Starting /dee2/code/volunteer_pipeline.sh SRR7804120 current disk space = 1525235396608 free memory = 1567134084 SRR7804120 SRAfilesize f563aff6387e93e359f9efd74d9f10d1 SRR7804120.sra SRR7804120.sra file validated SRR7804120 is paired end SRR7804120 is conventional basespace SRR7804120 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2325 37.0 37.0 37.0 37.0 37.0 2 36.2665 37.0 37.0 37.0 37.0 37.0 3 36.4225 37.0 37.0 37.0 37.0 37.0 4 36.501 37.0 37.0 37.0 37.0 37.0 5 36.5195 37.0 37.0 37.0 37.0 37.0 6 36.4625 37.0 37.0 37.0 37.0 37.0 7 36.4965 37.0 37.0 37.0 37.0 37.0 8 36.5035 37.0 37.0 37.0 37.0 37.0 9 36.477 37.0 37.0 37.0 37.0 37.0 10-14 36.50959999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.486900000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4435 37.0 37.0 37.0 37.0 37.0 25-29 36.4129 37.0 37.0 37.0 37.0 37.0 30-34 36.411699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.380300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.438599999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.381299999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.379200000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.355 37.0 37.0 37.0 37.0 37.0 60-64 36.3287 37.0 37.0 37.0 37.0 37.0 65-69 36.3134 37.0 37.0 37.0 37.0 37.0 70-74 36.2598 37.0 37.0 37.0 37.0 37.0 75-79 36.2671 37.0 37.0 37.0 37.0 37.0 80-84 36.201800000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.2096 37.0 37.0 37.0 37.0 37.0 90-94 36.202099999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.170500000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1955 37.0 37.0 37.0 37.0 37.0 105-109 36.0819 37.0 37.0 37.0 37.0 37.0 110-114 36.0449 37.0 37.0 37.0 37.0 37.0 115-119 36.113 37.0 37.0 37.0 37.0 37.0 120-124 36.0184 37.0 37.0 37.0 37.0 37.0 125-129 35.897 37.0 37.0 37.0 37.0 37.0 130-134 35.9002 37.0 37.0 37.0 37.0 37.0 135-139 35.858999999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.8077 37.0 37.0 37.0 37.0 37.0 145-149 35.769 37.0 37.0 37.0 37.0 37.0 150-151 35.32425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 8.0 27 4.0 28 12.0 29 17.0 30 40.0 31 36.0 32 64.0 33 92.0 34 131.0 35 319.0 36 2876.0 37 397.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.925 11.3 8.625 33.15 2 26.96348174087044 12.88144072036018 31.6408204102051 28.51425712856428 3 24.05 17.4 23.325000000000003 35.225 4 28.799999999999997 22.900000000000002 20.724999999999998 27.575 5 27.325 26.325 22.0 24.349999999999998 6 24.2 29.075 23.075000000000003 23.65 7 18.8 23.400000000000002 36.449999999999996 21.349999999999998 8 21.025 22.0 27.800000000000004 29.175 9 21.3 20.9 30.75 27.05 10-14 24.855 24.23 24.404999999999998 26.51 15-19 24.46 23.665 25.080000000000002 26.795 20-24 25.05 23.405 24.63 26.915 25-29 25.005 23.71 24.75 26.534999999999997 30-34 24.560000000000002 24.025 24.295 27.12 35-39 24.85 23.625 24.33 27.195000000000004 40-44 24.86 23.7 24.07 27.37 45-49 24.515 23.285 24.13 28.07 50-54 25.019999999999996 22.650000000000002 24.959999999999997 27.37 55-59 24.335 23.7 23.745 28.22 60-64 24.77 23.695 24.075 27.46 65-69 24.759999999999998 23.805 23.24 28.194999999999997 70-74 25.21 23.16 24.115000000000002 27.515 75-79 24.675 23.105 24.169999999999998 28.050000000000004 80-84 25.490000000000002 23.235 23.91 27.365000000000002 85-89 25.995 22.64 23.544999999999998 27.82 90-94 25.39 23.244999999999997 24.09 27.275 95-99 25.380000000000003 22.689999999999998 24.4 27.529999999999998 100-104 26.290000000000003 22.314999999999998 23.97 27.425 105-109 26.405 22.89 23.23 27.474999999999998 110-114 25.14 23.24 23.905 27.715 115-119 25.669999999999998 22.7 23.59 28.04 120-124 25.290000000000003 22.63 23.995 28.084999999999997 125-129 25.365 23.150000000000002 23.355 28.13 130-134 26.32 22.48 23.23 27.97 135-139 25.729999999999997 23.055 23.849999999999998 27.365000000000002 140-144 26.015 22.805 23.51 27.67 145-149 25.729999999999997 22.645 23.745 27.88 150-151 26.2125 22.275 23.775 27.737499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 1.5 29 3.5 30 4.5 31 8.0 32 10.0 33 14.0 34 22.0 35 28.5 36 39.0 37 50.0 38 54.0 39 65.0 40 83.5 41 90.5 42 118.0 43 141.0 44 135.0 45 138.5 46 148.0 47 138.5 48 143.0 49 143.5 50 137.0 51 148.0 52 140.5 53 140.0 54 135.5 55 143.0 56 144.5 57 127.5 58 125.0 59 117.0 60 109.0 61 104.0 62 91.0 63 76.5 64 79.5 65 80.0 66 68.5 67 67.0 68 67.0 69 59.0 70 56.0 71 48.0 72 36.5 73 28.0 74 19.0 75 19.0 76 18.0 77 11.5 78 7.0 79 5.5 80 3.5 81 1.5 82 1.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.75 #Duplication Level Percentage of deduplicated Percentage of total 1 90.99173553719008 82.575 2 8.044077134986226 14.6 3 0.7713498622589532 2.1 4 0.1652892561983471 0.6 5 0.027548209366391182 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCGACGTGGGGCTGGATCTCAGTGGATCGTGGCAGCAAGGCCACTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.3250000000000002 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138-139 2.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATCAT 10 0.006830828 145.0 4 GGCCCGT 10 0.006830828 145.0 3 >>END_MODULE SRR7804120 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.414 37.0 37.0 37.0 37.0 37.0 2 36.1455 37.0 37.0 37.0 37.0 37.0 3 36.21 37.0 37.0 37.0 37.0 37.0 4 36.3175 37.0 37.0 37.0 37.0 37.0 5 36.205 37.0 37.0 37.0 37.0 37.0 6 36.287 37.0 37.0 37.0 37.0 37.0 7 36.081 37.0 37.0 37.0 37.0 37.0 8 36.312 37.0 37.0 37.0 37.0 37.0 9 36.254 37.0 37.0 37.0 37.0 37.0 10-14 36.2295 37.0 37.0 37.0 37.0 37.0 15-19 36.1653 37.0 37.0 37.0 37.0 37.0 20-24 36.196600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.142399999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.0761 37.0 37.0 37.0 37.0 37.0 35-39 36.1082 37.0 37.0 37.0 37.0 37.0 40-44 36.058800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.0601 37.0 37.0 37.0 37.0 37.0 50-54 36.0181 37.0 37.0 37.0 37.0 37.0 55-59 35.9847 37.0 37.0 37.0 37.0 37.0 60-64 35.958299999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.9304 37.0 37.0 37.0 37.0 37.0 70-74 35.8871 37.0 37.0 37.0 37.0 37.0 75-79 35.8673 37.0 37.0 37.0 37.0 37.0 80-84 35.8595 37.0 37.0 37.0 37.0 37.0 85-89 35.906800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.8344 37.0 37.0 37.0 37.0 37.0 95-99 35.7926 37.0 37.0 37.0 37.0 37.0 100-104 35.787400000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7427 37.0 37.0 37.0 37.0 37.0 110-114 35.6357 37.0 37.0 37.0 37.0 37.0 115-119 35.658300000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6528 37.0 37.0 37.0 37.0 37.0 125-129 35.5776 37.0 37.0 37.0 37.0 37.0 130-134 35.5469 37.0 37.0 37.0 37.0 37.0 135-139 35.4924 37.0 37.0 37.0 37.0 37.0 140-144 35.4669 37.0 37.0 37.0 37.0 37.0 145-149 35.2282 37.0 37.0 37.0 29.8 37.0 150-151 34.8015 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 7.0 15 5.0 16 3.0 17 1.0 18 2.0 19 3.0 20 4.0 21 8.0 22 10.0 23 5.0 24 8.0 25 9.0 26 5.0 27 12.0 28 12.0 29 20.0 30 18.0 31 35.0 32 51.0 33 89.0 34 152.0 35 451.0 36 2778.0 37 305.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.925 19.225 9.65 30.2 2 34.0 21.425 22.55 22.025 3 27.250000000000004 25.4 24.2 23.150000000000002 4 29.075 29.775000000000002 17.95 23.200000000000003 5 30.075000000000003 31.75 16.650000000000002 21.525 6 26.575 31.574999999999996 18.025 23.825 7 24.0 19.45 31.35 25.2 8 25.5 23.325000000000003 20.724999999999998 30.45 9 25.974999999999998 21.6 23.799999999999997 28.625 10-14 28.025 24.055 21.175 26.745 15-19 27.639999999999997 24.39 21.34 26.63 20-24 27.884999999999998 24.435000000000002 20.855 26.825 25-29 27.93 24.34 20.715 27.015 30-34 27.450000000000003 24.46 22.055 26.035000000000004 35-39 27.865000000000002 24.63 20.915 26.590000000000003 40-44 28.09 23.61 21.84 26.46 45-49 28.235 23.990000000000002 21.224999999999998 26.55 50-54 28.15 23.96 21.19 26.700000000000003 55-59 27.334999999999997 24.3 21.355 27.01 60-64 27.810000000000002 23.96 21.43 26.8 65-69 28.299999999999997 23.605 21.725 26.369999999999997 70-74 28.299999999999997 23.77 21.605 26.325 75-79 27.715 23.435 22.285 26.565 80-84 27.92 23.595 21.54 26.945000000000004 85-89 27.57 23.915 21.65 26.865 90-94 27.97 24.29 22.14 25.6 95-99 28.439999999999998 24.075 21.54 25.945 100-104 28.01 23.775 21.815 26.400000000000002 105-109 28.03 24.474999999999998 21.709999999999997 25.785000000000004 110-114 27.595 24.23 22.165000000000003 26.009999999999998 115-119 27.834999999999997 24.69 21.18 26.295 120-124 28.655 23.799999999999997 21.310000000000002 26.235000000000003 125-129 28.51 23.919999999999998 21.755 25.814999999999998 130-134 28.115000000000002 24.425 21.445 26.015 135-139 27.779999999999998 24.435000000000002 21.51 26.275 140-144 28.475 24.015 21.9 25.61 145-149 28.33 23.919999999999998 22.009999999999998 25.740000000000002 150-151 29.062500000000004 24.45 21.3875 25.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 2.0 11 2.5 12 1.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 1.0 25 0.0 26 0.5 27 1.5 28 3.5 29 2.5 30 4.0 31 7.0 32 6.5 33 6.0 34 9.0 35 10.5 36 15.0 37 36.0 38 55.0 39 54.0 40 59.5 41 70.5 42 92.0 43 121.0 44 126.0 45 124.5 46 122.5 47 129.5 48 128.5 49 122.0 50 132.0 51 143.0 52 140.0 53 127.5 54 134.5 55 147.0 56 127.0 57 106.5 58 118.0 59 127.0 60 122.5 61 112.5 62 108.5 63 104.0 64 95.0 65 92.0 66 82.0 67 78.5 68 87.0 69 83.5 70 78.5 71 72.5 72 60.5 73 53.5 74 39.0 75 22.0 76 21.5 77 20.5 78 13.5 79 9.0 80 4.5 81 2.0 82 1.0 83 1.5 84 0.5 85 0.0 86 1.0 87 1.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 1.0 96 1.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.51054384017758 81.55 2 8.407325194228635 15.15 3 0.8324084350721421 2.25 4 0.13873473917869034 0.5 5 0.05549389567147614 0.25 6 0.05549389567147614 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 6 0.15 No Hit CGAAAACATTGGTGAGAATCCAATGCCCCGAAAACCCAAGGTTTCCTCCG 6 0.15 No Hit AAGCAATTAAGCAAAAGCAATGGCCTCCCAGCTCTCCGCCATGGCCTCCG 5 0.125 No Hit GCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.9875 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.3625 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.8 0.0 0.0 0.0 0.0 136-137 1.9249999999999998 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAGGG 10 0.006830828 145.0 2 AGATATC 10 0.006830828 145.0 4 >>END_MODULE Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275559 spots for SRR7804120.sra Written 1275559 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra Read 1275548 spots for SRR7804120.sra Written 1275548 spots for SRR7804120.sra SRR ids: ['SRR7804120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n73i1r0r SRR7804120.sra spots: 25510971 blocks: [[1, 1275548], [1275549, 2551096], [2551097, 3826644], [3826645, 5102192], [5102193, 6377740], [6377741, 7653288], [7653289, 8928836], [8928837, 10204384], [10204385, 11479932], [11479933, 12755480], [12755481, 14031028], [14031029, 15306576], [15306577, 16582124], [16582125, 17857672], [17857673, 19133220], [19133221, 20408768], [20408769, 21684316], [21684317, 22959864], [22959865, 24235412], [24235413, 25510971]] SRR7804120 file size 8623130 SRR7804120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804120 SRR7804120_1.fastq SRR7804120_2.fastq Input file: SRR7804120_1.fastq Paired file: SRR7804120_2.fastq trimmed: SRR7804120-trimmed-pair1.fastq, SRR7804120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:06:22 2024 >> started Tue Dec 10 02:06:50 2024 >> done (28.740s) 25510971 read pairs processed; of these: 96 ( 0.00%) short read pairs filtered out after trimming by size control 600 ( 0.00%) empty read pairs filtered out after trimming by size control 25510275 (100.00%) read pairs available; of these: 812135 ( 3.18%) trimmed read pairs available after processing 24698140 (96.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 8 0.00% 21 9 0.00% 22 6 0.00% 23 13 0.00% 24 13 0.00% 25 16 0.00% 26 9 0.00% 27 20 0.00% 28 21 0.00% 29 18 0.00% 30 19 0.00% 31 20 0.00% 32 17 0.00% 33 19 0.00% 34 14 0.00% 35 27 0.00% 36 24 0.00% 37 16 0.00% 38 30 0.00% 39 20 0.00% 40 22 0.00% 41 20 0.00% 42 24 0.00% 43 17 0.00% 44 22 0.00% 45 23 0.00% 46 42 0.00% 47 35 0.00% 48 21 0.00% 49 25 0.00% 50 30 0.00% 51 39 0.00% 52 45 0.00% 53 37 0.00% 54 36 0.00% 55 41 0.00% 56 38 0.00% 57 63 0.00% 58 41 0.00% 59 51 0.00% 60 74 0.00% 61 58 0.00% 62 51 0.00% 63 79 0.00% 64 49 0.00% 65 76 0.00% 66 104 0.00% 67 90 0.00% 68 125 0.00% 69 111 0.00% 70 114 0.00% 71 131 0.00% 72 148 0.00% 73 156 0.00% 74 233 0.00% 75 210 0.00% 76 249 0.00% 77 225 0.00% 78 294 0.00% 79 335 0.00% 80 383 0.00% 81 411 0.00% 82 518 0.00% 83 591 0.00% 84 680 0.00% 85 707 0.00% 86 798 0.00% 87 869 0.00% 88 995 0.00% 89 1069 0.00% 90 1210 0.00% 91 1380 0.01% 92 1496 0.01% 93 1567 0.01% 94 1912 0.01% 95 2018 0.01% 96 2299 0.01% 97 2299 0.01% 98 2660 0.01% 99 2698 0.01% 100 3010 0.01% 101 3229 0.01% 102 3575 0.01% 103 3810 0.01% 104 4162 0.02% 105 4468 0.02% 106 4766 0.02% 107 4995 0.02% 108 5252 0.02% 109 5561 0.02% 110 6024 0.02% 111 6381 0.03% 112 6770 0.03% 113 7354 0.03% 114 7767 0.03% 115 8420 0.03% 116 8807 0.03% 117 9107 0.04% 118 9442 0.04% 119 9754 0.04% 120 10177 0.04% 121 10733 0.04% 122 11436 0.04% 123 12419 0.05% 124 12971 0.05% 125 13637 0.05% 126 14350 0.06% 127 14803 0.06% 128 15363 0.06% 129 15931 0.06% 130 16194 0.06% 131 17118 0.07% 132 17946 0.07% 133 18808 0.07% 134 20175 0.08% 135 20846 0.08% 136 21649 0.08% 137 22142 0.09% 138 22670 0.09% 139 23834 0.09% 140 24150 0.09% 141 25310 0.10% 142 26249 0.10% 143 27481 0.11% 144 28761 0.11% 145 29740 0.12% 146 31131 0.12% 147 32056 0.13% 148 32817 0.13% 149 33585 0.13% 150 34503 0.14% 151 24698140 96.82% 25510275 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=22 prefix-density=1.01 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=62.32 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=3.4 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=13 prefix-density=0.84 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=39.62 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.1 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804120 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:07:37 Started mapping on | Dec 10 02:07:37 Finished on | Dec 10 02:11:06 Mapping speed, Million of reads per hour | 439.41 Number of input reads | 25510275 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 21238094 Uniquely mapped reads % | 83.25% Average mapped length | 299.63 Number of splices: Total | 20829711 Number of splices: Annotated (sjdb) | 19753501 Number of splices: GT/AG | 20517160 Number of splices: GC/AG | 260869 Number of splices: AT/AC | 7250 Number of splices: Non-canonical | 44432 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1203834 % of reads mapped to multiple loci | 4.72% Number of reads mapped to too many loci | 157320 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.69% % of reads unmapped: other | 4.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3068347 3068347 3068347 N_multimapping 1203834 1203834 1203834 N_noFeature 1720180 20596563 1852674 N_ambiguous 630473 3471 122462 UnstrandedReadsAssigned:18887441 PositiveStrandReadsAssigned:638060 NegativeStrandReadsAssigned:19262958 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804120-trimmed-pair1.fastq SRR7804120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,510,275 reads, 19,915,419 reads pseudoaligned [quant] estimated average fragment length: 294.805 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52973 SRR7804120.ke.tsv 35125 SRR7804120.se.tsv 88098 total ==> SRR7804120.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 642.616 33.4606 2.88565 PNS24247 1044 750.195 49.2585 3.6389 PNS24249 1928 1634.19 111.942 3.79624 PNS24246 1044 750.195 49.2585 3.6389 PNS24248 1044 750.195 49.2585 3.6389 PNS24244 1471 1177.19 76.8216 3.61658 PNS24243 293 74.4207 0 0 KQK14069 1603 1309.19 4091.35 173.191 KQK14071 474 204.284 28.0427 7.60763 ==> SRR7804120.se.tsv <== BRADI_1g14170v3 4102 BRADI_1g53295v3 701 BRADI_1g59795v3 247 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 195 BRADI_1g74790v3 429 BRADI_1g09890v3 0 BRADI_1g77505v3 513 BRADI_1g48960v3 0 SRR7804120 completed mapping pipeline successfully