Starting /dee2/code/volunteer_pipeline.sh SRR7804116 current disk space = 1525023461376 free memory = 1567290268 SRR7804116 SRAfilesize d1841e6110a2dba63387177d26b74330 SRR7804116.sra SRR7804116.sra file validated SRR7804116 is paired end SRR7804116 is conventional basespace SRR7804116 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804116_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.145 37.0 37.0 37.0 37.0 37.0 2 36.28125 37.0 37.0 37.0 37.0 37.0 3 36.2745 37.0 37.0 37.0 37.0 37.0 4 36.4585 37.0 37.0 37.0 37.0 37.0 5 36.504 37.0 37.0 37.0 37.0 37.0 6 36.4335 37.0 37.0 37.0 37.0 37.0 7 36.4375 37.0 37.0 37.0 37.0 37.0 8 36.406 37.0 37.0 37.0 37.0 37.0 9 36.4675 37.0 37.0 37.0 37.0 37.0 10-14 36.473200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.421400000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.393899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.3314 37.0 37.0 37.0 37.0 37.0 30-34 36.3797 37.0 37.0 37.0 37.0 37.0 35-39 36.3423 37.0 37.0 37.0 37.0 37.0 40-44 36.3519 37.0 37.0 37.0 37.0 37.0 45-49 36.3291 37.0 37.0 37.0 37.0 37.0 50-54 36.351400000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3416 37.0 37.0 37.0 37.0 37.0 60-64 36.3368 37.0 37.0 37.0 37.0 37.0 65-69 36.2595 37.0 37.0 37.0 37.0 37.0 70-74 36.2573 37.0 37.0 37.0 37.0 37.0 75-79 36.18150000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.183299999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.1652 37.0 37.0 37.0 37.0 37.0 90-94 36.1413 37.0 37.0 37.0 37.0 37.0 95-99 36.093599999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.123999999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.012600000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.0449 37.0 37.0 37.0 37.0 37.0 115-119 35.9994 37.0 37.0 37.0 37.0 37.0 120-124 36.006 37.0 37.0 37.0 37.0 37.0 125-129 35.8689 37.0 37.0 37.0 37.0 37.0 130-134 35.821 37.0 37.0 37.0 37.0 37.0 135-139 35.8302 37.0 37.0 37.0 37.0 37.0 140-144 35.8027 37.0 37.0 37.0 37.0 37.0 145-149 35.7813 37.0 37.0 37.0 37.0 37.0 150-151 35.191 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 4.0 26 5.0 27 14.0 28 19.0 29 31.0 30 24.0 31 41.0 32 61.0 33 89.0 34 142.0 35 325.0 36 2819.0 37 425.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.7 12.55 8.975 31.775 2 29.422066549912433 12.83462596947711 28.471353515136354 29.271953965474108 3 23.175 19.0 24.3 33.525 4 27.224999999999998 22.625 22.3 27.85 5 29.299999999999997 25.75 21.475 23.474999999999998 6 25.900000000000002 29.075 22.075 22.95 7 21.325 23.075000000000003 35.099999999999994 20.5 8 23.599999999999998 22.2 26.0 28.199999999999996 9 21.275 21.2 30.525000000000002 27.0 10-14 25.405 23.955000000000002 24.34 26.3 15-19 25.490000000000002 23.65 24.275 26.584999999999997 20-24 25.69 23.395 24.154999999999998 26.76 25-29 26.029999999999998 23.015 24.255 26.700000000000003 30-34 25.825 23.03 24.154999999999998 26.99 35-39 25.045 23.03 24.905 27.02 40-44 25.485000000000003 23.71 23.625 27.18 45-49 25.81 23.205000000000002 23.73 27.255000000000003 50-54 26.090000000000003 22.97 24.54 26.400000000000002 55-59 25.745 23.494999999999997 23.14 27.62 60-64 25.35 23.555 23.89 27.205000000000002 65-69 25.885 22.814999999999998 23.919999999999998 27.38 70-74 26.119999999999997 23.07 23.35 27.46 75-79 26.645000000000003 23.05 23.385 26.919999999999998 80-84 26.465 22.900000000000002 23.26 27.375 85-89 26.419999999999998 22.415 23.405 27.76 90-94 26.145000000000003 23.115 23.395 27.345000000000002 95-99 26.575 23.13 22.470000000000002 27.825 100-104 26.545 22.52 23.369999999999997 27.565 105-109 26.924999999999997 22.29 23.425 27.36 110-114 26.27 22.689999999999998 23.24 27.800000000000004 115-119 26.545 22.975 22.935 27.544999999999998 120-124 26.82 22.73 23.0 27.450000000000003 125-129 26.595000000000002 22.88 23.22 27.305 130-134 27.334999999999997 22.41 22.68 27.575 135-139 26.58 23.055 23.14 27.224999999999998 140-144 27.16 22.33 22.705000000000002 27.805000000000003 145-149 26.845000000000002 22.95 22.735 27.47 150-151 26.900000000000002 22.875 23.400000000000002 26.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.5 27 1.5 28 3.0 29 3.5 30 6.0 31 7.0 32 9.5 33 12.5 34 17.0 35 27.0 36 30.5 37 41.0 38 56.0 39 63.0 40 81.0 41 110.5 42 134.5 43 145.5 44 141.0 45 148.5 46 162.5 47 158.0 48 148.0 49 141.5 50 141.0 51 131.0 52 117.5 53 105.5 54 91.5 55 90.5 56 90.0 57 84.5 58 95.5 59 112.5 60 103.5 61 96.5 62 108.5 63 112.0 64 104.0 65 95.0 66 86.0 67 90.0 68 86.5 69 69.0 70 58.5 71 52.5 72 51.0 73 44.0 74 36.0 75 27.5 76 21.5 77 16.5 78 8.0 79 6.5 80 8.5 81 4.0 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 93.67999999999999 87.825 2 5.973333333333334 11.200000000000001 3 0.3466666666666667 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.5125 0.0 0.0 0.0 0.0 134-135 1.7125 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804116 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804116_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.34775 37.0 37.0 37.0 37.0 37.0 2 36.103 37.0 37.0 37.0 37.0 37.0 3 36.1345 37.0 37.0 37.0 37.0 37.0 4 36.278 37.0 37.0 37.0 37.0 37.0 5 36.174 37.0 37.0 37.0 37.0 37.0 6 36.25 37.0 37.0 37.0 37.0 37.0 7 36.055 37.0 37.0 37.0 37.0 37.0 8 36.205 37.0 37.0 37.0 37.0 37.0 9 36.0995 37.0 37.0 37.0 37.0 37.0 10-14 36.2318 37.0 37.0 37.0 37.0 37.0 15-19 36.148399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.117200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0871 37.0 37.0 37.0 37.0 37.0 30-34 36.106899999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.081 37.0 37.0 37.0 37.0 37.0 40-44 36.0047 37.0 37.0 37.0 37.0 37.0 45-49 35.98 37.0 37.0 37.0 37.0 37.0 50-54 36.0024 37.0 37.0 37.0 37.0 37.0 55-59 35.904799999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9078 37.0 37.0 37.0 37.0 37.0 65-69 35.8269 37.0 37.0 37.0 37.0 37.0 70-74 35.8665 37.0 37.0 37.0 37.0 37.0 75-79 35.8412 37.0 37.0 37.0 37.0 37.0 80-84 35.7744 37.0 37.0 37.0 37.0 37.0 85-89 35.8518 37.0 37.0 37.0 37.0 37.0 90-94 35.77329999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7024 37.0 37.0 37.0 37.0 37.0 100-104 35.73629999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.6736 37.0 37.0 37.0 37.0 37.0 110-114 35.6048 37.0 37.0 37.0 37.0 37.0 115-119 35.5976 37.0 37.0 37.0 37.0 37.0 120-124 35.5578 37.0 37.0 37.0 37.0 37.0 125-129 35.4271 37.0 37.0 37.0 37.0 37.0 130-134 35.529700000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.4143 37.0 37.0 37.0 37.0 37.0 140-144 35.344899999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.191500000000005 37.0 37.0 37.0 29.8 37.0 150-151 34.7515 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 5.0 15 5.0 16 4.0 17 2.0 18 6.0 19 3.0 20 6.0 21 3.0 22 5.0 23 8.0 24 10.0 25 5.0 26 7.0 27 15.0 28 13.0 29 16.0 30 32.0 31 30.0 32 55.0 33 105.0 34 182.0 35 472.0 36 2729.0 37 275.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.43535883970993 18.42960740185046 9.67741935483871 30.457614403600903 2 32.550000000000004 22.125 22.35 22.975 3 26.174999999999997 25.4 24.85 23.575 4 28.1 30.8 17.825 23.275000000000002 5 28.875 30.7 17.299999999999997 23.125 6 27.700000000000003 33.425 15.925 22.95 7 23.974999999999998 19.25 30.875000000000004 25.900000000000002 8 25.575 22.15 21.075 31.2 9 25.224999999999998 21.825 24.25 28.7 10-14 27.215 24.195 21.0 27.589999999999996 15-19 26.805 24.62 21.6 26.974999999999998 20-24 27.125 24.065 21.495 27.315 25-29 26.99 23.625 21.14 28.244999999999997 30-34 26.484999999999996 23.544999999999998 22.25 27.72 35-39 27.18 24.03 21.72 27.07 40-44 27.650000000000002 24.255 20.880000000000003 27.215 45-49 27.32 23.825 21.78 27.075 50-54 27.839999999999996 22.564999999999998 21.87 27.725 55-59 27.925 23.32 21.22 27.534999999999997 60-64 27.229999999999997 23.24 22.165000000000003 27.365000000000002 65-69 27.445000000000004 23.425 21.115000000000002 28.015 70-74 27.98 22.435 21.995 27.589999999999996 75-79 27.084999999999997 22.78 22.564999999999998 27.57 80-84 28.105000000000004 23.544999999999998 21.235 27.115000000000002 85-89 27.73 22.965 21.740000000000002 27.565 90-94 27.560000000000002 23.11 21.4 27.93 95-99 27.66 23.455000000000002 21.44 27.445000000000004 100-104 27.185 23.115 21.815 27.884999999999998 105-109 27.355 22.625 22.34 27.68 110-114 27.93 23.61 21.16 27.3 115-119 27.685 23.785 21.05 27.48 120-124 27.54 23.82 21.18 27.46 125-129 28.075 23.445 21.82 26.66 130-134 28.075 23.919999999999998 21.22 26.784999999999997 135-139 27.389999999999997 23.755000000000003 21.995 26.86 140-144 27.715 23.794999999999998 22.08 26.41 145-149 28.225 23.64 21.755 26.38 150-151 27.1 24.6 21.6125 26.687499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 1.0 25 0.5 26 2.5 27 3.0 28 1.0 29 2.0 30 9.0 31 9.5 32 6.5 33 9.0 34 9.5 35 15.5 36 26.0 37 34.5 38 40.0 39 56.0 40 74.5 41 93.0 42 107.5 43 114.0 44 125.0 45 124.5 46 134.0 47 141.0 48 138.0 49 128.5 50 115.0 51 106.5 52 101.0 53 102.5 54 97.0 55 88.0 56 84.0 57 96.5 58 112.0 59 122.0 60 126.5 61 120.0 62 127.0 63 129.0 64 109.5 65 110.5 66 104.5 67 83.0 68 91.5 69 93.5 70 81.5 71 76.5 72 60.0 73 52.0 74 49.0 75 38.5 76 32.0 77 21.5 78 14.0 79 9.5 80 6.5 81 4.5 82 2.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 0.5 93 1.0 94 1.0 95 1.0 96 1.0 97 0.0 98 1.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.15 #Duplication Level Percentage of deduplicated Percentage of total 1 93.24470971242539 85.925 2 5.860010851871948 10.8 3 0.48833423765599565 1.35 4 0.18990775908844276 0.7000000000000001 5 0.10851871947911015 0.5 6 0.05425935973955508 0.3 7 0.0 0.0 8 0.02712967986977754 0.2 9 0.02712967986977754 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGC 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GAGTTCTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCG 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit AGTTCTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.4125 0.0 0.0 0.0 0.0 134-135 1.6125 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138-139 2.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTCC 10 0.006830828 145.0 7 AAAAAAA 35 0.0035366106 20.714287 9 >>END_MODULE Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391480 spots for SRR7804116.sra Written 1391480 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra Read 1391466 spots for SRR7804116.sra Written 1391466 spots for SRR7804116.sra SRR ids: ['SRR7804116.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r6el19rs SRR7804116.sra spots: 27829334 blocks: [[1, 1391466], [1391467, 2782932], [2782933, 4174398], [4174399, 5565864], [5565865, 6957330], [6957331, 8348796], [8348797, 9740262], [9740263, 11131728], [11131729, 12523194], [12523195, 13914660], [13914661, 15306126], [15306127, 16697592], [16697593, 18089058], [18089059, 19480524], [19480525, 20871990], [20871991, 22263456], [22263457, 23654922], [23654923, 25046388], [25046389, 26437854], [26437855, 27829334]] SRR7804116 file size 9408747 SRR7804116 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804116 SRR7804116_1.fastq SRR7804116_2.fastq Input file: SRR7804116_1.fastq Paired file: SRR7804116_2.fastq trimmed: SRR7804116-trimmed-pair1.fastq, SRR7804116-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:59:34 2024 >> started Tue Dec 10 02:00:05 2024 >> done (30.245s) 27829334 read pairs processed; of these: 86 ( 0.00%) short read pairs filtered out after trimming by size control 813 ( 0.00%) empty read pairs filtered out after trimming by size control 27828435 (100.00%) read pairs available; of these: 1066348 ( 3.83%) trimmed read pairs available after processing 26762087 (96.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 6 0.00% 21 8 0.00% 22 16 0.00% 23 6 0.00% 24 19 0.00% 25 13 0.00% 26 16 0.00% 27 17 0.00% 28 18 0.00% 29 15 0.00% 30 16 0.00% 31 14 0.00% 32 25 0.00% 33 16 0.00% 34 21 0.00% 35 22 0.00% 36 27 0.00% 37 32 0.00% 38 21 0.00% 39 34 0.00% 40 31 0.00% 41 25 0.00% 42 22 0.00% 43 29 0.00% 44 36 0.00% 45 30 0.00% 46 31 0.00% 47 43 0.00% 48 39 0.00% 49 37 0.00% 50 27 0.00% 51 34 0.00% 52 48 0.00% 53 33 0.00% 54 42 0.00% 55 55 0.00% 56 44 0.00% 57 54 0.00% 58 60 0.00% 59 39 0.00% 60 64 0.00% 61 51 0.00% 62 78 0.00% 63 80 0.00% 64 90 0.00% 65 88 0.00% 66 93 0.00% 67 113 0.00% 68 119 0.00% 69 125 0.00% 70 156 0.00% 71 170 0.00% 72 145 0.00% 73 195 0.00% 74 210 0.00% 75 244 0.00% 76 279 0.00% 77 287 0.00% 78 402 0.00% 79 381 0.00% 80 453 0.00% 81 548 0.00% 82 570 0.00% 83 697 0.00% 84 757 0.00% 85 914 0.00% 86 957 0.00% 87 1028 0.00% 88 1178 0.00% 89 1336 0.00% 90 1443 0.01% 91 1602 0.01% 92 1851 0.01% 93 2056 0.01% 94 2374 0.01% 95 2523 0.01% 96 2651 0.01% 97 2934 0.01% 98 3158 0.01% 99 3497 0.01% 100 3810 0.01% 101 4231 0.02% 102 4616 0.02% 103 4939 0.02% 104 5334 0.02% 105 5618 0.02% 106 6103 0.02% 107 6492 0.02% 108 6870 0.02% 109 7209 0.03% 110 7599 0.03% 111 8356 0.03% 112 9284 0.03% 113 9762 0.04% 114 10393 0.04% 115 11216 0.04% 116 11747 0.04% 117 12094 0.04% 118 12424 0.04% 119 13164 0.05% 120 13761 0.05% 121 14332 0.05% 122 15200 0.05% 123 16256 0.06% 124 17304 0.06% 125 18401 0.07% 126 19338 0.07% 127 19717 0.07% 128 20492 0.07% 129 21227 0.08% 130 21985 0.08% 131 22547 0.08% 132 23796 0.09% 133 25373 0.09% 134 26221 0.09% 135 27499 0.10% 136 28436 0.10% 137 29028 0.10% 138 30032 0.11% 139 31426 0.11% 140 32285 0.12% 141 33055 0.12% 142 34902 0.13% 143 35454 0.13% 144 37515 0.13% 145 39376 0.14% 146 40027 0.14% 147 42157 0.15% 148 42902 0.15% 149 43599 0.16% 150 44411 0.16% 151 26762087 96.17% 27828435 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=4.51 fanout-score-rank=11 prefix-density=0.99 prefix-fanout=3.6 sequence=AGGTTCTCGAGGG criterion=fanout-score sequence-density=0.24 sequence-density-rank=32 fanout-score=27.81 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=7.6 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=22 prefix-density=1.05 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=91.50 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=3.8 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7804116 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:00:48 Started mapping on | Dec 10 02:00:48 Finished on | Dec 10 02:05:28 Mapping speed, Million of reads per hour | 357.79 Number of input reads | 27828435 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25246854 Uniquely mapped reads % | 90.72% Average mapped length | 299.36 Number of splices: Total | 26039468 Number of splices: Annotated (sjdb) | 24685777 Number of splices: GT/AG | 25666087 Number of splices: GC/AG | 313204 Number of splices: AT/AC | 7616 Number of splices: Non-canonical | 52561 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385959 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 34647 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.85% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2195622 2195622 2195622 N_multimapping 385959 385959 385959 N_noFeature 759654 24557787 918347 N_ambiguous 697726 4271 168737 UnstrandedReadsAssigned:23789474 PositiveStrandReadsAssigned:684796 NegativeStrandReadsAssigned:24159770 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804116 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804116-trimmed-pair1.fastq SRR7804116-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,828,435 reads, 24,401,107 reads pseudoaligned [quant] estimated average fragment length: 295.922 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52973 SRR7804116.ke.tsv 35125 SRR7804116.se.tsv 88098 total ==> SRR7804116.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 641.672 0 0 PNS24247 1044 749.078 53.2018 3.56757 PNS24249 1928 1633.08 148.757 4.57554 PNS24246 1044 749.078 53.2018 3.56757 PNS24248 1044 749.078 53.2018 3.56757 PNS24244 1471 1176.08 56.6379 2.41905 PNS24243 293 78.7033 0 0 KQK14069 1603 1308.08 1461.83 56.1355 KQK14071 474 205.691 27.4924 6.71383 ==> SRR7804116.se.tsv <== BRADI_1g14170v3 1546 BRADI_1g53295v3 614 BRADI_1g59795v3 461 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 207 BRADI_1g74790v3 144 BRADI_1g09890v3 0 BRADI_1g77505v3 361 BRADI_1g48960v3 0 SRR7804116 completed mapping pipeline successfully