Starting /dee2/code/volunteer_pipeline.sh SRR7804119 current disk space = 1525225254912 free memory = 1600674188 SRR7804119 SRAfilesize 2dd3f844e93d9e5e41c73f25aac848f2 SRR7804119.sra SRR7804119.sra file validated SRR7804119 is paired end SRR7804119 is conventional basespace SRR7804119 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804119_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2345 37.0 37.0 37.0 37.0 37.0 2 36.23875 37.0 37.0 37.0 37.0 37.0 3 36.459 37.0 37.0 37.0 37.0 37.0 4 36.473 37.0 37.0 37.0 37.0 37.0 5 36.4515 37.0 37.0 37.0 37.0 37.0 6 36.4705 37.0 37.0 37.0 37.0 37.0 7 36.445 37.0 37.0 37.0 37.0 37.0 8 36.4565 37.0 37.0 37.0 37.0 37.0 9 36.5695 37.0 37.0 37.0 37.0 37.0 10-14 36.5425 37.0 37.0 37.0 37.0 37.0 15-19 36.5505 37.0 37.0 37.0 37.0 37.0 20-24 36.4873 37.0 37.0 37.0 37.0 37.0 25-29 36.456500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4559 37.0 37.0 37.0 37.0 37.0 35-39 36.3837 37.0 37.0 37.0 37.0 37.0 40-44 36.460899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4579 37.0 37.0 37.0 37.0 37.0 50-54 36.352500000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.4071 37.0 37.0 37.0 37.0 37.0 60-64 36.3767 37.0 37.0 37.0 37.0 37.0 65-69 36.367 37.0 37.0 37.0 37.0 37.0 70-74 36.2902 37.0 37.0 37.0 37.0 37.0 75-79 36.3054 37.0 37.0 37.0 37.0 37.0 80-84 36.24980000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2262 37.0 37.0 37.0 37.0 37.0 90-94 36.1466 37.0 37.0 37.0 37.0 37.0 95-99 36.144099999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.0964 37.0 37.0 37.0 37.0 37.0 105-109 36.0618 37.0 37.0 37.0 37.0 37.0 110-114 36.03510000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0394 37.0 37.0 37.0 37.0 37.0 120-124 36.001400000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9202 37.0 37.0 37.0 37.0 37.0 130-134 35.838 37.0 37.0 37.0 37.0 37.0 135-139 35.814800000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.711400000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.7648 37.0 37.0 37.0 37.0 37.0 150-151 35.11475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 1.0 25 2.0 26 2.0 27 4.0 28 6.0 29 18.0 30 25.0 31 43.0 32 62.0 33 75.0 34 153.0 35 378.0 36 2845.0 37 383.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.1 11.825 8.799999999999999 33.275 2 26.770077558168627 14.660995746810107 30.723042281711283 27.845884413309985 3 23.974999999999998 18.375 25.074999999999996 32.574999999999996 4 27.400000000000002 24.4 21.025 27.175 5 25.8 28.425 21.775 24.0 6 23.325000000000003 32.7 22.400000000000002 21.575 7 18.224999999999998 24.8 36.225 20.75 8 23.225 23.875 25.624999999999996 27.275 9 20.424999999999997 21.625 31.15 26.8 10-14 24.22 25.595000000000002 23.865 26.32 15-19 23.765 25.155 24.675 26.405 20-24 23.43 26.035000000000004 24.15 26.384999999999998 25-29 24.195 25.215 24.395 26.195 30-34 23.835 24.825 24.6 26.740000000000002 35-39 23.51 24.64 24.77 27.08 40-44 24.169999999999998 24.94 23.805 27.084999999999997 45-49 24.23 24.69 24.195 26.884999999999998 50-54 23.98 24.925 24.490000000000002 26.605 55-59 24.64 24.665 24.610000000000003 26.085 60-64 24.445 24.709999999999997 23.810000000000002 27.034999999999997 65-69 24.3 24.995 24.455 26.25 70-74 24.625 24.990000000000002 23.945 26.44 75-79 23.885 24.98 24.245 26.889999999999997 80-84 24.8 24.03 24.675 26.495 85-89 24.610000000000003 24.395 24.490000000000002 26.505000000000003 90-94 24.46 24.975 23.91 26.655 95-99 25.064999999999998 23.98 24.705 26.25 100-104 24.779999999999998 24.515 24.395 26.31 105-109 24.575 23.86 24.245 27.32 110-114 24.005000000000003 24.65 24.185000000000002 27.16 115-119 25.645 24.04 24.04 26.275 120-124 25.115 24.279999999999998 24.060000000000002 26.545 125-129 24.565 24.315 24.27 26.85 130-134 25.130000000000003 24.195 23.93 26.745 135-139 25.485000000000003 23.96 23.745 26.810000000000002 140-144 24.705 24.04 23.974999999999998 27.279999999999998 145-149 25.330000000000002 24.03 23.955000000000002 26.685 150-151 25.825 23.7125 23.95 26.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 2.5 27 3.0 28 1.5 29 3.5 30 5.0 31 7.0 32 12.0 33 14.5 34 17.0 35 22.5 36 32.5 37 50.5 38 63.0 39 82.0 40 103.0 41 119.5 42 140.0 43 162.5 44 171.5 45 172.0 46 191.5 47 198.5 48 184.5 49 165.5 50 161.0 51 153.5 52 148.0 53 152.5 54 137.0 55 120.5 56 105.0 57 90.0 58 82.5 59 80.5 60 81.0 61 72.0 62 60.0 63 61.5 64 68.0 65 64.5 66 61.0 67 61.0 68 59.5 69 44.0 70 33.0 71 38.0 72 35.5 73 26.0 74 19.0 75 18.5 76 14.5 77 10.5 78 7.0 79 3.5 80 2.5 81 1.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.18852239206221 86.875 2 6.40922499329579 11.95 3 0.34861893268972916 0.975 4 0.053633681952266025 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.75 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9125 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138-139 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTCA 10 0.006830828 145.0 4 >>END_MODULE SRR7804119 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804119_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3115 37.0 37.0 37.0 37.0 37.0 2 36.143 37.0 37.0 37.0 37.0 37.0 3 36.069 37.0 37.0 37.0 37.0 37.0 4 36.277 37.0 37.0 37.0 37.0 37.0 5 36.1985 37.0 37.0 37.0 37.0 37.0 6 36.3285 37.0 37.0 37.0 37.0 37.0 7 36.2285 37.0 37.0 37.0 37.0 37.0 8 36.3845 37.0 37.0 37.0 37.0 37.0 9 36.206 37.0 37.0 37.0 37.0 37.0 10-14 36.255 37.0 37.0 37.0 37.0 37.0 15-19 36.16289999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.194 37.0 37.0 37.0 37.0 37.0 25-29 36.1154 37.0 37.0 37.0 37.0 37.0 30-34 36.1052 37.0 37.0 37.0 37.0 37.0 35-39 36.1025 37.0 37.0 37.0 37.0 37.0 40-44 36.052 37.0 37.0 37.0 37.0 37.0 45-49 36.0127 37.0 37.0 37.0 37.0 37.0 50-54 35.9406 37.0 37.0 37.0 37.0 37.0 55-59 35.8657 37.0 37.0 37.0 37.0 37.0 60-64 35.9235 37.0 37.0 37.0 37.0 37.0 65-69 35.8888 37.0 37.0 37.0 37.0 37.0 70-74 35.88 37.0 37.0 37.0 37.0 37.0 75-79 35.82340000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.7815 37.0 37.0 37.0 37.0 37.0 85-89 35.8023 37.0 37.0 37.0 37.0 37.0 90-94 35.7666 37.0 37.0 37.0 37.0 37.0 95-99 35.6533 37.0 37.0 37.0 37.0 37.0 100-104 35.6768 37.0 37.0 37.0 37.0 37.0 105-109 35.6329 37.0 37.0 37.0 37.0 37.0 110-114 35.537400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.535399999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.485800000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4251 37.0 37.0 37.0 37.0 37.0 130-134 35.469899999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.3626 37.0 37.0 37.0 37.0 37.0 140-144 35.3372 37.0 37.0 37.0 37.0 37.0 145-149 35.1794 37.0 37.0 37.0 29.8 37.0 150-151 34.892250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 7.0 15 7.0 16 1.0 17 3.0 18 3.0 19 0.0 20 5.0 21 4.0 22 9.0 23 8.0 24 7.0 25 4.0 26 9.0 27 10.0 28 12.0 29 14.0 30 28.0 31 42.0 32 60.0 33 95.0 34 204.0 35 534.0 36 2704.0 37 227.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.9 18.9 10.7 29.5 2 31.175000000000004 22.85 23.575 22.400000000000002 3 24.4 25.75 26.075 23.775 4 27.400000000000002 28.799999999999997 17.5 26.3 5 27.375 31.674999999999997 18.6 22.35 6 26.325 32.45 19.3 21.925 7 24.75 19.475 30.25 25.525 8 24.625 21.8 23.3 30.275000000000002 9 23.400000000000002 21.925 25.4 29.275000000000002 10-14 26.040000000000003 25.130000000000003 21.855 26.974999999999998 15-19 26.86 24.34 22.025 26.775 20-24 27.07 24.044999999999998 22.675 26.21 25-29 26.765 23.955000000000002 22.95 26.33 30-34 26.815 24.11 22.875 26.200000000000003 35-39 27.200000000000003 24.075 22.63 26.095000000000002 40-44 26.44 24.09 23.31 26.16 45-49 26.174999999999997 24.75 22.770000000000003 26.305 50-54 26.950000000000003 24.505 22.865 25.679999999999996 55-59 27.41 24.15 22.625 25.814999999999998 60-64 26.625 24.755 22.79 25.83 65-69 27.07 24.279999999999998 23.13 25.52 70-74 27.1 24.605 22.95 25.345000000000002 75-79 27.875 23.69 22.97 25.465 80-84 27.045 24.240000000000002 22.814999999999998 25.900000000000002 85-89 27.375 24.240000000000002 23.294999999999998 25.09 90-94 27.495000000000005 23.895 23.09 25.52 95-99 27.060000000000002 24.585 23.080000000000002 25.275 100-104 27.250000000000004 23.93 23.56 25.259999999999998 105-109 27.77 24.404999999999998 22.62 25.205 110-114 27.905 24.435000000000002 22.97 24.69 115-119 27.735 24.195 23.544999999999998 24.525 120-124 27.41 24.675 23.085 24.83 125-129 27.16 24.709999999999997 23.23 24.9 130-134 28.249999999999996 24.38 22.405 24.965 135-139 27.0 24.27 23.294999999999998 25.435000000000002 140-144 27.58 25.21 22.875 24.335 145-149 27.99 24.154999999999998 23.169999999999998 24.685000000000002 150-151 28.225 24.337500000000002 22.4875 24.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.0 16 0.5 17 1.0 18 1.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.5 27 0.5 28 1.5 29 3.5 30 4.5 31 5.5 32 4.5 33 7.0 34 11.0 35 13.5 36 24.0 37 38.5 38 54.0 39 70.5 40 88.0 41 113.0 42 132.0 43 151.5 44 158.5 45 155.0 46 163.5 47 167.5 48 157.5 49 150.0 50 138.0 51 138.5 52 143.5 53 135.5 54 125.5 55 111.5 56 99.5 57 95.0 58 99.5 59 88.5 60 82.0 61 86.0 62 85.5 63 85.5 64 80.5 65 73.5 66 79.5 67 78.0 68 71.0 69 65.5 70 59.5 71 57.0 72 50.5 73 48.5 74 39.0 75 25.0 76 20.0 77 15.0 78 8.0 79 3.0 80 2.5 81 2.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 1.5 97 2.0 98 0.5 99 0.0 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.05 #Duplication Level Percentage of deduplicated Percentage of total 1 93.44438473938743 86.95 2 6.072004298764106 11.3 3 0.37614185921547555 1.05 4 0.08060182697474476 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026867275658248254 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9625 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138-139 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTCTC 10 0.006830828 145.0 5 CTGTCCA 10 0.006830828 145.0 145 >>END_MODULE Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra Read 1685993 spots for SRR7804119.sra Written 1685993 spots for SRR7804119.sra SRR ids: ['SRR7804119.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0xwdt8hl SRR7804119.sra spots: 33719860 blocks: [[1, 1685993], [1685994, 3371986], [3371987, 5057979], [5057980, 6743972], [6743973, 8429965], [8429966, 10115958], [10115959, 11801951], [11801952, 13487944], [13487945, 15173937], [15173938, 16859930], [16859931, 18545923], [18545924, 20231916], [20231917, 21917909], [21917910, 23603902], [23603903, 25289895], [25289896, 26975888], [26975889, 28661881], [28661882, 30347874], [30347875, 32033867], [32033868, 33719860]] SRR7804119 file size 11404853 SRR7804119 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804119 SRR7804119_1.fastq SRR7804119_2.fastq Input file: SRR7804119_1.fastq Paired file: SRR7804119_2.fastq trimmed: SRR7804119-trimmed-pair1.fastq, SRR7804119-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:09:51 2024 >> started Tue Dec 10 02:10:31 2024 >> done (39.970s) 33719860 read pairs processed; of these: 118 ( 0.00%) short read pairs filtered out after trimming by size control 1275 ( 0.00%) empty read pairs filtered out after trimming by size control 33718467 (100.00%) read pairs available; of these: 628957 ( 1.87%) trimmed read pairs available after processing 33089510 (98.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 17 0.00% 20 14 0.00% 21 13 0.00% 22 17 0.00% 23 22 0.00% 24 22 0.00% 25 20 0.00% 26 19 0.00% 27 30 0.00% 28 28 0.00% 29 30 0.00% 30 32 0.00% 31 34 0.00% 32 44 0.00% 33 40 0.00% 34 34 0.00% 35 48 0.00% 36 43 0.00% 37 48 0.00% 38 51 0.00% 39 61 0.00% 40 46 0.00% 41 47 0.00% 42 48 0.00% 43 56 0.00% 44 49 0.00% 45 50 0.00% 46 72 0.00% 47 67 0.00% 48 62 0.00% 49 57 0.00% 50 92 0.00% 51 87 0.00% 52 55 0.00% 53 62 0.00% 54 70 0.00% 55 78 0.00% 56 65 0.00% 57 89 0.00% 58 98 0.00% 59 88 0.00% 60 109 0.00% 61 89 0.00% 62 111 0.00% 63 113 0.00% 64 116 0.00% 65 145 0.00% 66 111 0.00% 67 136 0.00% 68 107 0.00% 69 194 0.00% 70 160 0.00% 71 210 0.00% 72 192 0.00% 73 251 0.00% 74 219 0.00% 75 266 0.00% 76 291 0.00% 77 287 0.00% 78 346 0.00% 79 397 0.00% 80 406 0.00% 81 435 0.00% 82 506 0.00% 83 551 0.00% 84 574 0.00% 85 694 0.00% 86 719 0.00% 87 785 0.00% 88 887 0.00% 89 890 0.00% 90 974 0.00% 91 1178 0.00% 92 1348 0.00% 93 1424 0.00% 94 1599 0.00% 95 1748 0.01% 96 1878 0.01% 97 1990 0.01% 98 2059 0.01% 99 2187 0.01% 100 2442 0.01% 101 2678 0.01% 102 2875 0.01% 103 3113 0.01% 104 3290 0.01% 105 3553 0.01% 106 3916 0.01% 107 3950 0.01% 108 4121 0.01% 109 4480 0.01% 110 4581 0.01% 111 4925 0.01% 112 5469 0.02% 113 5819 0.02% 114 6060 0.02% 115 6411 0.02% 116 6657 0.02% 117 6763 0.02% 118 7144 0.02% 119 7516 0.02% 120 7765 0.02% 121 8140 0.02% 122 8630 0.03% 123 9576 0.03% 124 9966 0.03% 125 10289 0.03% 126 10629 0.03% 127 11063 0.03% 128 11256 0.03% 129 11826 0.04% 130 12392 0.04% 131 12833 0.04% 132 13611 0.04% 133 14426 0.04% 134 14917 0.04% 135 15678 0.05% 136 16430 0.05% 137 16910 0.05% 138 17150 0.05% 139 17883 0.05% 140 18532 0.05% 141 18953 0.06% 142 20376 0.06% 143 21106 0.06% 144 22381 0.07% 145 23563 0.07% 146 23993 0.07% 147 25113 0.07% 148 25430 0.08% 149 26504 0.08% 150 27181 0.08% 151 33089510 98.13% 33718467 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=13.02 fanout-score-rank=7 prefix-density=0.31 prefix-fanout=6.7 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=814.00 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=29.3 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=11.56 fanout-score-rank=15 prefix-density=1.08 prefix-fanout=4.1 sequence=TCTTCTTCTTCTCCTCCTTGATTTCATCAGCTTGAGGTTAAAAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGGCAGCACCAACACTAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGTGCCGGAGAAGAAGCAGGAGCAGCTCGAGATGGCCGGCGTGTCCGGCAGCGAGGGGTGCAGCTGCGGCGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=765.37 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=20.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804119 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:11:22 Started mapping on | Dec 10 02:11:22 Finished on | Dec 10 02:15:37 Mapping speed, Million of reads per hour | 476.03 Number of input reads | 33718467 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 30879382 Uniquely mapped reads % | 91.58% Average mapped length | 299.96 Number of splices: Total | 32763431 Number of splices: Annotated (sjdb) | 30856828 Number of splices: GT/AG | 32290005 Number of splices: GC/AG | 363263 Number of splices: AT/AC | 25898 Number of splices: Non-canonical | 84265 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 489963 % of reads mapped to multiple loci | 1.45% Number of reads mapped to too many loci | 17565 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.51% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2349122 2349122 2349122 N_multimapping 489963 489963 489963 N_noFeature 599254 30082242 820947 N_ambiguous 674079 5654 99342 UnstrandedReadsAssigned:29606049 PositiveStrandReadsAssigned:791486 NegativeStrandReadsAssigned:29959093 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804119 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804119-trimmed-pair1.fastq SRR7804119-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,718,467 reads, 30,399,660 reads pseudoaligned [quant] estimated average fragment length: 318.499 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR7804119.ke.tsv 35125 SRR7804119.se.tsv 88098 total ==> SRR7804119.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 619.139 24.1644 1.68413 PNS24247 1044 726.501 125.537 7.45631 PNS24249 1928 1610.5 351.194 9.40967 PNS24246 1044 726.501 125.537 7.45631 PNS24248 1044 726.501 125.537 7.45631 PNS24244 1471 1153.5 132.03 4.93906 PNS24243 293 67.6954 0 0 KQK14069 1603 1285.5 19628.6 658.877 KQK14071 474 188.19 105.761 24.2504 ==> SRR7804119.se.tsv <== BRADI_1g14170v3 20205 BRADI_1g53295v3 1227 BRADI_1g59795v3 180 BRADI_1g07683v3 0 BRADI_1g00485v3 75 BRADI_1g20270v3 1991 BRADI_1g74790v3 65 BRADI_1g09890v3 0 BRADI_1g77505v3 352 BRADI_1g48960v3 3 SRR7804119 completed mapping pipeline successfully