Starting /dee2/code/volunteer_pipeline.sh SRR7804122 current disk space = 1525351841792 free memory = 1601805476 SRR7804122 SRAfilesize 146ab89e9975fee7c63240b3703051a5 SRR7804122.sra SRR7804122.sra file validated SRR7804122 is paired end SRR7804122 is conventional basespace SRR7804122 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2585 37.0 37.0 37.0 37.0 37.0 2 36.3155 37.0 37.0 37.0 37.0 37.0 3 36.4125 37.0 37.0 37.0 37.0 37.0 4 36.4365 37.0 37.0 37.0 37.0 37.0 5 36.4685 37.0 37.0 37.0 37.0 37.0 6 36.4205 37.0 37.0 37.0 37.0 37.0 7 36.3465 37.0 37.0 37.0 37.0 37.0 8 36.3995 37.0 37.0 37.0 37.0 37.0 9 36.4585 37.0 37.0 37.0 37.0 37.0 10-14 36.46319999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.425 37.0 37.0 37.0 37.0 37.0 20-24 36.44029999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.418600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3519 37.0 37.0 37.0 37.0 37.0 35-39 36.3592 37.0 37.0 37.0 37.0 37.0 40-44 36.338 37.0 37.0 37.0 37.0 37.0 45-49 36.3613 37.0 37.0 37.0 37.0 37.0 50-54 36.298500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2973 37.0 37.0 37.0 37.0 37.0 60-64 36.283500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.274800000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.1673 37.0 37.0 37.0 37.0 37.0 75-79 36.1965 37.0 37.0 37.0 37.0 37.0 80-84 36.11 37.0 37.0 37.0 37.0 37.0 85-89 36.151500000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1472 37.0 37.0 37.0 37.0 37.0 95-99 36.1097 37.0 37.0 37.0 37.0 37.0 100-104 36.0617 37.0 37.0 37.0 37.0 37.0 105-109 36.03680000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.029199999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0021 37.0 37.0 37.0 37.0 37.0 120-124 35.9607 37.0 37.0 37.0 37.0 37.0 125-129 35.8904 37.0 37.0 37.0 37.0 37.0 130-134 35.8167 37.0 37.0 37.0 37.0 37.0 135-139 35.802800000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.6658 37.0 37.0 37.0 37.0 37.0 145-149 35.73270000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.214 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 0.0 24 1.0 25 2.0 26 8.0 27 13.0 28 19.0 29 23.0 30 34.0 31 43.0 32 63.0 33 72.0 34 137.0 35 332.0 36 2879.0 37 370.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.25 13.075000000000001 7.95 33.725 2 27.666499749624435 12.794191286930396 29.44416624937406 30.095142714071105 3 22.0 16.2 23.3 38.5 4 27.125 21.3 21.8 29.775000000000002 5 26.674999999999997 24.05 22.725 26.55 6 26.0 27.975 23.025000000000002 23.0 7 19.75 23.65 35.625 20.974999999999998 8 21.425 23.425 28.349999999999998 26.8 9 21.05 22.675 31.1 25.174999999999997 10-14 24.32 24.945 24.375 26.36 15-19 23.735 24.635 25.035 26.595000000000002 20-24 24.44 24.805 24.275 26.479999999999997 25-29 24.32 24.585 24.62 26.474999999999998 30-34 24.055 24.435000000000002 24.610000000000003 26.900000000000002 35-39 24.25 24.48 24.595 26.674999999999997 40-44 24.395 24.26 24.3 27.045 45-49 25.27 24.005000000000003 23.885 26.840000000000003 50-54 24.29 24.575 24.36 26.775 55-59 24.955 24.51 24.32 26.215 60-64 24.935 24.185000000000002 23.955000000000002 26.924999999999997 65-69 24.485 24.215 24.645 26.655 70-74 25.22 23.849999999999998 23.9 27.029999999999998 75-79 25.285000000000004 23.585 24.529999999999998 26.6 80-84 25.03 24.315 23.175 27.48 85-89 24.775 24.13 23.96 27.134999999999998 90-94 25.5 23.945 23.435 27.12 95-99 25.295 23.65 24.125 26.93 100-104 25.174999999999997 23.375 24.22 27.229999999999997 105-109 25.735000000000003 23.915 23.695 26.655 110-114 25.35 23.535 23.68 27.435 115-119 25.045 23.294999999999998 24.154999999999998 27.505000000000003 120-124 25.44 23.46 23.35 27.750000000000004 125-129 25.69 23.515 23.365 27.43 130-134 25.535000000000004 23.595 23.669999999999998 27.200000000000003 135-139 25.46 23.635 23.36 27.544999999999998 140-144 25.580000000000002 23.35 23.74 27.33 145-149 25.785000000000004 23.44 23.549999999999997 27.224999999999998 150-151 25.837500000000002 22.475 23.775 27.9125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 0.5 29 3.5 30 6.0 31 9.0 32 12.5 33 16.5 34 23.5 35 33.0 36 38.0 37 50.5 38 63.0 39 78.5 40 95.0 41 110.5 42 133.0 43 147.5 44 173.0 45 181.5 46 184.0 47 188.0 48 167.5 49 148.5 50 140.0 51 140.5 52 128.0 53 106.5 54 101.5 55 110.0 56 100.5 57 84.0 58 88.5 59 98.0 60 99.0 61 90.5 62 88.0 63 76.5 64 59.0 65 68.5 66 81.5 67 67.5 68 57.5 69 53.5 70 50.5 71 49.0 72 41.5 73 43.5 74 29.5 75 17.0 76 21.0 77 15.5 78 9.5 79 4.5 80 3.5 81 3.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12858660998937 88.575 2 5.472901168969182 10.299999999999999 3 0.3985122210414453 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 0.9625 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.475 0.0 0.0 0.0 0.0 138-139 1.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCGA 10 0.006830828 145.0 4 CAGCAGG 10 0.006830828 145.0 9 GTCGAAG 10 0.006830828 145.0 6 GTTGTCG 10 0.006830828 145.0 3 >>END_MODULE SRR7804122 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36 37.0 37.0 37.0 37.0 37.0 2 36.0 37.0 37.0 37.0 37.0 37.0 3 36.037 37.0 37.0 37.0 37.0 37.0 4 36.2575 37.0 37.0 37.0 37.0 37.0 5 36.1265 37.0 37.0 37.0 37.0 37.0 6 36.1725 37.0 37.0 37.0 37.0 37.0 7 36.0425 37.0 37.0 37.0 37.0 37.0 8 36.19 37.0 37.0 37.0 37.0 37.0 9 36.027 37.0 37.0 37.0 37.0 37.0 10-14 36.1034 37.0 37.0 37.0 37.0 37.0 15-19 36.010799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0034 37.0 37.0 37.0 37.0 37.0 25-29 35.9711 37.0 37.0 37.0 37.0 37.0 30-34 35.9609 37.0 37.0 37.0 37.0 37.0 35-39 35.975 37.0 37.0 37.0 37.0 37.0 40-44 35.9433 37.0 37.0 37.0 37.0 37.0 45-49 35.919000000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.8334 37.0 37.0 37.0 37.0 37.0 55-59 35.7916 37.0 37.0 37.0 37.0 37.0 60-64 35.8207 37.0 37.0 37.0 37.0 37.0 65-69 35.7952 37.0 37.0 37.0 37.0 37.0 70-74 35.848299999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.800399999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.699200000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.7673 37.0 37.0 37.0 37.0 37.0 90-94 35.7267 37.0 37.0 37.0 37.0 37.0 95-99 35.6722 37.0 37.0 37.0 37.0 37.0 100-104 35.7238 37.0 37.0 37.0 37.0 37.0 105-109 35.6298 37.0 37.0 37.0 37.0 37.0 110-114 35.4718 37.0 37.0 37.0 37.0 37.0 115-119 35.51899999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.501099999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.445499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.4502 37.0 37.0 37.0 37.0 37.0 135-139 35.3639 37.0 37.0 37.0 37.0 37.0 140-144 35.3074 37.0 37.0 37.0 32.2 37.0 145-149 35.185500000000005 37.0 37.0 37.0 27.4 37.0 150-151 34.766999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 2.0 14 8.0 15 6.0 16 4.0 17 0.0 18 6.0 19 4.0 20 8.0 21 7.0 22 12.0 23 14.0 24 11.0 25 10.0 26 14.0 27 12.0 28 17.0 29 18.0 30 33.0 31 33.0 32 47.0 33 75.0 34 178.0 35 448.0 36 2725.0 37 305.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.95 19.625 11.3 30.125 2 31.900000000000002 23.175 21.625 23.3 3 25.374999999999996 25.7 25.4 23.525 4 27.950000000000003 28.799999999999997 19.375 23.875 5 29.7 29.95 18.075 22.275 6 26.375 32.925 17.775 22.925 7 24.9 19.55 31.974999999999998 23.575 8 26.625 22.45 21.475 29.45 9 24.525 22.575 26.25 26.650000000000002 10-14 27.205000000000002 25.245 21.07 26.479999999999997 15-19 27.474999999999998 24.154999999999998 22.59 25.779999999999998 20-24 27.13 24.09 22.28 26.5 25-29 26.895000000000003 24.72 22.05 26.334999999999997 30-34 26.455000000000002 25.06 22.13 26.355 35-39 26.790000000000003 24.87 21.985 26.355 40-44 26.674999999999997 24.425 22.785 26.115 45-49 27.145000000000003 24.355 21.72 26.779999999999998 50-54 27.250000000000004 24.675 22.33 25.745 55-59 27.325 24.205 22.564999999999998 25.905 60-64 27.200000000000003 24.474999999999998 22.134999999999998 26.19 65-69 26.47 24.605 22.63 26.295 70-74 26.645000000000003 24.205 22.43 26.72 75-79 27.084999999999997 24.240000000000002 22.31 26.365 80-84 27.1 24.29 22.515 26.095000000000002 85-89 27.400000000000002 23.73 22.585 26.284999999999997 90-94 27.224999999999998 24.48 21.85 26.445 95-99 27.455000000000002 24.154999999999998 22.63 25.759999999999998 100-104 27.35 23.865 22.33 26.455000000000002 105-109 27.58 24.275 22.49 25.655 110-114 27.634999999999998 24.69 21.965 25.71 115-119 27.944999999999997 23.965 22.645 25.445 120-124 27.439999999999998 24.895 22.035 25.629999999999995 125-129 27.650000000000002 23.919999999999998 22.720000000000002 25.71 130-134 27.034999999999997 24.705 22.15 26.11 135-139 26.895000000000003 25.355 22.465 25.285000000000004 140-144 27.655 25.069999999999997 22.2 25.074999999999996 145-149 27.63 24.925 22.11 25.335 150-151 27.175 24.7 23.5125 24.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.5 2 1.5 3 0.5 4 0.5 5 0.5 6 0.5 7 1.0 8 1.5 9 2.0 10 1.5 11 1.5 12 2.5 13 1.5 14 3.0 15 4.0 16 2.0 17 2.0 18 2.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 1.0 25 1.0 26 3.0 27 3.5 28 2.5 29 2.5 30 3.5 31 5.5 32 6.5 33 10.0 34 16.0 35 22.0 36 27.0 37 27.5 38 38.5 39 64.5 40 88.5 41 100.5 42 130.5 43 150.0 44 131.5 45 128.0 46 148.0 47 152.0 48 148.5 49 141.5 50 137.0 51 135.5 52 113.5 53 106.5 54 111.0 55 105.5 56 105.5 57 105.5 58 99.0 59 111.5 60 112.5 61 100.0 62 102.0 63 95.0 64 81.0 65 82.5 66 93.5 67 97.0 68 80.5 69 70.0 70 63.0 71 54.5 72 50.0 73 42.5 74 36.5 75 26.5 76 22.5 77 20.0 78 14.5 79 9.0 80 6.0 81 2.5 82 2.0 83 2.5 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 1.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.27582534611288 88.52499999999999 2 5.271565495207668 9.9 3 0.34611288604898827 0.975 4 0.026624068157614485 0.1 5 0.05324813631522897 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026624068157614485 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit ATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTC 5 0.125 No Hit CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0125 0.0 0.0 80-81 0.037500000000000006 0.0 0.025 0.0 0.0 82-83 0.05 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.05 0.0 0.025 0.0 0.0 88-89 0.05 0.0 0.025 0.0 0.0 90-91 0.05 0.0 0.025 0.0 0.0 92-93 0.05 0.0 0.025 0.0 0.0 94-95 0.05 0.0 0.025 0.0 0.0 96-97 0.05 0.0 0.025 0.0 0.0 98-99 0.1125 0.0 0.025 0.0 0.0 100-101 0.15 0.0 0.025 0.0 0.0 102-103 0.1875 0.0 0.025 0.0 0.0 104-105 0.2 0.0 0.025 0.0 0.0 106-107 0.225 0.0 0.025 0.0 0.0 108-109 0.275 0.0 0.025 0.0 0.0 110-111 0.3 0.0 0.025 0.0 0.0 112-113 0.3125 0.0 0.025 0.0 0.0 114-115 0.35 0.0 0.025 0.0 0.0 116-117 0.35 0.0 0.025 0.0 0.0 118-119 0.3875 0.0 0.025 0.0 0.0 120-121 0.42500000000000004 0.0 0.025 0.0 0.0 122-123 0.5 0.0 0.025 0.0 0.0 124-125 0.6000000000000001 0.0 0.025 0.0 0.0 126-127 0.725 0.0 0.025 0.0 0.0 128-129 0.85 0.0 0.025 0.0 0.0 130-131 0.9874999999999999 0.0 0.025 0.0 0.0 132-133 1.15 0.0 0.025 0.0 0.0 134-135 1.3624999999999998 0.0 0.025 0.0 0.0 136-137 1.5 0.0 0.025 0.0 0.0 138-139 1.7125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAA 10 0.006830828 145.0 1 >>END_MODULE Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606416 spots for SRR7804122.sra Written 1606416 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra Read 1606413 spots for SRR7804122.sra Written 1606413 spots for SRR7804122.sra SRR ids: ['SRR7804122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dm0qmslu SRR7804122.sra spots: 32128263 blocks: [[1, 1606413], [1606414, 3212826], [3212827, 4819239], [4819240, 6425652], [6425653, 8032065], [8032066, 9638478], [9638479, 11244891], [11244892, 12851304], [12851305, 14457717], [14457718, 16064130], [16064131, 17670543], [17670544, 19276956], [19276957, 20883369], [20883370, 22489782], [22489783, 24096195], [24096196, 25702608], [25702609, 27309021], [27309022, 28915434], [28915435, 30521847], [30521848, 32128263]] SRR7804122 file size 10865513 SRR7804122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804122 SRR7804122_1.fastq SRR7804122_2.fastq Input file: SRR7804122_1.fastq Paired file: SRR7804122_2.fastq trimmed: SRR7804122-trimmed-pair1.fastq, SRR7804122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:13:13 2024 >> started Tue Dec 10 02:13:49 2024 >> done (35.594s) 32128263 read pairs processed; of these: 89 ( 0.00%) short read pairs filtered out after trimming by size control 1012 ( 0.00%) empty read pairs filtered out after trimming by size control 32127162 (100.00%) read pairs available; of these: 830495 ( 2.59%) trimmed read pairs available after processing 31296667 (97.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 7 0.00% 20 10 0.00% 21 15 0.00% 22 14 0.00% 23 14 0.00% 24 22 0.00% 25 15 0.00% 26 24 0.00% 27 18 0.00% 28 20 0.00% 29 18 0.00% 30 15 0.00% 31 25 0.00% 32 30 0.00% 33 31 0.00% 34 26 0.00% 35 34 0.00% 36 28 0.00% 37 29 0.00% 38 30 0.00% 39 19 0.00% 40 35 0.00% 41 26 0.00% 42 31 0.00% 43 33 0.00% 44 34 0.00% 45 35 0.00% 46 38 0.00% 47 31 0.00% 48 43 0.00% 49 35 0.00% 50 48 0.00% 51 39 0.00% 52 47 0.00% 53 49 0.00% 54 48 0.00% 55 49 0.00% 56 49 0.00% 57 43 0.00% 58 58 0.00% 59 55 0.00% 60 63 0.00% 61 73 0.00% 62 80 0.00% 63 71 0.00% 64 71 0.00% 65 88 0.00% 66 88 0.00% 67 79 0.00% 68 114 0.00% 69 97 0.00% 70 101 0.00% 71 135 0.00% 72 132 0.00% 73 166 0.00% 74 156 0.00% 75 180 0.00% 76 217 0.00% 77 208 0.00% 78 280 0.00% 79 286 0.00% 80 300 0.00% 81 370 0.00% 82 430 0.00% 83 456 0.00% 84 487 0.00% 85 593 0.00% 86 632 0.00% 87 642 0.00% 88 818 0.00% 89 843 0.00% 90 1022 0.00% 91 1117 0.00% 92 1176 0.00% 93 1441 0.00% 94 1474 0.00% 95 1744 0.01% 96 1857 0.01% 97 2139 0.01% 98 2148 0.01% 99 2386 0.01% 100 2613 0.01% 101 2875 0.01% 102 3013 0.01% 103 3393 0.01% 104 3473 0.01% 105 3890 0.01% 106 4254 0.01% 107 4462 0.01% 108 4862 0.02% 109 5187 0.02% 110 5444 0.02% 111 5975 0.02% 112 6290 0.02% 113 6833 0.02% 114 7340 0.02% 115 7677 0.02% 116 7926 0.02% 117 8782 0.03% 118 9155 0.03% 119 9426 0.03% 120 10322 0.03% 121 10838 0.03% 122 11126 0.03% 123 12194 0.04% 124 12638 0.04% 125 13336 0.04% 126 13982 0.04% 127 14891 0.05% 128 15432 0.05% 129 16219 0.05% 130 16838 0.05% 131 17598 0.05% 132 18355 0.06% 133 19389 0.06% 134 20530 0.06% 135 21367 0.07% 136 22309 0.07% 137 23168 0.07% 138 23657 0.07% 139 25025 0.08% 140 26065 0.08% 141 26963 0.08% 142 28238 0.09% 143 28835 0.09% 144 30827 0.10% 145 32353 0.10% 146 33352 0.10% 147 34558 0.11% 148 35824 0.11% 149 36797 0.11% 150 38557 0.12% 151 31296667 97.41% 32127162 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=23 prefix-density=0.97 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=57.84 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=9.9 sequence=GAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCAAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTCACTGGGTCGGACAGGTGGTCGGCCAGGTTCTCGAG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=7 prefix-density=0.81 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=80.33 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=8.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804122 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:14:40 Started mapping on | Dec 10 02:14:40 Finished on | Dec 10 02:19:09 Mapping speed, Million of reads per hour | 429.95 Number of input reads | 32127162 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 29462699 Uniquely mapped reads % | 91.71% Average mapped length | 299.83 Number of splices: Total | 30271358 Number of splices: Annotated (sjdb) | 28528763 Number of splices: GT/AG | 29821211 Number of splices: GC/AG | 369386 Number of splices: AT/AC | 13322 Number of splices: Non-canonical | 67439 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468044 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 36488 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.89% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2196419 2196419 2196419 N_multimapping 468044 468044 468044 N_noFeature 912310 28564763 1131180 N_ambiguous 842743 5289 164419 UnstrandedReadsAssigned:27707646 PositiveStrandReadsAssigned:892647 NegativeStrandReadsAssigned:28167100 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804122-trimmed-pair1.fastq SRR7804122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,127,162 reads, 28,586,789 reads pseudoaligned [quant] estimated average fragment length: 299.792 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52973 SRR7804122.ke.tsv 35125 SRR7804122.se.tsv 88098 total ==> SRR7804122.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 637.654 0 0 PNS24247 1044 745.208 93.2182 5.44985 PNS24249 1928 1629.21 206.433 5.52031 PNS24246 1044 745.208 93.2182 5.44985 PNS24248 1044 745.208 93.2182 5.44985 PNS24244 1471 1172.21 130.913 4.86562 PNS24243 293 72.5127 0 0 KQK14069 1603 1304.21 878.02 29.3305 KQK14071 474 199.781 12.9587 2.82597 ==> SRR7804122.se.tsv <== BRADI_1g14170v3 949 BRADI_1g53295v3 1622 BRADI_1g59795v3 725 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 1485 BRADI_1g74790v3 904 BRADI_1g09890v3 13 BRADI_1g77505v3 603 BRADI_1g48960v3 0 SRR7804122 completed mapping pipeline successfully