Starting /dee2/code/volunteer_pipeline.sh SRR7804123 current disk space = 1525372162048 free memory = 1456682028 SRR7804123 SRAfilesize a70ec0e3f63e412b26bccd64527d0853 SRR7804123.sra SRR7804123.sra file validated SRR7804123 is paired end SRR7804123 is conventional basespace SRR7804123 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4015 37.0 37.0 37.0 37.0 37.0 2 36.308 37.0 37.0 37.0 37.0 37.0 3 36.543 37.0 37.0 37.0 37.0 37.0 4 36.566 37.0 37.0 37.0 37.0 37.0 5 36.6455 37.0 37.0 37.0 37.0 37.0 6 36.558 37.0 37.0 37.0 37.0 37.0 7 36.4625 37.0 37.0 37.0 37.0 37.0 8 36.5565 37.0 37.0 37.0 37.0 37.0 9 36.585 37.0 37.0 37.0 37.0 37.0 10-14 36.5563 37.0 37.0 37.0 37.0 37.0 15-19 36.531699999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.564800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.497 37.0 37.0 37.0 37.0 37.0 30-34 36.48779999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.49400000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4395 37.0 37.0 37.0 37.0 37.0 45-49 36.44070000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.3669 37.0 37.0 37.0 37.0 37.0 55-59 36.4064 37.0 37.0 37.0 37.0 37.0 60-64 36.404700000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3743 37.0 37.0 37.0 37.0 37.0 70-74 36.3044 37.0 37.0 37.0 37.0 37.0 75-79 36.332100000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2918 37.0 37.0 37.0 37.0 37.0 85-89 36.270900000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2096 37.0 37.0 37.0 37.0 37.0 95-99 36.1956 37.0 37.0 37.0 37.0 37.0 100-104 36.1783 37.0 37.0 37.0 37.0 37.0 105-109 36.10329999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.079499999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.057900000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.025 37.0 37.0 37.0 37.0 37.0 125-129 35.9563 37.0 37.0 37.0 37.0 37.0 130-134 35.9409 37.0 37.0 37.0 37.0 37.0 135-139 35.881 37.0 37.0 37.0 37.0 37.0 140-144 35.809200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.7707 37.0 37.0 37.0 37.0 37.0 150-151 35.29975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 3.0 25 4.0 26 3.0 27 9.0 28 13.0 29 19.0 30 29.0 31 37.0 32 42.0 33 94.0 34 114.0 35 288.0 36 2845.0 37 497.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.475 13.575000000000001 10.7 32.25 2 26.8 13.8 31.275 28.125 3 23.75 18.75 25.0 32.5 4 24.2 25.275 23.125 27.400000000000002 5 23.775 29.25 25.1 21.875 6 25.650000000000002 29.95 22.650000000000002 21.75 7 18.224999999999998 24.725 36.75 20.3 8 20.95 24.4 28.549999999999997 26.1 9 21.0 22.7 30.45 25.85 10-14 23.369999999999997 26.44 25.36 24.83 15-19 23.494999999999997 25.46 25.535000000000004 25.509999999999998 20-24 23.1 25.990000000000002 25.47 25.44 25-29 23.935000000000002 25.22 25.275 25.569999999999997 30-34 23.565 25.34 24.94 26.155 35-39 23.39 25.66 24.404999999999998 26.545 40-44 23.71 24.985 25.145 26.16 45-49 23.810000000000002 25.685000000000002 24.15 26.355 50-54 23.65 25.305 25.290000000000003 25.755 55-59 23.294999999999998 24.815 25.41 26.479999999999997 60-64 23.669999999999998 24.925 24.565 26.840000000000003 65-69 23.68 25.345000000000002 24.355 26.619999999999997 70-74 23.925 25.369999999999997 24.5 26.205000000000002 75-79 23.91 24.990000000000002 24.79 26.31 80-84 24.12 24.59 24.585 26.705000000000002 85-89 24.38 25.224999999999998 24.595 25.8 90-94 24.565 25.415 23.849999999999998 26.169999999999998 95-99 24.48 24.435000000000002 24.755 26.33 100-104 24.5 24.595 24.7 26.205000000000002 105-109 24.25 24.7 24.654999999999998 26.395000000000003 110-114 23.974999999999998 24.495 24.68 26.85 115-119 24.725 25.105 24.065 26.105 120-124 25.074999999999996 24.959999999999997 23.96 26.005 125-129 24.67 23.835 24.474999999999998 27.02 130-134 24.635 24.425 24.545 26.395000000000003 135-139 24.95 24.505 24.385 26.16 140-144 24.84 24.355 24.5 26.305 145-149 25.255 23.915 24.51 26.32 150-151 24.637500000000003 24.0375 24.5 26.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.5 25 3.0 26 3.0 27 3.0 28 5.0 29 7.0 30 8.5 31 12.0 32 17.5 33 24.0 34 36.0 35 50.5 36 61.0 37 78.5 38 89.5 39 99.0 40 122.5 41 133.5 42 141.5 43 166.5 44 167.0 45 160.5 46 164.0 47 158.5 48 155.0 49 155.5 50 160.0 51 145.5 52 140.5 53 132.5 54 105.0 55 94.0 56 93.5 57 92.5 58 93.5 59 87.5 60 83.5 61 80.0 62 69.5 63 70.5 64 69.5 65 62.5 66 59.0 67 55.5 68 46.5 69 38.0 70 35.5 71 32.5 72 25.5 73 20.5 74 18.0 75 14.5 76 12.0 77 10.5 78 9.5 79 5.5 80 2.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.55 #Duplication Level Percentage of deduplicated Percentage of total 1 92.73365748244193 85.82499999999999 2 6.591031874662345 12.2 3 0.5942733657482442 1.6500000000000001 4 0.05402485143165856 0.2 5 0.02701242571582928 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.8500000000000001 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.6375000000000002 0.0 0.0 0.0 0.0 132-133 1.825 0.0 0.0 0.0 0.0 134-135 1.9625 0.0 0.0 0.0 0.0 136-137 2.0875000000000004 0.0 0.0 0.0 0.0 138-139 2.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCTGT 10 0.006830828 145.0 4 CGCTGTC 10 0.006830828 145.0 5 TTTTTTT 85 0.002429728 34.11765 1 >>END_MODULE SRR7804123 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.28425 37.0 37.0 37.0 37.0 37.0 2 36.0435 37.0 37.0 37.0 37.0 37.0 3 35.9415 37.0 37.0 37.0 37.0 37.0 4 36.1375 37.0 37.0 37.0 37.0 37.0 5 36.1705 37.0 37.0 37.0 37.0 37.0 6 36.13 37.0 37.0 37.0 37.0 37.0 7 35.937 37.0 37.0 37.0 37.0 37.0 8 36.183 37.0 37.0 37.0 37.0 37.0 9 36.0885 37.0 37.0 37.0 37.0 37.0 10-14 36.0594 37.0 37.0 37.0 37.0 37.0 15-19 35.9801 37.0 37.0 37.0 37.0 37.0 20-24 35.9949 37.0 37.0 37.0 37.0 37.0 25-29 35.943999999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.858 37.0 37.0 37.0 37.0 37.0 35-39 35.8386 37.0 37.0 37.0 37.0 37.0 40-44 35.8287 37.0 37.0 37.0 37.0 37.0 45-49 35.7673 37.0 37.0 37.0 37.0 37.0 50-54 35.766 37.0 37.0 37.0 37.0 37.0 55-59 35.7247 37.0 37.0 37.0 37.0 37.0 60-64 35.6786 37.0 37.0 37.0 37.0 37.0 65-69 35.6965 37.0 37.0 37.0 37.0 37.0 70-74 35.644400000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.668099999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.6288 37.0 37.0 37.0 37.0 37.0 85-89 35.64149999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.5641 37.0 37.0 37.0 37.0 37.0 95-99 35.5056 37.0 37.0 37.0 37.0 37.0 100-104 35.5268 37.0 37.0 37.0 37.0 37.0 105-109 35.442899999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.310199999999995 37.0 37.0 37.0 34.6 37.0 115-119 35.2831 37.0 37.0 37.0 34.6 37.0 120-124 35.28009999999999 37.0 37.0 37.0 32.2 37.0 125-129 35.2433 37.0 37.0 37.0 34.6 37.0 130-134 35.2632 37.0 37.0 37.0 34.6 37.0 135-139 35.1769 37.0 37.0 37.0 29.8 37.0 140-144 35.1018 37.0 37.0 37.0 25.0 37.0 145-149 34.9448 37.0 37.0 37.0 27.4 37.0 150-151 34.506 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 8.0 14 8.0 15 10.0 16 5.0 17 6.0 18 3.0 19 5.0 20 6.0 21 6.0 22 12.0 23 11.0 24 10.0 25 11.0 26 6.0 27 21.0 28 14.0 29 19.0 30 23.0 31 38.0 32 43.0 33 102.0 34 190.0 35 605.0 36 2614.0 37 223.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.85971492873218 19.079769942485623 11.727931982995749 30.332583145786447 2 32.125 22.925 24.425 20.525 3 26.224999999999998 25.174999999999997 25.85 22.75 4 28.075 28.775000000000002 19.525000000000002 23.625 5 30.049999999999997 31.624999999999996 18.55 19.775000000000002 6 26.575 33.300000000000004 18.25 21.875 7 24.875 20.075000000000003 32.35 22.7 8 27.125 22.325 20.925 29.625 9 24.925 21.975 25.974999999999998 27.125 10-14 26.915 25.7 22.255 25.130000000000003 15-19 26.755000000000003 24.759999999999998 23.085 25.4 20-24 27.425 25.290000000000003 22.73 24.555 25-29 27.689999999999998 24.735 22.955000000000002 24.62 30-34 26.865 24.86 23.485 24.79 35-39 26.88 25.005 22.695 25.419999999999998 40-44 27.49 24.94 22.705000000000002 24.865000000000002 45-49 27.18 24.68 23.27 24.87 50-54 26.55 25.22 22.99 25.240000000000002 55-59 26.83 25.27 22.825 25.074999999999996 60-64 26.645000000000003 24.215 24.115000000000002 25.025 65-69 26.46 24.65 23.235 25.655 70-74 26.584999999999997 24.955 23.544999999999998 24.915000000000003 75-79 26.055 24.395 24.315 25.235000000000003 80-84 27.455000000000002 24.834999999999997 22.555 25.155 85-89 26.755000000000003 24.97 23.13 25.145 90-94 27.04 24.759999999999998 23.59 24.610000000000003 95-99 27.025 24.485 23.669999999999998 24.82 100-104 27.12 24.905 23.615 24.36 105-109 26.974999999999998 24.675 23.13 25.22 110-114 27.05 25.345000000000002 23.04 24.565 115-119 27.395000000000003 24.47 23.87 24.265 120-124 27.11 25.14 23.54 24.21 125-129 27.275 25.430000000000003 23.1 24.195 130-134 27.205000000000002 25.805 22.919999999999998 24.07 135-139 26.540000000000003 24.825 23.880000000000003 24.755 140-144 27.3 24.905 23.71 24.085 145-149 27.465 25.259999999999998 23.75 23.525 150-151 27.1125 25.025 23.75 24.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.5 9 1.0 10 0.0 11 1.5 12 1.5 13 0.5 14 2.0 15 2.5 16 1.5 17 2.0 18 1.5 19 0.5 20 1.0 21 2.0 22 1.5 23 0.0 24 1.0 25 2.0 26 2.5 27 3.5 28 4.0 29 7.0 30 8.0 31 7.0 32 13.0 33 18.0 34 22.0 35 29.0 36 42.5 37 52.5 38 49.5 39 66.5 40 92.5 41 109.0 42 126.0 43 130.5 44 143.0 45 159.0 46 157.0 47 175.5 48 177.5 49 152.5 50 139.5 51 141.0 52 133.0 53 111.5 54 112.0 55 117.5 56 102.0 57 95.5 58 104.5 59 100.0 60 95.5 61 98.0 62 96.0 63 86.5 64 71.0 65 66.0 66 73.0 67 78.5 68 71.5 69 58.0 70 52.0 71 46.0 72 36.0 73 30.0 74 23.0 75 13.5 76 14.5 77 14.5 78 10.5 79 6.5 80 3.0 81 2.5 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 1.5 88 2.0 89 1.0 90 0.5 91 0.0 92 0.5 93 1.0 94 0.5 95 0.5 96 0.5 97 0.0 98 1.0 99 1.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.91317284284555 85.875 2 6.383554233162022 11.799999999999999 3 0.5950770895320531 1.6500000000000001 4 0.08114687584527995 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027048958615093318 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.0125 0.0 0.0 0.0 0.025 94-95 0.025 0.0 0.0 0.0 0.025 96-97 0.075 0.0 0.0 0.0 0.025 98-99 0.1 0.0 0.0 0.0 0.025 100-101 0.15 0.0 0.0 0.0 0.025 102-103 0.175 0.0 0.0 0.0 0.025 104-105 0.21250000000000002 0.0 0.0 0.0 0.025 106-107 0.2625 0.0 0.0 0.0 0.025 108-109 0.325 0.0 0.0 0.0 0.025 110-111 0.375 0.0 0.0 0.0 0.025 112-113 0.375 0.0 0.0 0.0 0.025 114-115 0.4 0.0 0.0 0.0 0.025 116-117 0.5125 0.0 0.0 0.0 0.025 118-119 0.6 0.0 0.0 0.0 0.025 120-121 0.7124999999999999 0.0 0.0 0.0 0.025 122-123 0.8500000000000001 0.0 0.0 0.0 0.025 124-125 1.1 0.0 0.0 0.0 0.025 126-127 1.25 0.0 0.0 0.0 0.025 128-129 1.475 0.0 0.0 0.0 0.025 130-131 1.6375000000000002 0.0 0.0 0.0 0.025 132-133 1.825 0.0 0.0 0.0 0.025 134-135 1.9625 0.0 0.0 0.0 0.025 136-137 2.0875000000000004 0.0 0.0 0.0 0.025 138-139 2.3375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928274 spots for SRR7804123.sra Written 928274 spots for SRR7804123.sra Read 928290 spots for SRR7804123.sra Written 928290 spots for SRR7804123.sra SRR ids: ['SRR7804123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k_bcfbcg SRR7804123.sra spots: 18565496 blocks: [[1, 928274], [928275, 1856548], [1856549, 2784822], [2784823, 3713096], [3713097, 4641370], [4641371, 5569644], [5569645, 6497918], [6497919, 7426192], [7426193, 8354466], [8354467, 9282740], [9282741, 10211014], [10211015, 11139288], [11139289, 12067562], [12067563, 12995836], [12995837, 13924110], [13924111, 14852384], [14852385, 15780658], [15780659, 16708932], [16708933, 17637206], [17637207, 18565496]] SRR7804123 file size 6269537 SRR7804123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804123 SRR7804123_1.fastq SRR7804123_2.fastq Input file: SRR7804123_1.fastq Paired file: SRR7804123_2.fastq trimmed: SRR7804123-trimmed-pair1.fastq, SRR7804123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:08:47 2024 >> started Tue Dec 10 02:09:19 2024 >> done (32.127s) 18565496 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 1947 ( 0.01%) empty read pairs filtered out after trimming by size control 18563442 (99.99%) read pairs available; of these: 807557 ( 4.35%) trimmed read pairs available after processing 17755885 (95.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 9 0.00% 21 7 0.00% 22 8 0.00% 23 6 0.00% 24 24 0.00% 25 13 0.00% 26 15 0.00% 27 10 0.00% 28 21 0.00% 29 17 0.00% 30 21 0.00% 31 13 0.00% 32 25 0.00% 33 17 0.00% 34 20 0.00% 35 19 0.00% 36 20 0.00% 37 23 0.00% 38 21 0.00% 39 23 0.00% 40 17 0.00% 41 22 0.00% 42 25 0.00% 43 32 0.00% 44 18 0.00% 45 20 0.00% 46 22 0.00% 47 34 0.00% 48 30 0.00% 49 41 0.00% 50 27 0.00% 51 39 0.00% 52 42 0.00% 53 42 0.00% 54 37 0.00% 55 38 0.00% 56 38 0.00% 57 33 0.00% 58 48 0.00% 59 50 0.00% 60 56 0.00% 61 59 0.00% 62 65 0.00% 63 79 0.00% 64 76 0.00% 65 86 0.00% 66 81 0.00% 67 87 0.00% 68 96 0.00% 69 72 0.00% 70 131 0.00% 71 127 0.00% 72 158 0.00% 73 180 0.00% 74 192 0.00% 75 229 0.00% 76 253 0.00% 77 287 0.00% 78 306 0.00% 79 335 0.00% 80 377 0.00% 81 368 0.00% 82 501 0.00% 83 537 0.00% 84 643 0.00% 85 768 0.00% 86 823 0.00% 87 830 0.00% 88 947 0.01% 89 1062 0.01% 90 1205 0.01% 91 1310 0.01% 92 1503 0.01% 93 1750 0.01% 94 1841 0.01% 95 1901 0.01% 96 2115 0.01% 97 2349 0.01% 98 2463 0.01% 99 2640 0.01% 100 2950 0.02% 101 3243 0.02% 102 3527 0.02% 103 3792 0.02% 104 4130 0.02% 105 4185 0.02% 106 4538 0.02% 107 5012 0.03% 108 5127 0.03% 109 5554 0.03% 110 5757 0.03% 111 6044 0.03% 112 6690 0.04% 113 7134 0.04% 114 7489 0.04% 115 8287 0.04% 116 8628 0.05% 117 8998 0.05% 118 9444 0.05% 119 9714 0.05% 120 10298 0.06% 121 10696 0.06% 122 11220 0.06% 123 11958 0.06% 124 12895 0.07% 125 13573 0.07% 126 14263 0.08% 127 14444 0.08% 128 15188 0.08% 129 15681 0.08% 130 16210 0.09% 131 16632 0.09% 132 17623 0.09% 133 18756 0.10% 134 20123 0.11% 135 20671 0.11% 136 21701 0.12% 137 22457 0.12% 138 22918 0.12% 139 24038 0.13% 140 24182 0.13% 141 25155 0.14% 142 26314 0.14% 143 27273 0.15% 144 28710 0.15% 145 30008 0.16% 146 31214 0.17% 147 31837 0.17% 148 32537 0.18% 149 33508 0.18% 150 35326 0.19% 151 17755885 95.65% 18563442 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=18 prefix-density=0.61 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=101.33 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=6.2 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=17 prefix-density=0.53 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=30.92 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.8 sequence=CAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAA SRR7804123 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:10:19 Started mapping on | Dec 10 02:10:20 Finished on | Dec 10 02:16:04 Mapping speed, Million of reads per hour | 194.27 Number of input reads | 18563442 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 15920088 Uniquely mapped reads % | 85.76% Average mapped length | 299.01 Number of splices: Total | 14740096 Number of splices: Annotated (sjdb) | 13868019 Number of splices: GT/AG | 14517238 Number of splices: GC/AG | 172186 Number of splices: AT/AC | 6093 Number of splices: Non-canonical | 44579 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429820 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 54285 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.21% % of reads unmapped: other | 2.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2213534 2213534 2213534 N_multimapping 429820 429820 429820 N_noFeature 790427 15396881 944320 N_ambiguous 452686 5810 83677 UnstrandedReadsAssigned:14676975 PositiveStrandReadsAssigned:517397 NegativeStrandReadsAssigned:14892091 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804123-trimmed-pair1.fastq SRR7804123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,563,442 reads, 15,210,348 reads pseudoaligned [quant] estimated average fragment length: 278.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52973 SRR7804123.ke.tsv 35125 SRR7804123.se.tsv 88098 total ==> SRR7804123.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.133 0 0 PNS24247 1044 766.72 109.603 11.5238 PNS24249 1928 1650.72 110.617 5.40206 PNS24246 1044 766.72 109.603 11.5238 PNS24248 1044 766.72 109.603 11.5238 PNS24244 1471 1193.72 222.575 15.0309 PNS24243 293 80.1343 0 0 KQK14069 1603 1325.72 4971.29 302.294 KQK14071 474 216.098 132.178 49.3083 ==> SRR7804123.se.tsv <== BRADI_1g14170v3 5483 BRADI_1g53295v3 843 BRADI_1g59795v3 751 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 274 BRADI_1g74790v3 1199 BRADI_1g09890v3 0 BRADI_1g77505v3 240 BRADI_1g48960v3 0 SRR7804123 completed mapping pipeline successfully