Starting /dee2/code/volunteer_pipeline.sh SRR7804121 current disk space = 1525332369408 free memory = 1557438660 SRR7804121 SRAfilesize d44488e37a9ccdb00561ad962c2ae395 SRR7804121.sra SRR7804121.sra file validated SRR7804121 is paired end SRR7804121 is conventional basespace SRR7804121 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804121_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1965 37.0 37.0 37.0 37.0 37.0 2 36.169 37.0 37.0 37.0 37.0 37.0 3 36.38 37.0 37.0 37.0 37.0 37.0 4 36.359 37.0 37.0 37.0 37.0 37.0 5 36.5025 37.0 37.0 37.0 37.0 37.0 6 36.414 37.0 37.0 37.0 37.0 37.0 7 36.351 37.0 37.0 37.0 37.0 37.0 8 36.455 37.0 37.0 37.0 37.0 37.0 9 36.4145 37.0 37.0 37.0 37.0 37.0 10-14 36.414 37.0 37.0 37.0 37.0 37.0 15-19 36.4735 37.0 37.0 37.0 37.0 37.0 20-24 36.40749999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4249 37.0 37.0 37.0 37.0 37.0 30-34 36.3543 37.0 37.0 37.0 37.0 37.0 35-39 36.356399999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3777 37.0 37.0 37.0 37.0 37.0 45-49 36.3135 37.0 37.0 37.0 37.0 37.0 50-54 36.29260000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.26520000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.275400000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.225100000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.1432 37.0 37.0 37.0 37.0 37.0 75-79 36.176 37.0 37.0 37.0 37.0 37.0 80-84 36.1258 37.0 37.0 37.0 37.0 37.0 85-89 36.1597 37.0 37.0 37.0 37.0 37.0 90-94 36.11880000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.056 37.0 37.0 37.0 37.0 37.0 100-104 36.08879999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.947700000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.9952 37.0 37.0 37.0 37.0 37.0 115-119 35.9198 37.0 37.0 37.0 37.0 37.0 120-124 35.862199999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.776599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.764700000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.7581 37.0 37.0 37.0 37.0 37.0 140-144 35.7394 37.0 37.0 37.0 37.0 37.0 145-149 35.6916 37.0 37.0 37.0 37.0 37.0 150-151 35.19525 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 4.0 25 6.0 26 2.0 27 15.0 28 11.0 29 19.0 30 32.0 31 45.0 32 51.0 33 87.0 34 170.0 35 363.0 36 2831.0 37 358.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.275 11.4 8.375 35.949999999999996 2 26.263131565782892 13.131565782891446 29.61480740370185 30.990495247623812 3 22.125 17.275 22.25 38.35 4 26.0 23.275000000000002 21.325 29.4 5 26.150000000000002 27.625 21.7 24.525 6 25.55 29.325000000000003 22.3 22.825 7 19.2 25.2 35.0 20.599999999999998 8 22.325 23.474999999999998 27.725 26.474999999999998 9 20.075000000000003 22.15 32.1 25.674999999999997 10-14 23.580000000000002 26.815 23.965 25.64 15-19 23.785 25.115 25.174999999999997 25.924999999999997 20-24 23.745 25.724999999999998 24.87 25.66 25-29 24.115000000000002 25.580000000000002 24.005000000000003 26.3 30-34 23.75 25.1 24.87 26.279999999999998 35-39 23.45 24.855 24.59 27.105 40-44 24.255 24.915000000000003 24.535 26.295 45-49 24.03 25.245 24.555 26.169999999999998 50-54 23.78 25.275 24.41 26.534999999999997 55-59 23.77 24.985 24.675 26.57 60-64 25.009999999999998 24.834999999999997 24.02 26.135 65-69 24.635 24.57 23.845 26.950000000000003 70-74 24.385 25.25 24.015 26.35 75-79 24.385 24.91 24.54 26.165 80-84 24.525 24.2 24.59 26.685 85-89 24.67 24.075 23.935000000000002 27.32 90-94 24.82 24.740000000000002 23.66 26.779999999999998 95-99 24.08 24.705 24.3 26.915 100-104 24.41 24.92 23.990000000000002 26.68 105-109 24.32 24.45 24.5 26.729999999999997 110-114 24.43 24.775 23.7 27.095000000000002 115-119 24.72 24.185000000000002 24.54 26.555 120-124 25.385 24.565 23.44 26.61 125-129 24.44 24.0 24.495 27.065 130-134 24.695 24.32 24.33 26.655 135-139 24.595 24.335 24.445 26.625 140-144 25.424999999999997 24.085 23.885 26.605 145-149 24.83 23.75 24.04 27.38 150-151 24.075 24.6125 24.1625 27.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.0 28 2.0 29 3.5 30 4.5 31 7.0 32 8.5 33 13.5 34 19.0 35 25.5 36 32.0 37 41.5 38 64.5 39 85.0 40 92.0 41 109.5 42 131.0 43 140.5 44 159.0 45 195.5 46 194.5 47 187.0 48 198.5 49 192.5 50 186.0 51 167.0 52 141.0 53 136.5 54 144.5 55 138.5 56 112.0 57 97.5 58 99.0 59 81.0 60 70.0 61 76.0 62 74.0 63 66.0 64 65.5 65 59.5 66 51.5 67 52.0 68 48.0 69 43.5 70 39.0 71 31.0 72 23.0 73 17.5 74 15.0 75 14.0 76 14.5 77 11.0 78 5.0 79 4.0 80 3.5 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.68394604601957 89.5 2 4.919333509653531 9.3 3 0.34382438508331126 0.975 4 0.026448029621793177 0.1 5 0.026448029621793177 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGCACAATGGCATTTTTCACAAGTGTCTGGGTCCTGACAAGCTCATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.30000000000000004 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138-139 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804121 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804121_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.293 37.0 37.0 37.0 37.0 37.0 2 36.083 37.0 37.0 37.0 37.0 37.0 3 36.0955 37.0 37.0 37.0 37.0 37.0 4 36.1925 37.0 37.0 37.0 37.0 37.0 5 36.132 37.0 37.0 37.0 37.0 37.0 6 36.1725 37.0 37.0 37.0 37.0 37.0 7 36.1645 37.0 37.0 37.0 37.0 37.0 8 36.329 37.0 37.0 37.0 37.0 37.0 9 36.075 37.0 37.0 37.0 37.0 37.0 10-14 36.1774 37.0 37.0 37.0 37.0 37.0 15-19 36.0693 37.0 37.0 37.0 37.0 37.0 20-24 36.1171 37.0 37.0 37.0 37.0 37.0 25-29 36.0375 37.0 37.0 37.0 37.0 37.0 30-34 36.0809 37.0 37.0 37.0 37.0 37.0 35-39 36.001999999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.9869 37.0 37.0 37.0 37.0 37.0 45-49 35.9046 37.0 37.0 37.0 37.0 37.0 50-54 35.8759 37.0 37.0 37.0 37.0 37.0 55-59 35.842499999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.88590000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.757 37.0 37.0 37.0 37.0 37.0 70-74 35.7829 37.0 37.0 37.0 37.0 37.0 75-79 35.7372 37.0 37.0 37.0 37.0 37.0 80-84 35.7226 37.0 37.0 37.0 37.0 37.0 85-89 35.7455 37.0 37.0 37.0 37.0 37.0 90-94 35.7161 37.0 37.0 37.0 37.0 37.0 95-99 35.697199999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.6555 37.0 37.0 37.0 37.0 37.0 105-109 35.5621 37.0 37.0 37.0 37.0 37.0 110-114 35.39020000000001 37.0 37.0 37.0 34.6 37.0 115-119 35.5021 37.0 37.0 37.0 37.0 37.0 120-124 35.4274 37.0 37.0 37.0 34.6 37.0 125-129 35.390499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.442699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.298500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.384600000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.172000000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.76575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 5.0 15 4.0 16 1.0 17 2.0 18 1.0 19 2.0 20 2.0 21 3.0 22 5.0 23 6.0 24 3.0 25 6.0 26 10.0 27 12.0 28 17.0 29 32.0 30 27.0 31 53.0 32 81.0 33 115.0 34 217.0 35 571.0 36 2627.0 37 194.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.24362181090545 18.284142071035518 10.880440220110055 33.59179589794897 2 31.424999999999997 22.175 23.175 23.225 3 25.15 24.675 25.825 24.349999999999998 4 27.675 28.475 19.7 24.15 5 27.825 31.175000000000004 18.425 22.575 6 24.875 34.425 19.175 21.525 7 25.75 18.7 31.974999999999998 23.575 8 25.75 22.025 21.725 30.5 9 24.7 21.4 26.8 27.1 10-14 26.150000000000002 24.51 22.34 27.0 15-19 26.265 24.535 22.67 26.529999999999998 20-24 26.174999999999997 24.9 22.955000000000002 25.97 25-29 26.540000000000003 24.215 22.855 26.39 30-34 26.11 24.83 22.875 26.185000000000002 35-39 26.484999999999996 24.75 22.8 25.965 40-44 26.334999999999997 24.165 23.28 26.22 45-49 26.290000000000003 24.745 22.82 26.145000000000003 50-54 26.834999999999997 24.94 22.689999999999998 25.535000000000004 55-59 26.729999999999997 24.55 23.385 25.335 60-64 26.840000000000003 24.73 23.330000000000002 25.1 65-69 27.46 25.105 22.545 24.89 70-74 26.705000000000002 24.55 23.25 25.495 75-79 27.195000000000004 24.195 23.0 25.61 80-84 27.125 24.54 23.095 25.240000000000002 85-89 27.465 24.349999999999998 22.945 25.240000000000002 90-94 27.71 24.21 23.345 24.735 95-99 26.979999999999997 24.44 23.615 24.965 100-104 27.805000000000003 24.015 23.244999999999997 24.935 105-109 27.405 24.435000000000002 22.93 25.230000000000004 110-114 26.875 25.05 23.075000000000003 25.0 115-119 27.334999999999997 24.6 23.175 24.89 120-124 27.224999999999998 24.755 23.25 24.77 125-129 26.779999999999998 24.525 23.369999999999997 25.324999999999996 130-134 27.32 24.195 23.445 25.040000000000003 135-139 26.57 25.009999999999998 23.54 24.88 140-144 27.175 24.6 23.145 25.080000000000002 145-149 27.435 24.73 22.7 25.135 150-151 27.0125 24.587500000000002 24.4875 23.9125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 1.0 27 1.0 28 0.5 29 0.5 30 0.0 31 2.0 32 4.5 33 7.0 34 11.5 35 19.5 36 27.0 37 37.0 38 53.0 39 67.5 40 85.0 41 110.5 42 128.0 43 138.0 44 156.5 45 168.5 46 158.5 47 159.5 48 175.0 49 171.5 50 157.0 51 147.5 52 142.5 53 142.0 54 138.0 55 128.5 56 115.0 57 103.5 58 98.5 59 91.5 60 88.5 61 92.5 62 87.0 63 82.5 64 79.0 65 71.0 66 70.5 67 68.5 68 68.5 69 66.5 70 59.0 71 45.5 72 31.5 73 26.5 74 20.0 75 17.0 76 20.5 77 14.5 78 6.5 79 7.5 80 6.5 81 2.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.27734894862922 88.55 2 5.190311418685121 9.75 3 0.4524886877828055 1.275 4 0.026616981634282673 0.1 5 0.026616981634282673 0.125 6 0.0 0.0 7 0.0 0.0 8 0.026616981634282673 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AAGCAACAAGACAGTGAGGAGGGTGCGTGTCCGTGGAGGCAATGTCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.5875 0.0 0.0 0.0 0.0 128-129 0.6625000000000001 0.0 0.0 0.0 0.0 130-131 0.7875000000000001 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 0.9624999999999999 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138-139 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTCCG 10 0.006830828 145.0 5 >>END_MODULE Read 1646036 spots for SRR7804121.sra Written 1646036 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra Read 1646032 spots for SRR7804121.sra Written 1646032 spots for SRR7804121.sra SRR ids: ['SRR7804121.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_81tiwuyo SRR7804121.sra spots: 32920644 blocks: [[1, 1646032], [1646033, 3292064], [3292065, 4938096], [4938097, 6584128], [6584129, 8230160], [8230161, 9876192], [9876193, 11522224], [11522225, 13168256], [13168257, 14814288], [14814289, 16460320], [16460321, 18106352], [18106353, 19752384], [19752385, 21398416], [21398417, 23044448], [23044449, 24690480], [24690481, 26336512], [26336513, 27982544], [27982545, 29628576], [29628577, 31274608], [31274609, 32920644]] SRR7804121 file size 11134025 SRR7804121 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804121 SRR7804121_1.fastq SRR7804121_2.fastq Input file: SRR7804121_1.fastq Paired file: SRR7804121_2.fastq trimmed: SRR7804121-trimmed-pair1.fastq, SRR7804121-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:10:04 2024 >> started Tue Dec 10 02:10:55 2024 >> done (51.843s) 32920644 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 681 ( 0.00%) empty read pairs filtered out after trimming by size control 32919869 (100.00%) read pairs available; of these: 780143 ( 2.37%) trimmed read pairs available after processing 32139726 (97.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 7 0.00% 20 12 0.00% 21 6 0.00% 22 14 0.00% 23 8 0.00% 24 12 0.00% 25 22 0.00% 26 22 0.00% 27 16 0.00% 28 20 0.00% 29 20 0.00% 30 23 0.00% 31 26 0.00% 32 30 0.00% 33 24 0.00% 34 25 0.00% 35 37 0.00% 36 28 0.00% 37 21 0.00% 38 38 0.00% 39 35 0.00% 40 40 0.00% 41 37 0.00% 42 41 0.00% 43 34 0.00% 44 46 0.00% 45 29 0.00% 46 37 0.00% 47 37 0.00% 48 35 0.00% 49 58 0.00% 50 47 0.00% 51 34 0.00% 52 47 0.00% 53 47 0.00% 54 55 0.00% 55 44 0.00% 56 65 0.00% 57 50 0.00% 58 66 0.00% 59 72 0.00% 60 73 0.00% 61 73 0.00% 62 86 0.00% 63 71 0.00% 64 73 0.00% 65 90 0.00% 66 79 0.00% 67 115 0.00% 68 90 0.00% 69 99 0.00% 70 118 0.00% 71 127 0.00% 72 159 0.00% 73 173 0.00% 74 177 0.00% 75 231 0.00% 76 215 0.00% 77 270 0.00% 78 296 0.00% 79 300 0.00% 80 390 0.00% 81 364 0.00% 82 473 0.00% 83 496 0.00% 84 597 0.00% 85 621 0.00% 86 701 0.00% 87 780 0.00% 88 934 0.00% 89 963 0.00% 90 1105 0.00% 91 1215 0.00% 92 1329 0.00% 93 1482 0.00% 94 1673 0.01% 95 1763 0.01% 96 2032 0.01% 97 2160 0.01% 98 2281 0.01% 99 2490 0.01% 100 2645 0.01% 101 2958 0.01% 102 3280 0.01% 103 3451 0.01% 104 3759 0.01% 105 4014 0.01% 106 4389 0.01% 107 4461 0.01% 108 4748 0.01% 109 5291 0.02% 110 5530 0.02% 111 5841 0.02% 112 6239 0.02% 113 6619 0.02% 114 7089 0.02% 115 7623 0.02% 116 7867 0.02% 117 8246 0.03% 118 8854 0.03% 119 9314 0.03% 120 9791 0.03% 121 10206 0.03% 122 10912 0.03% 123 11468 0.03% 124 11961 0.04% 125 12609 0.04% 126 13443 0.04% 127 14052 0.04% 128 14379 0.04% 129 15230 0.05% 130 15668 0.05% 131 16366 0.05% 132 17302 0.05% 133 17923 0.05% 134 18776 0.06% 135 19678 0.06% 136 20651 0.06% 137 21457 0.07% 138 22000 0.07% 139 23066 0.07% 140 23949 0.07% 141 24724 0.08% 142 26327 0.08% 143 27159 0.08% 144 28242 0.09% 145 29143 0.09% 146 30482 0.09% 147 31452 0.10% 148 33035 0.10% 149 33591 0.10% 150 34742 0.11% 151 32139726 97.63% 32919869 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=11.46 fanout-score-rank=16 prefix-density=0.40 prefix-fanout=6.6 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=526.60 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=24.9 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=34 prefix-density=0.39 prefix-fanout=2.4 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=727.99 fanout-score-rank=1 prefix-density=1.22 prefix-fanout=18.6 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804121 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:11:46 Started mapping on | Dec 10 02:11:48 Finished on | Dec 10 02:16:47 Mapping speed, Million of reads per hour | 396.36 Number of input reads | 32919869 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 30417084 Uniquely mapped reads % | 92.40% Average mapped length | 299.90 Number of splices: Total | 33000503 Number of splices: Annotated (sjdb) | 31149625 Number of splices: GT/AG | 32541536 Number of splices: GC/AG | 367452 Number of splices: AT/AC | 27544 Number of splices: Non-canonical | 63971 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 526004 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 32045 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.22% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1976781 1976781 1976781 N_multimapping 526004 526004 526004 N_noFeature 568092 29702120 779572 N_ambiguous 585455 4891 84327 UnstrandedReadsAssigned:29263537 PositiveStrandReadsAssigned:710073 NegativeStrandReadsAssigned:29553185 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804121 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804121-trimmed-pair1.fastq SRR7804121-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,919,869 reads, 29,942,963 reads pseudoaligned [quant] estimated average fragment length: 305.219 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR7804121.ke.tsv 35125 SRR7804121.se.tsv 88098 total ==> SRR7804121.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 632.397 133.852 9.1462 PNS24247 1044 739.781 79.8727 4.66555 PNS24249 1928 1623.78 260.149 6.92314 PNS24246 1044 739.781 79.8727 4.66555 PNS24248 1044 739.781 79.8727 4.66555 PNS24244 1471 1166.78 114.381 4.23616 PNS24243 293 70.6304 0 0 KQK14069 1603 1298.78 1663.03 55.3314 KQK14071 474 198.012 9.83106 2.14544 ==> SRR7804121.se.tsv <== BRADI_1g14170v3 1731 BRADI_1g53295v3 818 BRADI_1g59795v3 252 BRADI_1g07683v3 0 BRADI_1g00485v3 126 BRADI_1g20270v3 4992 BRADI_1g74790v3 33 BRADI_1g09890v3 0 BRADI_1g77505v3 326 BRADI_1g48960v3 0 SRR7804121 completed mapping pipeline successfully