Starting /dee2/code/volunteer_pipeline.sh SRR7804118 current disk space = 1525218529280 free memory = 1438539668 SRR7804118 SRAfilesize 5a27456ca217f56e56ce35b572029253 SRR7804118.sra SRR7804118.sra file validated SRR7804118 is paired end SRR7804118 is conventional basespace SRR7804118 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804118_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.154 37.0 37.0 37.0 37.0 37.0 2 36.16025 37.0 37.0 37.0 37.0 37.0 3 36.3495 37.0 37.0 37.0 37.0 37.0 4 36.482 37.0 37.0 37.0 37.0 37.0 5 36.4765 37.0 37.0 37.0 37.0 37.0 6 36.4945 37.0 37.0 37.0 37.0 37.0 7 36.3855 37.0 37.0 37.0 37.0 37.0 8 36.4705 37.0 37.0 37.0 37.0 37.0 9 36.388 37.0 37.0 37.0 37.0 37.0 10-14 36.4809 37.0 37.0 37.0 37.0 37.0 15-19 36.406000000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4273 37.0 37.0 37.0 37.0 37.0 25-29 36.403 37.0 37.0 37.0 37.0 37.0 30-34 36.42209999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.357 37.0 37.0 37.0 37.0 37.0 40-44 36.30460000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.302800000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.32889999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.331900000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.257600000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2475 37.0 37.0 37.0 37.0 37.0 70-74 36.2131 37.0 37.0 37.0 37.0 37.0 75-79 36.22539999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.0714 37.0 37.0 37.0 37.0 37.0 85-89 36.1026 37.0 37.0 37.0 37.0 37.0 90-94 36.0825 37.0 37.0 37.0 37.0 37.0 95-99 36.0523 37.0 37.0 37.0 37.0 37.0 100-104 36.0395 37.0 37.0 37.0 37.0 37.0 105-109 35.970600000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.9835 37.0 37.0 37.0 37.0 37.0 115-119 35.9253 37.0 37.0 37.0 37.0 37.0 120-124 35.9274 37.0 37.0 37.0 37.0 37.0 125-129 35.82959999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.7205 37.0 37.0 37.0 37.0 37.0 135-139 35.713800000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.644600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.67229999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.19425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 5.0 24 1.0 25 4.0 26 6.0 27 6.0 28 17.0 29 19.0 30 39.0 31 43.0 32 65.0 33 101.0 34 150.0 35 346.0 36 2830.0 37 366.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.475 13.25 11.05 32.225 2 28.157039259814955 14.853713428357091 27.981995498874717 29.00725181295324 3 23.325000000000003 19.35 25.874999999999996 31.45 4 25.650000000000002 24.0 23.0 27.35 5 26.400000000000002 27.575 23.9 22.125 6 24.7 28.95 23.425 22.925 7 17.875 23.125 38.125 20.875 8 22.3 22.875 28.825 26.0 9 20.65 22.8 31.175000000000004 25.374999999999996 10-14 23.585 25.295 25.415 25.705 15-19 23.27 25.35 25.36 26.02 20-24 23.52 25.555 25.740000000000002 25.185000000000002 25-29 23.990000000000002 25.124999999999996 24.865000000000002 26.02 30-34 23.755000000000003 24.85 25.330000000000002 26.064999999999998 35-39 24.125 23.935000000000002 25.740000000000002 26.200000000000003 40-44 24.03 25.080000000000002 24.349999999999998 26.540000000000003 45-49 24.23 24.759999999999998 25.155 25.855 50-54 24.295 24.48 24.610000000000003 26.615 55-59 24.8 25.290000000000003 24.085 25.825 60-64 24.060000000000002 24.740000000000002 24.025 27.175 65-69 24.2 23.955000000000002 24.825 27.02 70-74 23.87 25.255 24.52 26.355 75-79 24.709999999999997 24.325 24.73 26.235000000000003 80-84 24.0 24.51 24.82 26.669999999999998 85-89 24.11 24.404999999999998 24.36 27.125 90-94 24.455 24.22 24.86 26.465 95-99 24.33 24.72 24.79 26.16 100-104 24.545 24.3 24.305 26.85 105-109 24.79 23.775 24.735 26.700000000000003 110-114 24.595 24.65 24.305 26.450000000000003 115-119 24.77 24.395 24.13 26.705000000000002 120-124 24.765 24.52 24.36 26.355 125-129 25.064999999999998 24.455 23.98 26.5 130-134 24.535 23.885 24.87 26.71 135-139 24.755 24.16 24.42 26.665 140-144 24.165 24.29 24.435000000000002 27.11 145-149 24.735 24.51 24.595 26.16 150-151 25.4375 24.2875 24.3125 25.9625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.5 27 3.0 28 2.0 29 4.0 30 6.5 31 11.0 32 16.0 33 18.5 34 24.0 35 34.0 36 51.0 37 69.0 38 91.0 39 99.5 40 98.0 41 118.0 42 140.0 43 152.0 44 163.0 45 180.0 46 174.0 47 170.0 48 182.0 49 175.5 50 164.5 51 159.0 52 142.5 53 125.0 54 129.0 55 118.5 56 100.0 57 92.0 58 86.0 59 80.5 60 74.5 61 69.0 62 64.0 63 64.0 64 62.0 65 61.5 66 58.5 67 48.0 68 46.0 69 51.5 70 44.5 71 33.5 72 26.0 73 22.0 74 25.0 75 21.5 76 14.5 77 11.0 78 6.0 79 3.0 80 2.5 81 2.0 82 2.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.98456215065212 88.275 2 5.669417088102209 10.65 3 0.23955283470854402 0.675 4 0.10646792653713069 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7250000000000001 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.2000000000000002 0.0 0.0 0.0 0.0 136-137 1.3 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804118 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804118_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2065 37.0 37.0 37.0 37.0 37.0 2 35.92 37.0 37.0 37.0 37.0 37.0 3 35.881 37.0 37.0 37.0 37.0 37.0 4 36.0195 37.0 37.0 37.0 37.0 37.0 5 35.9635 37.0 37.0 37.0 37.0 37.0 6 36.044 37.0 37.0 37.0 37.0 37.0 7 35.7705 37.0 37.0 37.0 37.0 37.0 8 35.9905 37.0 37.0 37.0 37.0 37.0 9 35.8195 37.0 37.0 37.0 37.0 37.0 10-14 35.8019 37.0 37.0 37.0 37.0 37.0 15-19 35.6848 37.0 37.0 37.0 37.0 37.0 20-24 35.6927 37.0 37.0 37.0 37.0 37.0 25-29 35.62050000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.528999999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.4623 37.0 37.0 37.0 37.0 37.0 40-44 35.5033 37.0 37.0 37.0 37.0 37.0 45-49 35.415499999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.4035 37.0 37.0 37.0 37.0 37.0 55-59 35.3723 37.0 37.0 37.0 37.0 37.0 60-64 35.2862 37.0 37.0 37.0 37.0 37.0 65-69 35.2649 37.0 37.0 37.0 37.0 37.0 70-74 35.2788 37.0 37.0 37.0 37.0 37.0 75-79 35.1996 37.0 37.0 37.0 37.0 37.0 80-84 35.266299999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.24380000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.1661 37.0 37.0 37.0 37.0 37.0 95-99 35.1466 37.0 37.0 37.0 32.2 37.0 100-104 35.1483 37.0 37.0 37.0 34.6 37.0 105-109 35.035900000000005 37.0 37.0 37.0 27.4 37.0 110-114 34.9134 37.0 37.0 37.0 27.4 37.0 115-119 34.9424 37.0 37.0 37.0 25.0 37.0 120-124 34.9511 37.0 37.0 37.0 27.4 37.0 125-129 34.8239 37.0 37.0 37.0 25.0 37.0 130-134 34.933099999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.797399999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.8468 37.0 37.0 37.0 25.0 37.0 145-149 34.5876 37.0 37.0 37.0 25.0 37.0 150-151 34.2265 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 20.0 14 17.0 15 16.0 16 13.0 17 7.0 18 5.0 19 6.0 20 9.0 21 13.0 22 15.0 23 14.0 24 19.0 25 24.0 26 10.0 27 10.0 28 14.0 29 22.0 30 33.0 31 40.0 32 59.0 33 107.0 34 184.0 35 569.0 36 2581.0 37 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.720860430215104 18.75937968984492 12.631315657828916 26.88844422211106 2 34.325 22.05 22.325 21.3 3 27.575 25.4 25.224999999999998 21.8 4 28.225 31.624999999999996 19.2 20.95 5 30.4 31.15 18.0 20.45 6 26.775 33.550000000000004 18.425 21.25 7 25.525 20.150000000000002 30.9 23.425 8 27.775 23.549999999999997 20.150000000000002 28.525 9 26.450000000000003 22.725 23.400000000000002 27.425 10-14 27.63 26.119999999999997 21.335 24.915000000000003 15-19 27.51 25.11 22.42 24.959999999999997 20-24 27.435 25.35 22.41 24.805 25-29 26.245 25.165 22.855 25.735000000000003 30-34 26.705000000000002 25.369999999999997 22.49 25.435000000000002 35-39 26.945000000000004 25.5 22.830000000000002 24.725 40-44 26.815 25.169999999999998 22.770000000000003 25.245 45-49 27.04 25.53 22.78 24.65 50-54 26.884999999999998 25.895000000000003 23.085 24.135 55-59 27.175 25.335 22.56 24.93 60-64 27.295 24.785 23.34 24.58 65-69 27.584999999999997 24.87 22.34 25.205 70-74 27.21 25.365 22.830000000000002 24.595 75-79 27.275 25.595000000000002 22.965 24.165 80-84 27.68 25.295 22.275 24.75 85-89 27.644999999999996 25.445 22.439999999999998 24.47 90-94 26.740000000000002 25.775 22.81 24.675 95-99 27.02 25.39 23.06 24.529999999999998 100-104 27.750000000000004 25.264999999999997 22.35 24.635 105-109 27.134999999999998 24.86 23.225 24.779999999999998 110-114 27.595 25.290000000000003 22.515 24.6 115-119 27.985 25.47 21.81 24.735 120-124 26.705000000000002 24.92 22.915 25.46 125-129 27.735 24.654999999999998 22.720000000000002 24.89 130-134 27.200000000000003 25.55 22.855 24.395 135-139 27.355 25.4 23.494999999999997 23.75 140-144 27.389999999999997 25.35 23.64 23.62 145-149 26.905 25.165 23.61 24.32 150-151 27.212500000000002 26.400000000000002 22.55 23.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 2.0 7 2.0 8 1.5 9 1.5 10 2.0 11 2.0 12 0.5 13 0.0 14 1.0 15 1.0 16 0.5 17 3.0 18 3.0 19 1.5 20 2.5 21 4.0 22 3.5 23 1.5 24 1.0 25 3.5 26 4.5 27 2.5 28 2.5 29 4.0 30 9.5 31 11.5 32 11.0 33 13.5 34 19.0 35 29.0 36 32.5 37 37.5 38 53.5 39 71.0 40 102.0 41 128.5 42 126.5 43 130.0 44 148.0 45 170.0 46 173.0 47 165.5 48 164.0 49 151.5 50 140.5 51 149.0 52 146.0 53 124.5 54 115.0 55 109.0 56 98.5 57 91.5 58 94.5 59 92.5 60 87.0 61 89.0 62 80.0 63 62.0 64 72.0 65 70.0 66 57.0 67 59.0 68 64.5 69 61.5 70 49.0 71 49.5 72 44.5 73 34.5 74 27.5 75 23.5 76 14.5 77 8.5 78 9.5 79 9.0 80 6.5 81 4.0 82 4.0 83 3.0 84 2.5 85 2.0 86 1.5 87 1.5 88 1.0 89 1.0 90 0.5 91 1.0 92 3.0 93 3.5 94 2.5 95 2.0 96 3.0 97 3.5 98 3.0 99 2.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.65207995678013 86.675 2 5.6726094003241485 10.5 3 0.4321988114532685 1.2 4 0.1350621285791464 0.5 5 0.05402485143165856 0.25 6 0.0 0.0 7 0.02701242571582928 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02701242571582928 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 28 0.7000000000000001 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.2125 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.2000000000000002 0.0 0.0 0.0 0.0 136-137 1.3 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTGGG 10 0.006830828 145.0 1 AGAAGCC 10 0.006830828 145.0 145 >>END_MODULE Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008399 spots for SRR7804118.sra Written 1008399 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra Read 1008380 spots for SRR7804118.sra Written 1008380 spots for SRR7804118.sra SRR ids: ['SRR7804118.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lro5um29 SRR7804118.sra spots: 20167619 blocks: [[1, 1008380], [1008381, 2016760], [2016761, 3025140], [3025141, 4033520], [4033521, 5041900], [5041901, 6050280], [6050281, 7058660], [7058661, 8067040], [8067041, 9075420], [9075421, 10083800], [10083801, 11092180], [11092181, 12100560], [12100561, 13108940], [13108941, 14117320], [14117321, 15125700], [15125701, 16134080], [16134081, 17142460], [17142461, 18150840], [18150841, 19159220], [19159221, 20167619]] SRR7804118 file size 6812443 SRR7804118 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804118 SRR7804118_1.fastq SRR7804118_2.fastq Input file: SRR7804118_1.fastq Paired file: SRR7804118_2.fastq trimmed: SRR7804118-trimmed-pair1.fastq, SRR7804118-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:03:22 2024 >> started Tue Dec 10 02:03:47 2024 >> done (25.247s) 20167619 read pairs processed; of these: 123 ( 0.00%) short read pairs filtered out after trimming by size control 2018 ( 0.01%) empty read pairs filtered out after trimming by size control 20165478 (99.99%) read pairs available; of these: 534402 ( 2.65%) trimmed read pairs available after processing 19631076 (97.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 11 0.00% 20 10 0.00% 21 14 0.00% 22 15 0.00% 23 20 0.00% 24 23 0.00% 25 20 0.00% 26 16 0.00% 27 23 0.00% 28 20 0.00% 29 27 0.00% 30 22 0.00% 31 23 0.00% 32 41 0.00% 33 33 0.00% 34 13 0.00% 35 43 0.00% 36 38 0.00% 37 38 0.00% 38 38 0.00% 39 35 0.00% 40 24 0.00% 41 44 0.00% 42 42 0.00% 43 40 0.00% 44 60 0.00% 45 41 0.00% 46 34 0.00% 47 51 0.00% 48 50 0.00% 49 59 0.00% 50 54 0.00% 51 68 0.00% 52 51 0.00% 53 49 0.00% 54 48 0.00% 55 76 0.00% 56 70 0.00% 57 68 0.00% 58 66 0.00% 59 79 0.00% 60 75 0.00% 61 71 0.00% 62 86 0.00% 63 92 0.00% 64 105 0.00% 65 77 0.00% 66 92 0.00% 67 96 0.00% 68 108 0.00% 69 115 0.00% 70 133 0.00% 71 127 0.00% 72 131 0.00% 73 163 0.00% 74 193 0.00% 75 191 0.00% 76 194 0.00% 77 248 0.00% 78 252 0.00% 79 273 0.00% 80 321 0.00% 81 318 0.00% 82 366 0.00% 83 399 0.00% 84 500 0.00% 85 518 0.00% 86 608 0.00% 87 575 0.00% 88 628 0.00% 89 753 0.00% 90 849 0.00% 91 919 0.00% 92 1022 0.01% 93 1107 0.01% 94 1279 0.01% 95 1327 0.01% 96 1455 0.01% 97 1579 0.01% 98 1640 0.01% 99 1851 0.01% 100 1893 0.01% 101 2179 0.01% 102 2385 0.01% 103 2588 0.01% 104 2715 0.01% 105 2926 0.01% 106 3180 0.02% 107 3263 0.02% 108 3474 0.02% 109 3704 0.02% 110 3827 0.02% 111 3900 0.02% 112 4366 0.02% 113 4747 0.02% 114 4953 0.02% 115 5434 0.03% 116 5765 0.03% 117 5920 0.03% 118 6151 0.03% 119 6470 0.03% 120 6848 0.03% 121 7149 0.04% 122 7503 0.04% 123 7904 0.04% 124 8444 0.04% 125 9016 0.04% 126 9285 0.05% 127 9736 0.05% 128 9922 0.05% 129 10439 0.05% 130 10649 0.05% 131 11043 0.05% 132 11729 0.06% 133 12219 0.06% 134 12768 0.06% 135 13707 0.07% 136 13998 0.07% 137 14773 0.07% 138 15095 0.07% 139 15505 0.08% 140 15821 0.08% 141 16158 0.08% 142 17232 0.09% 143 17664 0.09% 144 18911 0.09% 145 19902 0.10% 146 20541 0.10% 147 21273 0.11% 148 21912 0.11% 149 22320 0.11% 150 22645 0.11% 151 19631076 97.35% 20165478 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=26 prefix-density=0.39 prefix-fanout=2.3 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGCTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=33.95 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.5 sequence=AACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=5.15 fanout-score-rank=27 prefix-density=0.37 prefix-fanout=3.7 sequence=AAGATCCAGGACAAGGAGGGCATCCCCCCGGACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=61.14 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.6 sequence=GCTGCCGGCGTATCGTGCCGGGCACAGCGCGTGGTGGGCGATCTCGCTTTACTCAGCGCAGCGCTGCAGGTGCGTAGCCGGCGCAAAGGCCTCCAAGGACCCCAAAAAACGGAGTGCGCGTCGCTCCGACCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAGCAGCCCAGCTTGAGAATCGGGCGGCCGTGCCGTCCGAATTGTAGTCTGGAGAGGCGTCCTCAGCGACGGACCGGGCCCAAGTCCCCTGGAAAGGGGCGCCTGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAAT SRR7804118 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:04:56 Started mapping on | Dec 10 02:04:56 Finished on | Dec 10 02:09:50 Mapping speed, Million of reads per hour | 246.92 Number of input reads | 20165478 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17435900 Uniquely mapped reads % | 86.46% Average mapped length | 299.71 Number of splices: Total | 17616772 Number of splices: Annotated (sjdb) | 16646968 Number of splices: GT/AG | 17361402 Number of splices: GC/AG | 203571 Number of splices: AT/AC | 7869 Number of splices: Non-canonical | 43930 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421639 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 59806 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.25% % of reads unmapped: other | 2.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2307939 2307939 2307939 N_multimapping 421639 421639 421639 N_noFeature 631084 16930983 801740 N_ambiguous 395653 3570 61064 UnstrandedReadsAssigned:16409163 PositiveStrandReadsAssigned:501347 NegativeStrandReadsAssigned:16573096 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804118 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804118-trimmed-pair1.fastq SRR7804118-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,165,478 reads, 17,051,634 reads pseudoaligned [quant] estimated average fragment length: 315.783 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52973 SRR7804118.ke.tsv 35125 SRR7804118.se.tsv 88098 total ==> SRR7804118.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 621.932 0 0 PNS24247 1044 729.217 63.518 6.54964 PNS24249 1928 1613.22 197.953 9.22669 PNS24246 1044 729.217 63.518 6.54964 PNS24248 1044 729.217 63.518 6.54964 PNS24244 1471 1156.22 20.4934 1.33276 PNS24243 293 72.9728 0 0 KQK14069 1603 1288.22 334.307 19.5134 KQK14071 474 192.103 0 0 ==> SRR7804118.se.tsv <== BRADI_1g14170v3 344 BRADI_1g53295v3 71 BRADI_1g59795v3 57 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 1101 BRADI_1g74790v3 492 BRADI_1g09890v3 0 BRADI_1g77505v3 126 BRADI_1g48960v3 0 SRR7804118 completed mapping pipeline successfully