNS24248 1044 750.658 61.0823 4.66118 PNS24244 1471 1177.66 61.869 3.00937 PNS24243 293 75.3958 0 0 KQK14069 1603 1309.66 16698.1 730.35 KQK14071 474 205.485 285.435 79.57 ==> SRR7804115.se.tsv <== BRADI_1g14170v3 17295 BRADI_1g53295v3 1140 BRADI_1g59795v3 295 BRADI_1g07683v3 0 BRADI_1g00485v3 35 BRADI_1g20270v3 2488 BRADI_1g74790v3 741 BRADI_1g09890v3 18 BRADI_1g77505v3 280 BRADI_1g48960v3 0 SRR7804115 completed mapping pipeline successfully