Starting /dee2/code/volunteer_pipeline.sh SRR7804117 current disk space = 1525023461376 free memory = 1567289580 SRR7804117 SRAfilesize 70101a0e873a5e686c1388aeea0f8715 SRR7804117.sra SRR7804117.sra file validated SRR7804117 is paired end SRR7804117 is conventional basespace SRR7804117 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804117_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2545 37.0 37.0 37.0 37.0 37.0 2 36.24725 37.0 37.0 37.0 37.0 37.0 3 36.3855 37.0 37.0 37.0 37.0 37.0 4 36.484 37.0 37.0 37.0 37.0 37.0 5 36.587 37.0 37.0 37.0 37.0 37.0 6 36.525 37.0 37.0 37.0 37.0 37.0 7 36.5145 37.0 37.0 37.0 37.0 37.0 8 36.4685 37.0 37.0 37.0 37.0 37.0 9 36.5165 37.0 37.0 37.0 37.0 37.0 10-14 36.5151 37.0 37.0 37.0 37.0 37.0 15-19 36.4742 37.0 37.0 37.0 37.0 37.0 20-24 36.4567 37.0 37.0 37.0 37.0 37.0 25-29 36.444900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.422900000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.442 37.0 37.0 37.0 37.0 37.0 40-44 36.439099999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.404399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3654 37.0 37.0 37.0 37.0 37.0 55-59 36.3377 37.0 37.0 37.0 37.0 37.0 60-64 36.338 37.0 37.0 37.0 37.0 37.0 65-69 36.310199999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.24549999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.2663 37.0 37.0 37.0 37.0 37.0 80-84 36.2796 37.0 37.0 37.0 37.0 37.0 85-89 36.2175 37.0 37.0 37.0 37.0 37.0 90-94 36.1654 37.0 37.0 37.0 37.0 37.0 95-99 36.1704 37.0 37.0 37.0 37.0 37.0 100-104 36.1553 37.0 37.0 37.0 37.0 37.0 105-109 36.107 37.0 37.0 37.0 37.0 37.0 110-114 36.09599999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0792 37.0 37.0 37.0 37.0 37.0 120-124 36.062 37.0 37.0 37.0 37.0 37.0 125-129 35.933800000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.7761 37.0 37.0 37.0 37.0 37.0 135-139 35.908500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7608 37.0 37.0 37.0 37.0 37.0 145-149 35.812599999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.25625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 3.0 26 1.0 27 11.0 28 8.0 29 24.0 30 36.0 31 41.0 32 51.0 33 81.0 34 128.0 35 322.0 36 2906.0 37 385.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.25 12.8 9.425 32.525 2 26.157697121401753 13.391739674593243 31.739674593241553 28.71088861076345 3 23.400000000000002 20.150000000000002 24.4 32.05 4 26.325 23.875 21.75 28.050000000000004 5 26.125 28.125 22.900000000000002 22.85 6 25.25 29.575000000000003 22.25 22.925 7 19.175 23.9 35.949999999999996 20.974999999999998 8 21.5 23.200000000000003 27.775 27.525 9 20.125 21.475 31.574999999999996 26.825 10-14 23.805 25.290000000000003 24.725 26.179999999999996 15-19 24.29 25.22 24.825 25.665 20-24 23.695 25.180000000000003 25.145 25.979999999999997 25-29 23.43 25.82 24.19 26.56 30-34 23.775 25.15 24.495 26.58 35-39 24.645 24.975 24.015 26.365 40-44 23.66 25.185000000000002 24.495 26.66 45-49 24.085 24.875 24.455 26.584999999999997 50-54 24.3 25.069999999999997 24.779999999999998 25.85 55-59 24.77 24.305 23.75 27.175 60-64 24.025 25.0 24.365000000000002 26.61 65-69 24.2 24.709999999999997 24.785 26.305 70-74 24.05 24.575 25.019999999999996 26.355 75-79 25.035 23.82 24.965 26.179999999999996 80-84 24.465 24.474999999999998 24.474999999999998 26.584999999999997 85-89 25.005 24.615000000000002 24.18 26.200000000000003 90-94 24.795 23.75 24.884999999999998 26.57 95-99 24.535 24.834999999999997 24.099999999999998 26.529999999999998 100-104 25.155 24.455 24.175 26.215 105-109 24.990000000000002 24.29 24.235 26.484999999999996 110-114 25.085 24.23 24.185000000000002 26.5 115-119 25.405 24.435000000000002 24.015 26.145000000000003 120-124 25.380000000000003 24.0 23.875 26.745 125-129 24.675 24.68 23.919999999999998 26.724999999999998 130-134 25.074999999999996 24.595 23.875 26.455000000000002 135-139 25.22 24.01 24.59 26.179999999999996 140-144 25.224999999999998 23.415 25.395 25.965 145-149 24.845 23.630000000000003 24.62 26.905 150-151 24.525 23.674999999999997 24.8625 26.937499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 0.5 27 0.5 28 1.5 29 3.0 30 3.5 31 3.5 32 4.5 33 11.5 34 19.5 35 22.5 36 38.0 37 58.5 38 61.5 39 78.5 40 107.5 41 128.5 42 158.5 43 177.0 44 179.0 45 191.0 46 202.5 47 182.5 48 163.0 49 167.0 50 161.0 51 154.0 52 146.0 53 139.0 54 137.5 55 119.0 56 99.5 57 89.0 58 76.0 59 75.5 60 76.5 61 63.0 62 67.0 63 73.5 64 66.0 65 67.0 66 64.0 67 56.5 68 52.5 69 42.5 70 42.5 71 37.0 72 29.5 73 28.5 74 21.0 75 16.5 76 13.0 77 8.5 78 5.0 79 3.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.94751009421265 86.325 2 6.48721399730821 12.049999999999999 3 0.5114401076716016 1.425 4 0.053835800807537006 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0125 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.30000000000000004 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.175 0.0 0.0 0.0 0.0 134-135 1.2999999999999998 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCCCT 10 0.006830828 145.0 6 GCTATGG 10 0.006830828 145.0 145 GCATCCC 10 0.006830828 145.0 5 >>END_MODULE SRR7804117 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804117_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33975 37.0 37.0 37.0 37.0 37.0 2 36.157 37.0 37.0 37.0 37.0 37.0 3 36.0255 37.0 37.0 37.0 37.0 37.0 4 36.1815 37.0 37.0 37.0 37.0 37.0 5 36.108 37.0 37.0 37.0 37.0 37.0 6 36.271 37.0 37.0 37.0 37.0 37.0 7 36.073 37.0 37.0 37.0 37.0 37.0 8 36.297 37.0 37.0 37.0 37.0 37.0 9 36.239 37.0 37.0 37.0 37.0 37.0 10-14 36.2463 37.0 37.0 37.0 37.0 37.0 15-19 36.1665 37.0 37.0 37.0 37.0 37.0 20-24 36.145300000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.1254 37.0 37.0 37.0 37.0 37.0 30-34 36.0756 37.0 37.0 37.0 37.0 37.0 35-39 36.045500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.0394 37.0 37.0 37.0 37.0 37.0 45-49 35.932 37.0 37.0 37.0 37.0 37.0 50-54 35.9001 37.0 37.0 37.0 37.0 37.0 55-59 35.8364 37.0 37.0 37.0 37.0 37.0 60-64 35.9645 37.0 37.0 37.0 37.0 37.0 65-69 35.8298 37.0 37.0 37.0 37.0 37.0 70-74 35.864 37.0 37.0 37.0 37.0 37.0 75-79 35.778299999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.8376 37.0 37.0 37.0 37.0 37.0 85-89 35.7568 37.0 37.0 37.0 37.0 37.0 90-94 35.7854 37.0 37.0 37.0 37.0 37.0 95-99 35.7099 37.0 37.0 37.0 37.0 37.0 100-104 35.7467 37.0 37.0 37.0 37.0 37.0 105-109 35.5788 37.0 37.0 37.0 37.0 37.0 110-114 35.5283 37.0 37.0 37.0 37.0 37.0 115-119 35.522000000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.4568 37.0 37.0 37.0 37.0 37.0 125-129 35.36710000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.4915 37.0 37.0 37.0 37.0 37.0 135-139 35.3086 37.0 37.0 37.0 32.2 37.0 140-144 35.3576 37.0 37.0 37.0 37.0 37.0 145-149 35.1302 37.0 37.0 37.0 27.4 37.0 150-151 34.647000000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 7.0 16 4.0 17 2.0 18 1.0 19 2.0 20 6.0 21 4.0 22 8.0 23 6.0 24 8.0 25 5.0 26 10.0 27 10.0 28 15.0 29 23.0 30 26.0 31 40.0 32 70.0 33 100.0 34 190.0 35 558.0 36 2682.0 37 218.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.010002500625156 19.529882470617654 10.252563140785197 30.207551887971995 2 29.875 22.75 24.45 22.925 3 25.124999999999996 24.65 25.825 24.4 4 27.224999999999998 31.175000000000004 19.25 22.35 5 28.050000000000004 31.900000000000002 19.0 21.05 6 25.424999999999997 33.0 18.8 22.775000000000002 7 23.65 19.675 32.175 24.5 8 25.074999999999996 22.3 21.475 31.15 9 24.224999999999998 23.200000000000003 23.775 28.799999999999997 10-14 26.345000000000002 24.75 22.295 26.61 15-19 26.025 25.069999999999997 22.225 26.68 20-24 25.85 25.415 22.495 26.240000000000002 25-29 26.395000000000003 23.765 23.455000000000002 26.384999999999998 30-34 26.11 24.27 22.935 26.685 35-39 26.415 24.779999999999998 22.93 25.874999999999996 40-44 26.495 24.015 23.369999999999997 26.119999999999997 45-49 26.484999999999996 24.425 23.035 26.055 50-54 26.455000000000002 24.675 22.985 25.885 55-59 27.089999999999996 24.45 22.605 25.855 60-64 26.355 24.275 23.605 25.765 65-69 26.584999999999997 25.290000000000003 22.425 25.7 70-74 26.35 24.959999999999997 23.549999999999997 25.14 75-79 27.16 24.435000000000002 23.26 25.145 80-84 27.48 24.36 22.75 25.41 85-89 27.42 24.72 23.02 24.84 90-94 26.634999999999998 24.565 23.380000000000003 25.419999999999998 95-99 27.055 24.959999999999997 22.73 25.255 100-104 26.76 24.86 23.035 25.345000000000002 105-109 26.68 25.124999999999996 22.785 25.41 110-114 26.705000000000002 25.27 22.445 25.580000000000002 115-119 26.93 24.755 23.44 24.875 120-124 26.865 24.685000000000002 22.98 25.47 125-129 26.995 25.09 23.45 24.465 130-134 26.985 24.69 23.36 24.965 135-139 26.634999999999998 25.085 23.255 25.025 140-144 27.175 25.045 22.985 24.795 145-149 26.8 25.66 23.06 24.48 150-151 26.7125 24.6625 23.849999999999998 24.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 1.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.5 22 1.0 23 0.5 24 1.0 25 1.5 26 1.5 27 2.0 28 3.5 29 4.0 30 3.0 31 3.0 32 4.0 33 7.5 34 15.0 35 24.0 36 31.0 37 36.5 38 45.5 39 70.0 40 99.5 41 114.0 42 133.0 43 153.5 44 162.5 45 164.0 46 160.0 47 166.5 48 173.5 49 157.0 50 139.5 51 131.5 52 129.0 53 124.0 54 114.5 55 108.5 56 106.5 57 98.0 58 98.5 59 98.5 60 83.5 61 80.5 62 83.5 63 86.5 64 93.0 65 94.5 66 79.0 67 65.0 68 72.5 69 69.5 70 47.0 71 49.5 72 49.5 73 32.0 74 27.5 75 25.5 76 18.0 77 13.0 78 7.0 79 3.0 80 4.0 81 4.5 82 3.5 83 1.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 92.65582655826559 85.475 2 6.504065040650407 12.0 3 0.6775067750677507 1.875 4 0.13550135501355012 0.5 5 0.0 0.0 6 0.02710027100271003 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.7250000000000001 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.0499999999999998 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.35 0.0 0.0 0.0 0.0 136-137 1.425 0.0 0.0 0.0 0.0 138-139 1.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAAAG 10 0.006830828 145.0 1 GGTCTCC 10 0.006830828 145.0 6 GAACGGT 10 0.006830828 145.0 2 AGGAACA 10 0.006830828 145.0 5 GCTGTTA 10 0.006830828 145.0 145 CGAACGG 10 0.006830828 145.0 1 CGGTCTC 10 0.006830828 145.0 5 AACGGTC 10 0.006830828 145.0 3 >>END_MODULE Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra Read 1695227 spots for SRR7804117.sra Written 1695227 spots for SRR7804117.sra Read 1695216 spots for SRR7804117.sra Written 1695216 spots for SRR7804117.sra SRR ids: ['SRR7804117.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b29_k79m SRR7804117.sra spots: 33904331 blocks: [[1, 1695216], [1695217, 3390432], [3390433, 5085648], [5085649, 6780864], [6780865, 8476080], [8476081, 10171296], [10171297, 11866512], [11866513, 13561728], [13561729, 15256944], [15256945, 16952160], [16952161, 18647376], [18647377, 20342592], [20342593, 22037808], [22037809, 23733024], [23733025, 25428240], [25428241, 27123456], [27123457, 28818672], [28818673, 30513888], [30513889, 32209104], [32209105, 33904331]] SRR7804117 file size 11467364 SRR7804117 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804117 SRR7804117_1.fastq SRR7804117_2.fastq Input file: SRR7804117_1.fastq Paired file: SRR7804117_2.fastq trimmed: SRR7804117-trimmed-pair1.fastq, SRR7804117-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:02:18 2024 >> started Tue Dec 10 02:04:26 2024 >> done (128.124s) 33904331 read pairs processed; of these: 105 ( 0.00%) short read pairs filtered out after trimming by size control 514 ( 0.00%) empty read pairs filtered out after trimming by size control 33903712 (100.00%) read pairs available; of these: 695715 ( 2.05%) trimmed read pairs available after processing 33207997 (97.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 17 0.00% 20 16 0.00% 21 18 0.00% 22 18 0.00% 23 23 0.00% 24 24 0.00% 25 23 0.00% 26 23 0.00% 27 30 0.00% 28 32 0.00% 29 30 0.00% 30 31 0.00% 31 30 0.00% 32 31 0.00% 33 37 0.00% 34 36 0.00% 35 39 0.00% 36 44 0.00% 37 46 0.00% 38 55 0.00% 39 53 0.00% 40 45 0.00% 41 52 0.00% 42 57 0.00% 43 52 0.00% 44 46 0.00% 45 51 0.00% 46 54 0.00% 47 56 0.00% 48 73 0.00% 49 68 0.00% 50 50 0.00% 51 64 0.00% 52 66 0.00% 53 75 0.00% 54 69 0.00% 55 66 0.00% 56 72 0.00% 57 86 0.00% 58 75 0.00% 59 90 0.00% 60 75 0.00% 61 89 0.00% 62 84 0.00% 63 79 0.00% 64 87 0.00% 65 105 0.00% 66 100 0.00% 67 124 0.00% 68 115 0.00% 69 126 0.00% 70 132 0.00% 71 128 0.00% 72 163 0.00% 73 149 0.00% 74 185 0.00% 75 181 0.00% 76 176 0.00% 77 183 0.00% 78 211 0.00% 79 240 0.00% 80 275 0.00% 81 310 0.00% 82 349 0.00% 83 416 0.00% 84 449 0.00% 85 516 0.00% 86 539 0.00% 87 571 0.00% 88 657 0.00% 89 735 0.00% 90 760 0.00% 91 877 0.00% 92 1008 0.00% 93 1042 0.00% 94 1126 0.00% 95 1375 0.00% 96 1431 0.00% 97 1542 0.00% 98 1600 0.00% 99 1898 0.01% 100 2033 0.01% 101 2146 0.01% 102 2399 0.01% 103 2642 0.01% 104 2804 0.01% 105 3144 0.01% 106 3401 0.01% 107 3540 0.01% 108 3644 0.01% 109 4057 0.01% 110 4167 0.01% 111 4540 0.01% 112 4984 0.01% 113 5408 0.02% 114 5823 0.02% 115 6164 0.02% 116 6567 0.02% 117 6801 0.02% 118 7009 0.02% 119 7533 0.02% 120 7780 0.02% 121 8547 0.03% 122 8969 0.03% 123 9756 0.03% 124 10333 0.03% 125 11189 0.03% 126 11615 0.03% 127 12087 0.04% 128 12535 0.04% 129 13220 0.04% 130 13583 0.04% 131 14379 0.04% 132 14903 0.04% 133 16246 0.05% 134 17008 0.05% 135 18062 0.05% 136 18895 0.06% 137 19479 0.06% 138 20429 0.06% 139 21214 0.06% 140 21679 0.06% 141 22813 0.07% 142 24310 0.07% 143 25223 0.07% 144 26854 0.08% 145 27787 0.08% 146 29517 0.09% 147 30317 0.09% 148 31179 0.09% 149 31782 0.09% 150 33076 0.10% 151 33207997 97.95% 33903712 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.91 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=3.6 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=1153.03 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.9 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=8.20 fanout-score-rank=21 prefix-density=1.37 prefix-fanout=3.3 sequence=TCTTCTTCTTCTCCTCCTTGATTTCATCAGCTTGAGGTTAAAAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGGCAGCACCAACACTAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGTGCCGGAGAAGAAGCAGGAGCAGCTCGAGATGGCCGGCGTGTCCGGCAGCGAGGGGTGCAGCTGCGGCGACAACTGCAAGTGCAACCCTTGCAACTGTTAGCCCACTAATCAATCATGATGCATTTGTGGTTAATAAATAAGCGCCGAGTCAGAGCGTGTGTTGTGGTTTACTTGTGAGTAACTGGTGTGTCCTTCCTTGTGAGTATGTATGTATTCGTGTGTGTCTGCGTGTAATTGGTTCATTTGATCAAGCTCTCTGCACTTGGGAGTTTGGCCAATGAACCAATCATCAGTATGTAAGAAAGGCAGAGGCTCTGTATGTCTGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=748.21 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=20.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804117 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:05:18 Started mapping on | Dec 10 02:05:18 Finished on | Dec 10 02:11:39 Mapping speed, Million of reads per hour | 320.35 Number of input reads | 33903712 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 30869063 Uniquely mapped reads % | 91.05% Average mapped length | 299.87 Number of splices: Total | 32068427 Number of splices: Annotated (sjdb) | 30121250 Number of splices: GT/AG | 31593495 Number of splices: GC/AG | 353331 Number of splices: AT/AC | 24784 Number of splices: Non-canonical | 96817 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505131 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 28843 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.72% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2529518 2529518 2529518 N_multimapping 505131 505131 505131 N_noFeature 648785 29962055 931350 N_ambiguous 724514 5647 102045 UnstrandedReadsAssigned:29495764 PositiveStrandReadsAssigned:901361 NegativeStrandReadsAssigned:29835668 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804117 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804117-trimmed-pair1.fastq SRR7804117-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,903,712 reads, 30,364,434 reads pseudoaligned [quant] estimated average fragment length: 308.135 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR7804117.ke.tsv 35125 SRR7804117.se.tsv 88098 total ==> SRR7804117.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 629.624 0 0 PNS24247 1044 736.865 158.332 9.14549 PNS24249 1928 1620.86 391.311 10.2755 PNS24246 1044 736.865 158.332 9.14549 PNS24248 1044 736.865 158.332 9.14549 PNS24244 1471 1163.86 113.694 4.15777 PNS24243 293 69.7969 0 0 KQK14069 1603 1295.86 18389.5 603.999 KQK14071 474 195.878 107.537 23.3668 ==> SRR7804117.se.tsv <== BRADI_1g14170v3 18843 BRADI_1g53295v3 1454 BRADI_1g59795v3 282 BRADI_1g07683v3 0 BRADI_1g00485v3 71 BRADI_1g20270v3 1533 BRADI_1g74790v3 99 BRADI_1g09890v3 0 BRADI_1g77505v3 463 BRADI_1g48960v3 0 SRR7804117 completed mapping pipeline successfully